Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius jacquemonti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTACAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTTTATTAATTTCCAGAAGAATTGTCGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCTCATGGAGGAAGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATACTTTTAACAGACCGAAATCTTAATACCTCATTCTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius jacquemonti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Parnassius jacquemontii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGTAACCCTGGATCTTTAATTGGAGAT---GATCAAATTTACAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTTTATTAATTTCCAGAAGAATTGTCGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCTCATGGGGGAAGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATACTTTTAACAGACCGAAATCTTAATACCTCATTCTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACNNNGAAGTTTATATTTTAATTTTACCTGGTTTTGGAATAATTTCTCATATTATTTCACAAGAAAGTGGAAAAAAAGAAACTTTTGGATGTCCAGGAATCATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAGCTTACTTCACCTCTGCAACTATAATTATTGCTGTACCAACAGGTATTAAAATTTTTAGTTGATTAGCAACATTACATGGATCC---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius jacquemontii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Parnassius jacquemontii

Keeled Apollo Parnassius jacquemontii is a high altitude butterfly which is found in India and Pakistan. It is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family. It is also fairly common at high altitudes from Chitral to Kumaon.

Contents

Description

For the technical terms used refer to Lepidopteran terminology

Male upperside: pale creamy white; both wings irrorated with diffuse black scales; body, base of the wings and the dorsum of hind wing clothed with long white hairs. Fore wing: the irroration of black scales most dense along the costal margin and at base of cell, more sparse on the disc; the apical two thirds of the cell, a portion beyond the middle of interspace 1, and the bases of interspaces 4, 5, 8 and 9 markedly free of the diffuse black scales; a transverse short bar across the middle of cell, another along the discocellulars, and a diffuse transverse series of postdiscal lunules, black; three or four crimson spots encircled with black arranged as follows:—one midway in interspace 1, two, sometimes three, beyond apex of cell in an oblique line from the costa; the terminal margin broadly hyaline, with minute black specks at the apices of the veins; cilia white. Hind wing : base and dorsal margin beneath the white hairs densely and broadly irrorated with black scales, the inner edge of this border irregular, rest of the wing with more diffuse black scaling; five or six black-encircled crimson spots as follows:—two, sometimes three, obliquely above the tornus, these or one of them occasionally white-centred ; one in the middle of interspaces 5 and 7 respectively, these are generally centred with white; and one pure crimson spot at the extreme base of the wing; the postdiscal series of black lunules are as on the fore wing, but the lunules are not so well defined and generally separate from one another; finally there is no distinct hyaline border to the wing, but the cream-white scaling extends to the termen; terminal black specks to the veins and white cilia as on the fore wing. Underside: shining, with more or less of a glazed appearance; markings much as on the upperside, but indicated as much by those of the upperside which show through as by actual scaling; in addition on the hind wing there is a subbasal transverse series of four dull crimson spots while the crimson spots beyond are all more or less white-centred. Antennae deep brownish black, rarely with a few white specks on the underside ; head, thorax and abdomen beneath the covering of white hairs, black.

female

Female. Similar, generally darker with the irroration of black scales more dense; the crimson spots are often larger and more brilliant. Anal pouch after fertilization "ovally scoop-shaped in front, convex beneath," furnished with a sharp high carina posteriorly.[1]

Range

North-eastern Afghanistan, Indus Valley (Pakistan) and (Jammu & Kashmir), Tajikistan (Pamirs), Uzbekistan, South West China and Szechwan.

Status

Not known to be in danger. The nominate subspecies is protected by law in India.[2]

Cited references

  1. ^ Bingham, C. T. 1907. Fauna of British India. Butterflies. Volume 2
  2. ^ Collins, N.M., Morris, M.G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6

Other references

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!