Molecular Biology and Genetics

Molecular Biology

Barcode data: Parides chabrias

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGAAAATGATTTTATTCAACTAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGTACTTCATTAAGTTTACTAATTCGAACCGAATTAGGTACCCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCYTTTCCTCGTATAAACAATATAAGTTTTTGACTTTTACCCCCTTCTTTAACCCTTTTAATATCGAGAAGAATTGTTGAAATAGGTGTAGGCACAGGATGAACAGTTTACCCTCCTCTTTCCTCTAATATTGCTCATAGAGGAAGATCAGTTGACTTAGCTATTTTTTCTTTGCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATTTACGT---AATAATCTACTTTTTGATCAAATACCTCTATTCGTTTGATCTGTAGGTATTACTGCTATTTTACTTTTACTCTCTCTTCCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATCTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAWTTCTTCCAGGATTTGGTATAATTTCTCATATCATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGTTGTTTAGGAATAATTTATGCTATAATAGCTATTGGATTATTAGGATTTATTGTCTGAGCTCATCATATATTTACAATTGGTATAGATATTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parides chabrias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parides chabrias

Parides chabrias is a species of butterfly in the Papilionidae family. It is found in Brazil (Amazonas), Ecuador and Peru.

The larva feeds on Aristolochia burchelli and A. didyma.

Subspecies[edit]

  • Parides chabrias chabrias (Brazil: Amazonas, Ecuador, Peru))[1] The forewing in both sexes has a row of submarginal spots, which however are often wanting in the female. The central area of the hindwing is situated somewhat further towards the margin than in ygdrasilla, consequently the cell-spot is smaller.

References[edit]

  1. ^ Lewis, H. L., 1974 Butterflies of the World ISBN 0-245-52097-X Page 26, figure 3
  2. ^ Lewis, H. L., 1974 Butterflies of the World ISBN 0-245-52097-X Page 26, figure 25 as triopas
  • Collins, N.M., Morris, M.G., IUCN, 1985 Threatened Swallowtail Butterflies of the World: the IUCN Red Data Book 1985 IUCN pdf
  • Edwin Möhn, 2006 Schmetterlinge der Erde, Butterflies of the world Part XXVI (26), Papilionidae XIII. Parides. Edited by Erich Bauer and Thomas Frankenbach Keltern : Goecke & Evers ; Canterbury : Hillside Books. ISBN 978-3-937783-27-7 (Supplement 13 in English - by Racheli)


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!