Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Papilio demodocus demodocus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Papilio demodocus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0520-06|AY457588|Papilio demodocus| CGAAAATGACTTTATTCAACAAATCATAAAGATATTGGAACATTATATTTTATTTTCGGTATTTGAGCAAGATTATTAGGAACTTCTTTA---AGTTTACTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACGGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATA---TTAGGAGCACCAGATATAGCCTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTCTTTTAATTTCTAGAATAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCCCATGGAAGAAGATCTGTTGATTTA---GTTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGTATTAATAGAATATCATTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCTTTATTATTACTTCTTTCTCTTCCTGTATTAGCAGGA---GCTATTACTATACTATTAACAGATCGTAATTTAAATACATCTTTCTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGGTTTGGTATAATTTCTCATATTATTTCCCAAGAAAGTGGAAAAAAG---GAAACATTTGGTTGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTACTTGGATTTATTGTTTGAGCTCATCATATGTTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papilio demodocus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 17
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Papilio demodocus

Papilio demodocus, also known as the citrus swallowtail, is a large swallowtail butterfly common to sub-Saharan Africa. It is a pest species, the caterpillar feeding on citrus trees.

Contents

Life cycle

Citrus swallowtails pass through approximately three generations per year. Eggs are laid singly on citrus tree leaves.

Eggs

Female butterflies lay their eggs singly on citrus leaves. After about six days, the egg hatches into an immature larva.

Immature larva

The immature larvae are black, yellow, and white with spikes. Their coloration provides effective camouflage, as they resemble bird droppings. They grow to a length of 10 or 15 mm before changing into mature larvae.

Mature larva

Mature larvae are green with white or pink markings and eyespots. They grow to a maximum length of about 45 mm.

Mature caterpillars lack the camouflage of their immature state. Instead, when threatened by a bird or other predator, they produce a forked, orange-coloured organ known as an osmeterium. The organ emits a strong smell which acts as a discouragement to the predator.

Pupa

The caterpillars attach themselves to branches with silk, transforming into pupae. They remain in the pupal form for 2–3 weeks before emerging as adults.

Adult

Royal Mile, Budongo W. Uganda
Nungwi, Zanzibar

Adult butterflies have black and yellow markings with red and blue eyespots. Female butterflies tend to be larger than males.

Natural enemies

Citrus swallowtail eggs and pupae are known to be parasitised by certain species of parasitic wasp, notably Ooencyrtus (eggs) and Pteromalus puparum (pupae).

Subspecies

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!