Overview

Brief Summary

The Pipevine Swallowtail (Battus philenor) is a swallowtail butterfly found in North and Central America. The butterflies are black with iridescent blue hind wings. They are found in many different habitats, but are most commonly found in forests (Iftner et al. 1992). The black or red caterpillars feed on Aristolochia species, making them poisonous as both larvae and adults, while the adults feed on the nectar of a variety of flowers.
  • Iftner, David C.; Shuey, John A.; Calhoun, John V. (1992). Butterflies and Skippers of Ohio. OH:: College of Biological Sciences and The Ohio State University. p. 66. ISBN 0-86727-107-8.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Katja Schulz

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

North American Ecology (US and Canada)

Mostly residential in North America where habitat is MOSTLY BRUSHY OR WOODED (Scott 1986). Host plants are largely restricted to one genus with most known hosts from Aristolochia. Hosts are usually vines or herbaceous. Eggs are laid on the host plant in clutches with 1-20 eggs per clutch. Individuals overwinter as pupae. There are multiple flights each year with the approximate flight time from MAR1-SEP30 depending on latitude (Scott 1986).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Battus philenor, the pipevine swallowtail, is one of the three North American species of tribe Triodini. (Triodini contains a total of 136 mostly tropical species worldwide.) This butterfly species is found year round in the Southeastern United States, and there is a non-migrant population in northern California. Because its host plants (Aristoluchia species) make larvae (and adults) poisonous to predators, B. philenor is mimicked by many other species with similar ranges, such as the Eastern Tiger Swallowtail (Papilio glaucus), the spicebush swallowtail (P. troilus), the black swallowtail (P. polyxenes), the Ozark swallowtail (P. joanae), the red-spotted purple (Limenitis arthemis astyanax) and the female Diana fritillary (Speyeria diana). (Scott, 1986.)
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Battus philenor is found in the southern half of the United States (occasionally further north), and ranges south to southern Mexico (Opler et al. 1995; Pyle 1981; Scott 1986; Comstock 1927; Lucien 1972; Allen 1991).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern Ontario and southern New England south to central Florida and west to Arizona, California and Oregon. Also extends south to Costa Rica. This species is not resident in some parts of this range. It is somewhat migratory and can appear suddenly in numbers in large areas of unsuitable habitat (no native foodplants) such as in southern New Jersey. It also probably cannot consistently survive the winters in some areas. B. p. hirsuta in California only.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Wing span: 2 3/4 - 5 inches (7-13 cm)

The eggs of a pipevine swallowtail are red-orange and circular. As larvae (caterpillars), pipevine swallowtails are black, with red projections and spots running down their backs. The color of the larvae and pupae of this species is affected by temperature, animals experiencing warmer temperatures shade from black to red. The chrysalis of this has its own shape distinct from other butterflies. The posterior end is segmented and has an inward curve; the ventral thorax of the chrysalis is raised, and the head has a pair of horns at the anterior dorsal portion.

The fore-wing of adults is coal-black above and gray below. The dorsal hind-wing is where the males and females are noticeably different. Males have smaller cream or pale spots than females, and the spots run along the fringe of the wings. Males are also a brighter metallic blue than their female counterparts, in the dorsal hind wing region. The bottom half of the ventral hind wing of males and females is metallic blue; a single row of seven orange spots and small pale, cream dots are found at the edge of the wing within the metallic blue section.

Range wingspan: 7 to 13 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Comstock, J. 1927. Butterflies of California: a popular guide to a knowledge of the butterflies of California, embracing all of the 477 species and varieties at present recorded for the state. Los Angeles, California: J.A. Comstock.
  • Pyle, R. 1981. The Audubon Society Field Guide to North American Butterflies. New York: Alfred A. Knopf, Inc..
  • Opler, P., R. Stanford, H. Pavulaan. 1995. "Butterflies of North America" (On-line). Accessed October 25, 2000 at http://www.npwrc.usgs.gov/resource/distr/lepid/bflyusa/bflyusa.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

B. philenor is found mostly in warm climates through out North America. The species favors open woodlands, meadows, and anywhere else an abundance of pipevine grow, including backyard gardens and nurseries. (Opler et al. 1995; Pyle 1981; Scott 1986; Comstock 1927; Lucien 1972; Allen 1991).

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Most frequently open woodlands; also, meadows, fields, gar- dens, orchards. Potential for breeding virtually anywhere foodplants grow, native or planted. Larvae feed on pipe vines (Aristolochia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

As larvae, pipevine swallowtails feed only on plants in the genus Aristolochia (known as pipevines). As a butterfly, B. philenor feeds soley on nectar from flowers, including thistles (Cirsium), bergamot, lilac, viper's bugloss, common azaleas, phlox, teasel, dame's rocket, lantana, petunias, verbenas, lupines, yellow start thistle, California buckeye, yerba santa, brodiaceas, and gilias (Opler et al. 1995; Pyle 1981; Scott 1986; Comstock 1927; Lucien 1972; Allen 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Battus philenor in Illinois

Battus philenor Linnaeus: Papilionidae, Lepidoptera
(most observations are from Robertson, otherwise they are from Clinebell, Macior, and Conger as indicated below; this butterfly is the Pipevine Swallowtail)

Apiaceae: Eryngium yuccifolium sn (Rb), Heracleum maximum sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias syriaca [plab sn] (Rb), Asclepias tuberosa [plpr sn] (Rb); Asteraceae: Bidens aristosa sn (Rb), Cirsium hillii sn (Rb), Echinacea purpurea sn (Cl), Eupatoriadelphus purpureus sn (Rb), Helianthus grosseserratus sn (Rb), Liatris cylindracea sn (Cl), Silphium perfoliatum sn (Rb); Campanulaceae: Lobelia cardinalis sn (Rb), Lobelia siphilitica sn (Rb); Convolvulaceae: Ipomoea pandurata sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Orbexilum onobrychis (Rb), Trifolium pratense sn (Rb); Lamiaceae: Monarda bradburiana sn (Rb), Monarda fistulosa sn fq (Rb), Pycnanthemum tenuifolium sn (Rb), Teucrium canadense sn (Rb, Cng); Onagraceae: Oenothera pilosella sn (Rb); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Phlox glaberrima sn (Rb); Rosaceae: Crataegus crus-galli sn (Rb), Porteranthus stipulatus sn (Rb); Ranunculaceae: Delphinium tricorne sn fq np (Mc); Rubiaceae: Cephalanthus occidentalis sn (Rb); Scrophulariaceae: Mimulus ringens sn np (Cng), Penstemon hirsutus sn np (Rb); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults sip nectar and mud. Males patrol for females (Scott, 1986).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Pipevine swallowtail males spend most of their time looking to breed with females. Once a male has located a female, he will quickly land and attemp to mate. Females lay clusters of eggs on or under leaves of pipevines and mostly exposed in the sun. Larva (caterpillars) hatch from the eggs and begin feeding on the host plant. Once they have eaten enough, and matured enough, the larva will metamorphose into a pupa, or chrysalis. It spends the winter as a chrysalis (or in warm regions, just a few weeks), and emerges as an adult in the spring. (Opler et al. 1995; Pyle 1981; Scott 1986; Comstock 1927; Lucien 1972; Allen 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Battus philenor

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0205-06|AF170875|Battus philenor| CGAAAATGATTATATTCTACTAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGAATTTTAGGCACTTCTTTA---AGTTTATTAATTCGAACTGAATTAGGAAATCCTGGCTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATCGGAGGATTTGGTAATTGATTAGTCCCTTTAATA---TTAGGAGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCACATAGAGGCAGATCAGTTGATCTA---GCTATTTTTTCCTTACACTTAGCAGGAATTTCTTCCATTCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAGTTAATAACATATCTTTCGATCAAATACCTTTATTTGTATGAGCAGTAGGTATTACAGCTTTATTATTACTTCTATCTCTCCCTGTTTTAGCTGGA---GCTATTACTATACTTCTCACAGATCGTAATCTTAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCTATCTTATATCAACATTTATTTTGAATTTTTGGCCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATCTCTCATATTATTTCTCAAGAAAGAGGTAAAAAG---GAAACTTTTGGTTGTTTAGGAATAATTTATGCTATAATAACAATTGGCCTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Battus philenor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 25
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Pipevine swallowtails are, for now, secure globally. In Michigan, where they reach the northern limit of their range, they are listed as a species of special concern.

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Other Considerations: Culture of host plants has extended range slightly in the Northeast. Cultivated pipevines may be oviposited on by migrant females but by themselves do not seem to often support sustained populations probably because such plants are too sparse on the landscape.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Battus philenor

The Pipevine Swallowtail (Battus philenor)[1][2] is a swallowtail butterfly found in North and West and Central America. The butterflies are black with iridescent blue hind wings. They are found in many different habitats, but are most commonly found in forests.[3] The black or red caterpillars feed on Aristolochia species, making them poisonous as both larvae and adults, while the adults feed on the nectar of a variety of flowers.

Contents

Description

LD Butterfly (3).jpg

The upper surface of the hind wings are an iridescent blue or blue-green with pale, arrow-head markings. Males have brighter metallic regions than females.[4] The underside of the hind wing has seven orange submarginal spots surrounded by iridescent blue.[5] Both surfaces of the fore wings are black or dull blackish-brown.[4][6] Individuals are smaller and hairier in northern California.[7]

Similar species

The Pipevine Swallowtail is mimicked by many species, including the dark morph female Eastern Tiger Swallowtail (Papilio glaucus), the Spicebush Swallowtail (P. troilus), the Black Swallowtail (P. polyxenes), the Ozark Swallowtail (P. joanae), the sympatric subspecies Red-spotted Purple (Limenitis arthemis astyanax), and the female Diana Fritillary (Speyeria diana).[7]

Distribution and habitat

The butterfly ranges from across USA to Mexico, Islas Marías and onto Guatemala and Costa Rica.[2][6] It rarely strays into southern Ontario.[5] In the United States, the butterfly is found in New England down to Florida west to Nebraska, Texas, New Mexico, Arizona, California, and Oregon.[2] Habitats for B. philenor vary greatly, including deciduous woodlands, forests, tropical forests, deserts, open fields, meadows, gardens, and orchards.[8][3]

Flight period

The Pipevine Swallowtail is seen from April to October in the northern portion of its range and from February to November in the southern portion. There are two broods in the north and three or more in the south.[8]

Life cycle

Pipevine Swallowtail larva
Pipevine Swallowtail chrysalis

Males patrol for females in suitable habitats. Females will lay clusters of one to twenty reddish-brown eggs on the underside of host plant leaves. Young caterpillars are gregarious, while older larvae are solitary.[9][5] The caterpillars will eat the leaves, stems, and seed capsules of the host plant.[9] The larvae are either black or smoky red. Many fleshy filaments project from the sides of the body, the longest being on the anterior end. Over the dorsal part of the body are two rows of orange-red warts.[10] The chrysalis is brown or green, with two horns on the head, a point on the thorax, and a ridge on each side of the abdomen. The abdomen is often patched with yellow.[9]The chrysalis hibernates in areas with cold winters.[8]

Host plants

Host plants for the caterpillars include the Pipevine (Aristolochia species), including A. californica, A. serpentaria and others. Pipevines confer a poisonous quality to the larvae and resulting adults, much as the Monarch butterfly obtains protection by feeding on milkweed, or heliconiines by feeding on passion flowers.

Nectar resources

Adults seek nectar from flowers, including thistles (Cirsium species), bergamot, lilac, viper's bugloss, common azaleas, phlox, teasel, azaleas, dame's rocket, lantana, petunias, verbenas, lupines, yellow star thistle, buckeye, and butterfly bush.

References

  1. ^ Beccaloni, G. W.; Scoble, M. J.; Robinson, G. S.; Pitkin, B. (2003). "Card for philenor in LepIndex". The Global Lepidoptera Names Index (LepIndex). World Wide Web electronic publication. http://www.nhm.ac.uk/jdsml/research-curation/research/projects/lepindex/detail.dsml?TaxonNo=166321.0&UserID=&UserName=&&listPageURL=list%2edsml%3fsort%3dSCIENTIFIC%255fNAME%255fon%255fcard%26SCIENTIFIC%5fNAME%5fon%5fcardqtype%3dstarts%2bwith%26SCIENTIFIC%5fNAME%5fon%5fcard%3dphilenor%26recLimit%3d30&searchPageURL=index%2edsml%3fSCIENTIFIC%5fNAME%5fon%5fcardqtype%3dstarts%2bwith%26sort%3dSCIENTIFIC%255fNAME%255fon%255fcard%26SCIENTIFIC%5fNAME%5fon%5fcard%3dphilenor%26recLimit%3d30. Retrieved 7 July 2007. 
  2. ^ a b c Savela, Markku. "Battus philenor". funet.fi. http://www.nic.funet.fi/pub/sci/bio/life/insecta/lepidoptera/ditrysia/papilionoidea/papilionidae/papilioninae/battus/index.html#philenor. Retrieved 2 August 2007. 
  3. ^ a b Iftner, David C.; Shuey, John A.; Calhoun, John V. (1992). Butterflies and Skippers of Ohio. OH:: College of Biological Sciences and The Ohio State University. p. 66. ISBN 0-86727-107-8. 
  4. ^ a b Ramos, I.. "Battus philenor". Animal Diversity Website. University of Michigan. http://animaldiversity.ummz.umich.edu/site/accounts/information/Battus_philenor.html. Retrieved 5 April 2011. 
  5. ^ a b c Opler, Paul A.. "Pipevine Swallowtail Battus philenor". Butterflies and Moths of North America. Big Sky Institute at Montana State University. http://www.butterfliesandmoths.org/species/Battus-philenor. Retrieved 5 April 2011. 
  6. ^ a b Carter, David (2000). Butterflies and Moths (2nd ed.). London: Dorling Kindersley. p. 55. ISBN 0-7513-2707-7. 
  7. ^ a b Brock, Jim P.; Kaufman, Kenn (2003). Butterflies of North America. New York City, NY:: Houghton Mifflin Company. p. 26. ISBN 0-618-15312-8. 
  8. ^ a b c Cech, Rick; Tudor, Guy (2005). Butterflies of the East Coast. Princeton, NJ:: Princeton University Press. p. 62. ISBN 0-691-09055-6. 
  9. ^ a b c Scott, James A. (1986). The Butterflies of North America. Stanford, CA:: Stanford University Press. p. 185. ISBN 0-8047-2013-4. 
  10. ^ Wagner, David L. (2005). Caterpillars of Eastern North America. Princeton, NJ:: Princeton University Press. p. 77. ISBN 0-691-12144-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!