Overview

Comprehensive Description

General comments

This information is based an ongoing project dedicated to the inventory and dissemination of information on lepidopteran larvae, their host plants, and their parasitoids in a Costa Rican tropical wet forest and an Ecuadorian montane cloud forest.


N=1 rearing as of 2012, eclosed.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Collected in Heredia Province, Costa Rica.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Parides iphidamas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 69
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Parides iphidamas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 59 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGCTCTTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGACTTGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTTTACCCCCTTCTTTAACCCTTTTAATTTCAAGAAGTATTGTCGAAAATGGAGCTGGTACCGGATGAACAGTTTATCCCCCTCTCTCTTCTAATATTGCCCACAGAGGAAGATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCCTCTATTTTAGGGGCAATTAATTTTATTACCACAATTATTAATATACGTATTAATAATATATCTTTCGATCAAATACCCTTATTTGTATGATCAGTCGGAATTACAGCTCTTTTACTTTTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATCTTAATACTTCCTTCTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parides iphidamas

Parides iphidamas is a species of butterfly in the family Papilionidae. It is commonly known as the Iphidamas Cattleheart and the Transandean Cattleheart.[1][2]

Subspecies[edit]

Description[edit]

Ventral view of a Parides iphidamas laying an egg

Parides iphidamas has a wingspan reaching about 10 centimetres (3.9 in). The dorsal sides of the forewings are black, with a broad green and white spots (completely white in females), while the dorsal sides of the hindwings show a broad red band or spot. Along the edges there are many yellow small spots. The undersides of the wings are black with a white band on the forewings and several pink patches on the hindwings.[4][5] The body of the butterfly is black with red dots. The poisonous caterpillars are chocolate-brown, with white or brown protrusions resembling thorns. The host plants are various toxic Aristolochia species (Aristolochia cordiflora, A. maxima, A. odoratissma, A. pilosa, A. ringens, and A. tonduzii).[3]

Distribution[edit]

This species is native to the Central and South Americas. It occurs from Southeastern Mexico to Costa Rica, Panama, and Peru.

Ecozone[edit]

Neotropical ecozone

Habitat[edit]

It is common in various habitats, ranging fron open lowlands to wooded areas and tropical forests, from sea level to 1,200 meters (3,900 ft).[6] Females mainly occur where the caterpillar host plant are located, in forest clearing and along forest edges.

References[edit]

  1. ^ Warren, A. D.; et al (2010). "Parides iphidamas". Butterflies of America. Retrieved 22 January 2011. 
  2. ^ Glassberg, Jeffrey (2007). A Swift Guide to the Butterflies of Mexico and Central America. Sunstreak Books Inc. ISBN 978-1-4243-0915-3. 
  3. ^ a b c d e f g h Savela, Markku. "Parides iphidamas". funet.fi. Retrieved 22 January 2011. 
  4. ^ Lewis, H. L., 1974 Butterflies of the World ISBN 0-245-52097-X Page 26, figure 11 (male) figure 12 (female, underside)
  5. ^ Brian McAndrew, Butterflies – James Lorimer & Co. Ltd Publishers
  6. ^ Collins, N. Mark; Collins, Michael G. (1985). Threatened Swallowtails of the World: The IUCN Red Data Book. IUCN Protected Area Programme Series. Gland, Switzerland and Cambridge, U.K.: IUCN. p. 69. ISBN 978-2-88032-603-6. 

Further reading[edit]

  • Lamas, Gerardo (2004). Atlas of Neotropical Lepidoptera; Checklist: Part4A Hesperioidea–Papilionoidea. Gainesville, Florida: Scientific Publishers, Inc. p. 93. ISBN 0-945417-28-4. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!