Overview

Brief Summary

The tiger swallowtail, or eastern tiger swallowtail (Papilio glaucus) is a species of the papilionid butterfly family native to North America. It is large butterfly (wingspan 7.9 – 14 cms), and one of the most familiar butterflies in the eastern United States, where it is common in many different habitats. It flies from spring to fall, during which time it produces two to three broods. Adults feed on the nectar of many species of flowers. Males are yellow with four black "tiger stripes" on each fore wing. Females are dimorphic in coloration, and can be found in as either a yellow or black morph. The yellow morph is similar to the male, while the dark form, which has long been thought to mimic the poisonous pipevine (blue) swallowtail, (Battus philenor), is almost completely black.

The eastern tiger swallowtail lays her green eggs singly on hostplants in many woody plant families, most commonly on Magnoliaceae and Rosaceae (for example, poplars, mountain ash, birch, cherry, tulip tree, ash, basswood, apple, maple, willow, magnolia, and occasionally sassafras). Young caterpillars (first three instars) are brown and white, with a coloration pattern that mimics bird droppings to help protect it from predators. In later instars, caterpillars are green with two black, yellow, and blue eyespots on the thorax, thought to deter birds. Caterpillars reach a length of 5.5 cm.

(Brower 1958; Roof 1999; Hall and Butler 2011; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

North American Ecology (US and Canada)

Resident in North America (Scott 1986). Habitats are DECIDUOUS WOODED AREAS. Host plants include species from many families. Hosts are usually trees or shrubs. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are are multiple flights each year with the approximate flight time MAY1-AUG30 in the northern part of the range and MAR1-NOV30 in the southern part of their range (Scott 1986).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The eastern tiger swallowtail ranges from Alaska and the Hudsonian zone of Canada to the southern United States, east of the Rocky Mountains.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout the central and eastern United States, north to extreme southern Canada (Ontario at least), and west to the Rocky Mountains. In general replaced by P. CANADENSIS from about central New England, central Michigan and southern Wisconsin northward. Exact range of these two species still a bit uncertain since they were considered conspecific into the 1990s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The forewing spans 4 to 7.6 cm. The males are yellow, with black tiger stripes. A large black border surrounds the edges of the wings. In Georgia, the coloring has more of an orange hint. The subspecies australis has been applied to these southeastern tiger swallowtails. Females are dimorphic. Some female swallowtails have the same color pattern as the males, while some are completely black. A variety of patterns between completely black, and yellow with black stripes can be seen in female swallowtails. These two extreme female colorings are thought to coexist because they both have equally beneficial effects. While the tiger striping causes a distracts predators, the dark coloring imitates the unpalatable blue swallowtail.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

This species occurs in nearly every area where deciduous woods are present, including towns and cities. It is most numerous along streams and river, and in wooded swamps.

Terrestrial Biomes: savanna or grassland ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults can occur in any habitat, but primary breeding habitats are deciduous or mixed forests, woodlands, swamps or less often thickets, old fields with wild cherries, parks, or suburban areas with foodplants. Suburban areas may sometimes be ecological sinks rather than habitat since manicured lawns do not provide adequate pupation sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Larvae are polyphagous, meaning they feed externally on the leaves of various woody plants. Foodplants include a variety of poplars, mountain ash, birch, cherry, tulip tree, ash, basswood, apple, maple, willow, magnolia, and occasionally sassafras.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Larvae of this species and its relatives are oliogophagous and often use more than one family at a given locality. E.g. Dale Schweitzer has observed individual wild females ovipositing on both tulip tree and wild cherry (Prunus serotina) that were growing together in Pennsylvania and Connecticut, and these two species are probably the most commonly used foodplants in most of the range. In southern New Jersey, larvae are common on sweetbay (Magnolia viriginiana) and Robert Barber and Dale Schweitzer found about 20 on this and three on Prunus serotina In Cumberland County in September and October 2002. Sweetbay is also used widely in Florida (Scriber et al., 2001). Those three appear to be by far the major foodplants in most of the range, but others are used. Consult recent literature regarding other foodplants. Ashes might be somewhat important. Some old literature records repeated in books as recently as Gochfeld and Burger (1997), such as aspens, willows, birches, refer to Papilio canadensis. Use of these by a population is probably be diagnostic for P. canadensis and ovipositing females are an easy way to identify populations in Massachusetts

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Papilio glaucus in Illinois

Papilio glaucus Linnaeus: Papilionidae, Lepidoptera
(observations are from Robertson, Graenicher, Wiggam & Ferguson, Hilty, Clinebell, Smith & Snow, Macior, and Luer; this butterfly is the Tiger Swallowtail)

Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias tuberosa [plab sn] (Rb); Asteraceae: Cirsium altissimum sn (Rb, Gr), Cirsium vulgare sn (Rb, Gr), Echinacea purpurea sn (Rb, H, Cl), Eupatoriadelphus purpureus sn (Rb), Liatris pycnostachya (Cl), Silphium perfoliatum sn (Rb), Vernonia fasciculata sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Dipsacaceae: Dipsacus fullonum sn (Rb); Fumariaceae: Dicentra cucullaria sn np (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa sn (Cl); Orchidaceae: Platanthera ciliaris sn (SS), Platanthera grandiflora sn (Lu), Platanthera peramoena sn (Lu); Philadelphaceae: Philadelphus grandiflorus sn (Rb); Polemoniaceae: Phlox divaricata laphamii sn (Rb, WF), Phlox pilosa sn (Rb); Ranunculaceae: Delphinium tricorne sn fq np (Rb, Mc); Rosaceae: Prunus americana sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar or carrion. Males patrol for females (Scott, 1986).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: This tiger swallowtail appears to be obligately at least bivoltine and there are three or four broods in the southern parts of the range. The spring brood is quite protracted due to both staggered eclosion of adults and individual longevity of at least occasionally up to four weeks (Schweitzer). Spring broods typically start about May 1 and persist through June and some years even into early July in Connecticut and fly through much of April into June in southernmost parts of New Jersey where the second brood is mainly in July and August. There might be a partial third brood in southern New Jersey where adults can be very common for at least the first half of September and later some years like 2002. It is not definitely known whether some first brood pupae enter hibernal diapause in June or July, which is the case for a majority of bi- or trivoltine Macrolepidoptera reared by Schweitzer in South Jersey. It is well known that some other swallowtails do this. There are no reports of pupae overwintering more than once.

Based on observations of wild larvae and outdoor rearings in southern New Jersey eggs must be laid by about September 10-15 for the larvae to have a good chance of completing development by leaf fall. Unless their host drops its leaves early larvae that reach last instar in October can potentially survive. Larvae from late September females mature in November or December, if at all. Larvae are present in southern New Jersey (39 degrees North) from May through most of October with stragglers at least into November. They occur earlier and later farther south. Fall last instars are very tolerant of freezing nights (down to at least -4C) and position themselves in direct sun usually in a slightly rolled leaf which makes a parabolic reflector. They can feed (not necessarily every evening) and grow slowly in sunny periods when highs are only around 8-12C and they feed daily and grow fairly rapidly in sunny weather when days reach 15C. In fall feeding tends to be in late afternoon and evening (down to about 6C). Larvae may leave their silk resting pad in order to position themselves in more direct sun.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Eastern tiger swallowtails reach maturity in the spring. Many generations are produced each year and the last mature butterflies remain into mid-autumn.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio glaucus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 36 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0125-06|AF044013|Papilio glaucus| CGAAAATGACTTTATTCTACAAATCATAAAGATATTGGAACATTATACTTTATTTTTGGAATTTGAGCAAGAATATTAGGAACTTCTTTA---AGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGAT---GACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATA---TTAGGGGCACCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTCTTTTAATTTCAAGAATAATTGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTATCCCCCTCTTTCTTCCAATATCGCTCATGGAAGAAGATCAGTAGATTTA---GTTATTTTTTCCCTTCATTTAGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTTCTTTCATTACCTGTTTTAGCTGGA---GCTATTACAATACTATTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTTTGATTCTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAG---GAAACATTTGGATGTTTAGGTATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papilio glaucus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Species: 55
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

The eastern tiger swallowtails are not yet threatened by human impact on their ecosystem.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Ranges over most of the eastern United States and considered common and secure in most states. Very adaptable species.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: Can breed successfully in almost any habitat with foodplants except probably generally not manicured lawns which lack safe pupation sites. Most abundant in hardwood froests and mixed swamps.

Other Considerations: this species should be favorably impacted by global warming and should soon spread northward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Decline of 30-50%

Comments: Has obviously lost significant habitat since 1700.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None, common and widespread.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Papilio glaucus

The Eastern Tiger Swallowtail (Papilio glaucus) is a species of swallowtail butterfly native to North America. It is one of the most familiar butterflies in the eastern United States,[2] where it is common in many different habitats. It flies from spring to fall, during which it produces two to three broods. Adults feed on the nectar of many species of flowers, mostly from those of the Apocynaceae, Asteraceae, and Fabaceae families. P. glaucus has a wingspan measuring 7.9 to 14 centimeters (3 to 5.5 in). The male is yellow with four black "tiger stripes" on each fore wing. Females may be either yellow or black, making them dimorphic. The yellow morph is similar to the male, while the dark morph is almost completely black.

The green eggs are laid singly on plants of the Magnoliaceae and Rosaceae families. Young caterpillars are brown and white; older ones are green with two black, yellow, and blue eyespots on the thorax. The caterpillar will turn brown prior to pupating. It will reach a length of 5.5 centimeters (2.2 in). The chrysalis varies from a whitish color to dark brown. Hibernation occurs in this stage in locations with cold winter months.

Contents

Description

Dorsal and ventral sides. 1. dorsal male; 2. dorsal female; 3. dorsal female (dark morph); 4. ventral male; 5. ventral female; 6. ventral female (dark morph)
A bilateral gynandromorph. The left half is male, while the right half is female.

The wingspan ranges from 7.9 to 14 cm (3.1 to 5.5 in)[3] with females being the larger sex. Southern individuals are larger than northern ones.[4] Males are yellow with four black "tiger stripes" on each fore wing. The outer edge of the fore wing is black with a row of yellow spots. The veins are marked with black. The postmedian area of the hind wing is black with yellow spots along the margin. The inner margin of the hind wing has small red and blue spots. The ventral fore wing margin has a yellow bar that is broken into spots. This broken bar is present in both sexes, and is used to distinguish P. glaucus from its close relatives.[5]

Females are dimorphic. The yellow morph differs from the male in having a blue postmedian area on the dorsal hind wing. In the dark morph, the areas that are normally yellow are replaced with dark gray or black. The bluish postmedian area on the ventral hind wing has one row of orange spots.[6] A shadow of the "tiger stripes" can be seen on the underside of some dark females.[5]

P. glaucus is one of a few species of papilionids known to produce gynandromorphs. Most bilateral gynandromorphs are hybrids of P. glaucus and P. canadensis that are found along hybrid zones. Color mosaics are found in the central part of the species range.[7]

Taxonomy

The first known drawing of a North America butterfly was that of an Eastern Tiger Swallowtail. It was drawn by John White in 1587,[2] during Sir Walter Raleigh's third expedition to Virginia.[8] White named his drawing "Mamankanois" which is believed to be the Native American word for "butterfly." This species was later described by Linnaeus in his 10th edition of Systema Naturae in 1758.[9] Some taxonomists place P. glaucus, along with the other tiger swallowtails, in the genus Pterourus.[2]

The Eastern Tiger Swallowtail was formerly considered a single species with a vast range into northern Canada and the eastern United States.[2] In 1991, the subspecies Papilio glaucus canadensis was elevated to species level, thus reducing the range of P. glaucus to south of Canada.[10] In 2002, another closely related species, P. appalachiensis, was described by H. Pavulaan and D. M. Wright from the southern Appalachian Mountains.[9] These two species can be separated from P. glaucus by size; P. canadensis is smaller and P. appalachiensis is larger. These two also have a solid yellow bar along the margin of the ventral fore wing.[5] P. canadensis females are not dimorphic, and P. appalachiensis females are rarely black.[11]

Similar species for the dark P. glaucus female include the Pipevine Swallowtail (Battus philenor), the Spicebush Swallowtail (Papilio troilus), and the female Black Swallowtail (Papilio polyxenes). B. philenor differs from the dark morph P. glaucus by the row of light-colored spots on each wing margin. P. troilus is more greenish, and has two rows of orange spots on the ventral hind wing. P. polyxenes is smaller, and the ventral hind wing has two rows of yellow-orange spots.[5]

Distribution and habitat

P. glaucus is found in the eastern United States from southern Vermont to Florida west to eastern Texas and the Great Plains.[2] It is common throughout its range,[6] although is rarer in southern Florida and absent from the Florida Keys.[2] In 1932, a single specimen was collected in County Wicklow, Ireland. It is believed to have been an accidental introduction from North America.[12] P. glaucus can be found almost anywhere deciduous forests occur. Common habitats include woodlands, fields, rivers, creeks, roadsides, and gardens. It will stray into urban parks and city yards.[3][13][14] Because it has adapted to many different habitats and host plants, P. glaucus is a generalist, and is not considered threatened.[2][8]

Adults are seen from spring to fall, although the exact date varies depending on the location. In the south, they are seen from February to November; in the north, they are seen from May to September.[2][3][13] P. glaucus produces two broods in the north and three in the south. The first broods yield the smallest adults.[2]

The Eastern Tiger Swallowtail is the state butterfly of Alabama, Delaware, Georgia, and South Carolina,[15] and is the state insect of Virginia.[16]

Behavior

A group of male Eastern Tiger Swallowtails puddling, including a male Spicebush Swallowtail.

Eastern Tiger Swallowtails are diurnal, and are usually solitary. Adults are known to fly high above the ground, usually seen above the tree canopy.[8][17] Males seek females by patrolling habitats containing the larval host plants. During courtship, the male and female fly about each other prior to landing and mating. The male releases perfume-like pheromones during courtship to entice the female into mating.[2][18]

Adults use a wide range of food sources, most preferring to nectar on sturdy plants with red or pink flowers.[2][4] Many members of the families Apocynaceae, Asteraceae, and Fabaceae are used as common nectar sources.[13][14] Males participate in a behavior called puddling, in which they congregate on mud, damp gravel, or puddles. They extract sodium ions and amino acids from these sources which aid in reproduction.[13][19] Males that puddle are typically fresh, and puddle only for their first couple of days. Females will occasionally puddle, but do not form congregations.[19] Adults have also been seen feeding on dung, carrion, and urine.[13]

Life cycle

Egg

Egg

Females lay their eggs singly on the host plant leaves,[18] preferring to oviposit on host plants near nectar sources.[20] The egg is round and green, later turning yellowish-green with reddish dots.[18] The size of the egg is large for a butterfly, being 0.8 millimeters (0.03 in) in height and 1.2 millimeters (00.5 in) in width.[21] It takes between 4 to 10 days to hatch.[22]

A fifth instar caterpillar, shortly before pupating.

Caterpillar

The caterpillar eats the leaves of the host plant. It will rest on a silk pad on a leaf, with the edges of the leaf folded over itself and held together with silk.[18][23][24] The first three instars are brown. A large white spot, known as a saddle, is found on the abdomen. After molting to the fourth instar, the caterpillar becomes green. The swollen thorax has two black, yellow, and blue eyespots. These eyespots are much smaller than those of the similar-looking Spicebush Swallowtail caterpillar. A yellow and black transverse stripe is present between the first and second abdominal segments. It is concealed between the folds of the segments when the caterpillar is at rest.[18][23] The abdomen is spotted transversely with light blue. Before pupating, the caterpillar will turn dark brown. It will reach a length of 5.5 centimeters (2.2 in). The caterpillar of P. glaucus is impossible to distinguish from the caterpillars of P. canadensis and P. appalachiensis.[18][23]

A light colored chrysalis.

Chrysalis

The chrysalis measures 3.2 centimeters long (1.3 in).[21] It hangs from a surface by a silk girdle around the thorax and a silk pad at the base.[18] The chrysalis varies in color, ranging from off white to dark brown. It is often spotted with green and dark brown. Ligter-colored chrysalids often have a dark lateral stripe along each side of the body. Two horn-like projections are present on the head; one is found the thorax. P. glaucus chrysalids can be found in a variety of places, but are commonly found on tree trunks, fence posts, and in ground litter.[18] It hibernates in locations with cold winters.[2]

The leaves of Liriodendron tulipifera, one of many host plants for P. glaucus.

Egg - It takes 3-5 days for eggs to hatch. Larva - The caterpillar has five instars. Pupa - The chrysalis stage lasts 9-11 days, or over winter hybernation. Adult – Northern areas have 1-2 generations; southern areas may have three.

Host plants

The caterpillar feeds on host plants of many different families.[2] Common host plants used are those of the Magnoliaceae and Rosaceae families, with species including tulip tree (Liriodendron tulipifera), wild black cherry (Prunus serotina), and sweet bay magnolia (Magnolia virginiana).[1] It also feeds on other members of the family Rosaceae, as well as members from the families Lauraceae, Oleaceae, Rutaceae, and Tilioideae.[3][13][21] Aspens (Populus sect. Populus), birches (Betula), and willows (Salix) have been recorded in older literature as host plants, but these are used by P. canadensis.[1]

Defense against predators

A caterpillar with an everted osmeterium.

The first three instars of the caterpillar are bird dropping mimics, coloration that helps protect it from predators. In later instars, the eyespots on the thorax serve to deter birds.[24] Like all members of the family Papilionidae, the caterpillar of P. glaucus possesses an osmeterium, an orange, fleshy organ that emits foul-smelling terpenes to repel predators. Normally hidden, the osmeterium is located on the first segment of the thorax, and can be everted when the caterpillar feels threatened.[25] The combination of eyespots and osmeterium makes the caterpillar resemble a snake.[26]

Since adults are palatable, dark morph females use Batesian mimicry to protect themselves from vertebrate predators by mimicking the poisonous Pipevine Swallowtail. Dark morph females are more prevalent in the south, where B. philenor is more common.[5][27]

See also

References

  1. ^ a b c "Papilio glaucus - Linnaeus, 1758 Eastern Tiger Swallowatil". NatureServe Explorer. NatureServe. 2 February 2009. http://www.natureserve.org/explorer/servlet/NatureServe?sourceTemplate=tabular_report.wmt&loadTemplate=species_RptComprehensive.wmt&selectedReport=RptComprehensive.wmt&summaryView=tabular_report.wmt&elKey=120967&paging=home&save=true&startIndex=1&nextStartIndex=1&reset=false&offPageSelectedElKey=120967&offPageSelectedElType=species&offPageYesNo=true&post_processes=&radiobutton=radiobutton&selectedIndexes=120967&selectedIndexes=113077. Retrieved 16 November 2010. 
  2. ^ a b c d e f g h i j k l m Cech, Rick; Tudor, Guy (2005). Butterflies of the East Coast. Princeton, NJ: Princeton University Press. p. 64. ISBN 0-691-09055-6. 
  3. ^ a b c d Shull, Ernest M. (1987). The Butterflies of Indiana. IN: Indiana Academy of Science. pp. 91, 108. ISBN 0-253-31292-2. 
  4. ^ a b Wood, Aaron; Howard, Garrett; Young, Ashli (200). "Papilio glaucus "Eastern Tiger Swallowtail" Family: Papilionidae". Clemson Entomology. Clemson University Department of Entomology, Soils, and Plant Sciences. http://entweb.clemson.edu/museum/buttrfly/local/bfly7.htm. Retrieved 16 November 2010. 
  5. ^ a b c d e Brock, Jim P.; Kaufman, Kenn (2003). Butterflies of North America. New York, NY: Houghton Mifflin. pp. 20, 26, 28. ISBN 0-618-15312-8. 
  6. ^ a b Glassberg, Jeffrey (1999). Butteflies through Binoculars: The East. New York, NY: Oxford University Press. p. 48. ISBN 0-19-510668-7. 
  7. ^ Scriber, Mark; Mercader, Rodrico; Romack, Howard; Deering, Mark (29 April 2009). "Not all bilateral gynandromorph butterflies are interspecific hybrids: new Papilio specimens from field populations". Journal of the Lepidopterists' Society (The Lepidopterists' Society) 63 (1): 37–47. ISSN 0024-0966. 
  8. ^ a b c Roof, Jennifer (1999). "Papilio glaucus". Animal Diversity Website. University of Michigan Museum of Zoology. http://animaldiversity.ummz.umich.edu/site/accounts/information/Papilio_glaucus.html. Retrieved 19 November 2010. 
  9. ^ a b Pavulaan, Harry; Wright, David M. (2002). "Pterourus appalachiensis (Papilionidae: Papilioninae), a new swallowtail butterfly from the Appalachian region of the United States". The Taxonomic Report of the International Lepidoptera Survey 3 (7): 1–20. http://tils-ttr.org/ttr/ttr-3-7.pdf. 
  10. ^ Haden, Robert H.; Lederhouse, Robert C.; Bossart, J. L.; Scriber, J. Mark (1991). "Papilio canadensis and P. glaucus (Papilionidae) are distinct species". Journel of the Lepidopterists' Society 45 (4): 245–258. http://peabody.research.yale.edu//jls/pdfs/1990s/1991/1991-45(4)245-Hagen.pdf. 
  11. ^ Pavulaan, Harry; Wright, David M. (1 December 2004). "Discovery of a black female form of Pterourus appalachiensis (Papilionidae: Papilioninae) and additional observations of the species in West Virginia". The Taxonomic Report of the International Lepidoptera Survey 6 (1): 1–10. http://www.carolinanature.com/butterflies/ttr-6-1.pdf. Retrieved 3 January 2011. 
  12. ^ Eeles, Peter (2002–2010). "Tiger Swallowtail Papilio glaucus". UK Butterflies. http://www.ukbutterflies.co.uk/species.php?species=glaucus. Retrieved 19 November 2010. 
  13. ^ a b c d e f Iftner, David C.; Shuey, John A.; Calhoun, John V. (1992). Butterflies and Skippers of Ohio. College of Biological Sciences and The Ohio University. p. 70. ISBN 0-86727-107-8. 
  14. ^ a b Nielson, Mogens C. (1999). Michigan Butterflies and Skippers. MI: Michigan State University Extension. p. 34. ISBN 1-56525-012-5. 
  15. ^ "Official State Butterflies". Netstate. NSTATE, LLC. 2 March 2010. http://www.netstate.com/states/tables/state_butterflies.htm. Retrieved 13 August 2010. 
  16. ^ "Official State Insects". Netstate. NSTATE, LLC. 18 March 2010. http://www.netstate.com/states/tables/state_insects.htm. Retrieved 13 August 2010. 
  17. ^ Fullard, James H. & Napoleone, Nadia (2001). "Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera" (PDF). Animal Behaviour 62 (2): 349–368. doi:10.1006/anbe.2001.1753. http://www.erin.utoronto.ca/~w3full/reprints/FullNapolDielAB.pdf. 
  18. ^ a b c d e f g h Scott, James A. (1986). The Butterflies of North America. Stanford, CA: Stanford University Press. pp. 162, 181–182. ISBN 0-8047-2013-4. 
  19. ^ a b Lederhouse, R.C.; Ayres, M.P.; Scriber, J.M. (1990). "Adult nutrition affects male virility in Papilio glaucus L.". Functional Ecology 4: 743–751. http://www.dartmouth.edu/~mpayres/pubs/Lederhouse_etal_1990.pdf. Retrieved 19 November 2010. 
  20. ^ Grossmueller, D. W.; Lederhouse, R. C. (1987). "The role of nectar source distribution in habitat use and oviposition by the tiger swallowtail butterfly". Journal of the Lepidopterists' Society (The Lepidopterists' Society) 41 (3): 159–165. http://peabody.research.yale.edu//jls/pdfs/1980s/1987/1987-41(1)159-Grossmueller.pdf. 
  21. ^ a b c Pyle, Robert Michael (1981). National Audubon Society Field Guide to North American Butterflies. New York: Alfred A. Knopf. p. 341. ISBN 0-394-51914-0. 
  22. ^ Stokes, Donald and Lillian; Williams, Ernest (1991). Stokes Butterfly Book. Boston, MA: Little, Brown and Company. p. 49. ISBN 0-316-81780-5. 
  23. ^ a b c Wagner, David L. (2005). Caterpillars of Eastern North America. Princeton, NJ: Princeton University Press. p. 79. ISBN 0-691-12144-3. 
  24. ^ a b "Natural History Notes: Eastern Tiger Swallowtail (Papilio glaucus)". WindPuffin Designs. 2005. http://www.windpuffindesigns.com/pdfs/tigerst.pdf. Retrieved 4 December 2010. 
  25. ^ Eisner, Thomas; Meinwald, Yvonne C. (24 December 1965). "The defensive secretions of a caterpillar (Papilio)". Science 150 (3704): 1733–1735. doi:10.1126/science.150.3704.1733. 
  26. ^ Zabarauskas, Paul (2010). "Other kinds of mimicry". Grolier Online. Scholastic. http://gme-ada.grolier.com/article?assetid=0193960-0. Retrieved 4 December 2010. 
  27. ^ Hall, Donald W.; Butler, Jerry F. (1998—2007). "Eastern Tiger Swallowtail". Featured Creatures. http://entomology.ifas.ufl.edu/creatures/bfly/tiger_swallowtail.htm. Retrieved 4 December 2010. 

Further reading

  • Burnie, David & Wilson, Don E., ed (2001). "Invertebrates". Animal The Definitive Visual Guide to the World's Wildlife. DK Publishing, Inc. p. 571. ISBN 0-7894-7764-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Papilio canadensis has been generally regarded as a separate species since Hagen et al. (1992). However more recent studies (Scriber et al., 2003) may force a reinterpretation of that status. See comments for that species. Subspecies australis found mainly in the coastal plain from extreme southern Virginia southward appears rather distinctive. It is very unlikely that it is a heat induced phenotype as some have suggested since it is not produced in nearby regions like the inland Carolinas or in southern New Jersey during abnormally hot summers and some parts of the range of subspecies glaucus have hotter summers than those in the range of australis. See Wright and Pavulaan (2002) for a review. Only time will tell if Papilio appalachiensis which they name in that article will be generally accepted as a valid species. Most authors consider the Mexican alexiares a subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!