Overview

Brief Summary

North American Ecology (US and Canada)

Mostly residential in North America where habitat is SEMI-WOODED AREAS, LOW MOIST SPOTS (Scott 1986). Host plants are largely restricted to one genus with most known hosts from Asimina. Hosts are usually shrubs. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are two flights each year with the approximate flight time MAY1-JUL31 in the northern part of the range and MAR1-DEC31 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Central Pennsylvania west to eastern Great Plains south through most of Florida and into Texas. Very rare stragglers as far as New England.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eurytides marcellus range throughout the eastern United States, although are most abundant in the southeast.

Biogeographic Regions: nearctic (Native )

  • Pyle, R. 1981. The Audubon Society Field Guide to North American Butterflies. New York, New York: Alfred A. Knopf, Inc..
  • Tveten, J., G. Tveten. 1996. Butterflies of Houston and Southeast Texas. Austin, Texas: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The zebra swallowtail butterfly has a wing span of 5-9 cm. It has long, triangular wings with swordlike tails. The color and size varies between spring and summer butterflies. The early spring zebra swallowtail is smaller with pale greenish-white wings which are crossed by black stripes and bands. They also have shorter tails. The summer zebra swallowtail is larger with light blue-green wings, which are crossed by black stripes and bands, and have longer tails. The hindwings of both the spring and summer zebra swallowtail have two deep blue spots at the base and a red spot closer to the body.

Caterpillars are generally hairless. They have a forked gland called the osmeterium that can protrude from the back of the head if the butterfly is alarmed. This releases a bad smell that is used as defense mechanism. There are two color morphologies of caterpillars. The first is green with yellow and black bands, and the other is dark brown with orange and white bands.

Range wingspan: 5 to 9 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Parenti, U. 1977. The World of Butterflies and Moths. New York, New York: G. P. Putman's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Iphiclides marcellus
Catalog Number: USNM USNMENT781128
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Preparation: pinned
Collector(s): F. Forbes
Year Collected: 1935
Locality: Greenwood Co., Kan, Greenwood, Kansas, United States
  • Type:; : Field, W. Pomona College Journal of Entomology and Zoology. 28 (2): 20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Meadows, riversides, lakeshores and marshes; broad-leaved woodlands, virtually anywhere that pawpaw grows. Also dry pine or pine-oak woods at least in Florida with dwarf pawpaw. Almost any habitat with adequate foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The zebra swallowtail prefers corridors of wooded land alongside bodies of water such as riversides, lakeshores, marshes and open moist woods.

Habitat Regions: temperate

Terrestrial Biomes: forest

Other Habitat Features: riparian

  • Holland, W. 1910. The Butterfly Book. Garden City, New York: Doubleday, Page and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The zebra swallowtail rarely strays away from the habitats where various species of pawpaw are found. The common food plants for the larvae are the pawpaw and dwarf pawpaw. Some larvae will eat other caterpillars found on the same plant. The adult zebra swallowtail will eat nectar from a variety of flowers. Adults generally eat from taller flowers, because they have a long, flexible "tongue" called a proboscis and can feed from longer, tubed flowers.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Papilio marcellus in Illinois

Papilio marcellus Cramer: Papilionidae, Lepidoptera
(a scientific synonym of this butterfly is Eurytides marcellus; observations are from Robertson, Fothergill & Vaughn; this butterfly is the Zebra Swallowtail)

Apiaceae: Cicuta maculata sn (Rb), Heracleum maximum sn (Rb); Asteraceae: Erigeron philadelphicus sn (FV), Senecio glabellus sn (FV), Taraxacum officinale sn (FV); Boraginaceae: Lithospermum canescens sn fq (Rb); Brassicaceae: Dentaria laciniata sn (Rb); Caprifoliaceae: Viburnum dentatum sn (Rb); Cornaceae: Cornus racemosa sn (Rb); Fabaceae: Melilotus alba sn (Rb), Robinia pseudoacacia sn np (Rb), Trifolium pratense sn (Rb, FV); Fumariaceae: Dicentra cucullaria sn np (Rb); Grossulariaceae: Ribes missouriense sn (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Stachys palustris sn np (Rb); Polemoniaceae: Phlox divaricata laphamii sn (Rb); Santalaceae: Comandra umbellata sn (Rb); Verbenaceae: Phyla lanceolata sn (FV), Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Mostly residential in America north of Mexico (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

In the life cycle of the butterfly, it takes about one month for the zebra swallowtail to mature from an egg to an adult. The chrysalis, or pupa, is attached to a stem or leaf by the tail and by a girdle of silk around the thorax. It hangs head upward in this position.

Development - Life Cycle: metamorphosis

  • Parenti, U. 1972. Butterflies and Moths. London: Orbis Publishing Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

An adult Eurytides marcellus butterfly can live up to 6 months in its natural environment.

Range lifespan

Status: wild:
6 (high) months.

Typical lifespan

Status: wild:
6 (high) months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males usually patrol places near host plants searching for females. Small aggregations of patrolling males often form close to mud puddles or moist stream banks.

Female zebra swallowtails lay their eggs singly on the underside of pawpaw leaves.

Key Reproductive Features: fertilization (Internal ); oviparous

  • Holland, W. 1910. The Butterfly Book. Garden City, New York: Doubleday, Page and Company.
  • Parenti, U. 1972. Butterflies and Moths. London: Orbis Publishing Limited.
  • Tveten, J., G. Tveten. 1996. Butterflies of Houston and Southeast Texas. Austin, Texas: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurytides marcellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGACTTTATTCAACAAATCATAAGGATATTGGAACATTATATTTTATTTTTGGTATTTGATCTGGGATAATTGGAACTTCATTAAGAATATTAATTCGTACTGAATTAGGTAATCCTGGCTCATTAATTGGTGAT---GATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATTCTTCTTATTTCTAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTCTATCCCCCTCTTTCATCAAATATTGCTCATAGAGGAAGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAACTTCATTACTACCATTATTAATATACGAATTAATAATATATCCTTTGATCAAATACCTCTATTTGTATGAGCAGTTGGAATTACAGCTTTACTTTTACTATTATCTTTACCTGTTTTAGCAGGTGCCATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGTATAATTTCACATATCATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGATGTTTAGGAATAATTTATGCTATAATATCAATTGGATTACTAGGTTTTATTGTATGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurytides marcellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This butterfly needs no special protective status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Currently it does not adversely affect humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Economic benefits from this species have yet to be discovered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Protographium marcellus

The Zebra Swallowtail (Protographium marcellus, formerly listed under genera Eurytides, Iphiclides, Graphium and Papilio by some authorities) is a swallowtail butterfly native to the eastern United States and southeast Canada. Its distinctive wing shape and long tails make it easy to identify, and its black and white-striped pattern is reminiscent of a zebra.[1][2] The butterflies are closely associated with pawpaws, and are rarely found far from these trees. The green or black caterpillars feed on the leaves of various pawpaw species, while the adults feed on flower nectar and minerals from damp soil.

Description[edit]

Summer form

The Zebra Swallowtail has a wingspan of 6.4 to 10.4 cm (2.5 to 4.1 in).[3] The triangular wings are white to greenish-white with black longitudinal stripes. A pair of swordlike tails extend from the hind wings.[2] The inner margin of the hind wing has two blue spots on the corner and a red spot near the body.[2] A red stripe runs along the middle of the ventral hind wing. P. marcellus has two seasonal forms, one occurring in the spring and the other in the summer. Spring forms are smaller, more white, and have short, black tails with white tips. Summer forms are larger, have broader black stripes, and longer, black tails with white edges.[1][4]

Flight period[edit]

The Zebra Swallowtail can be seen from late March to August in the northern portion of its range and from February to December in the southern portion. It has two broods in the north and three to four in the south,[5] with the first brood being the most numerous.[2]

Behavior[edit]

Males will patrol near host plants in search of females, flying swiftly and directly.[6] They usually fly 0.5 to 1.8 meters (2 to 6 ft) above the ground. Females will fly slowly when searching for suitable host plants.[5][7] Both males and females avidly visit flowers, including species from the families Apocynaceae, Brassicaceae, Fabaceae, Lythraceae, Polemoniaceae, and Rosaceae. Males participate in a behavior known as puddling, in which individuals congregate on sand, gravel, or moist soil to obtain salts and amino acids.[7] These nutrients aid the male in reproduction.[8] Other food sources include rotting fruit and urine.[5][7]

Life cycle[edit]

Since the caterpillars are cannibalistic, females lay their eggs singly on pawpaw leaves or on the tree trunks. The round egg is pale green, later turing an orange-brown color. Young caterpillars are black with lighter colored transverse stripes. Older larvae have two color forms. The more common form is green with yellow and white transverse stripes; the rarer form is black and banded with white and orange. In both forms, between the swollen thorax and the abdomen, there is a yellow, black, and bluish-white band.[6][9] The larva has a yellow, foul-smelling, forked gland called an osmeterium which it will use to deter predators, especially spiders and ants.[5] The chrysalis is either green or brown, and is more compact compared to chrysalids in the genus Papilio. Three small horns project from the head and thorax. The chrysalis hibernates in areas of its range with cold winters.[6]

Life cycle
Female P. marcellus laying an egg on Common Pawpaw 
An egg on a host plant leaf. On the left, the egg is one day old; on the right, it is three days old. 
A green form larva 
A black form larva 
Lateral side of a chrysalis 

Host plants[edit]

A. triloba, a host plant of the Zebra Swallowtail

The Zebra Swallowtail caterpillar feeds only on species within the genus Asimina. Commonly used species include A. angustifolia (Slimleaf Pawpaw), A. incana (Woolly Pawpaw), A. parviflora (Smallflower Pawpaw), A. reticulata (Netted Pawpaw), A. tetramera (Four-petal Pawpaw), and A. triloba (Common Pawpaw).[5][10][11] P. marcellus caterpillars ingest chemicals called annonaceous acetogenins from their host plants, which are retained in the body tissues of both the caterpillar and the adult, and may help chemically protect the butterfly from birds.[5]

References[edit]

  1. ^ a b Brock, Jim P.; Kaufman, Kenn (2003). Butterflies of North America. New York City, NY: Houghton Mifflin Company. p. 24. ISBN 0-618-15312-8. 
  2. ^ a b c d Pyle, Robert Michael (1981). National Audubon Society Field Guide to North American Butterflies. NY: Alfred A. Knopf. pp. 347–348. ISBN 0-394-51914-0. 
  3. ^ Opler, Paul A. "Zebra Swallowtail Eurytides marcellus". Butterflies and Moths of North America. Big Sky Institute at Montana State University. Retrieved 30 March 2011. 
  4. ^ Shull, Ernest M (1987). The Butterflies of Indiana. IN: Indiana Academy of Science. p. 81. ISBN 0-253-31292-2. 
  5. ^ a b c d e f Cech, Rick; Tudor, Guy (2005). Butterflies of the East Coast. Princeton, NJ: Princeton University Press. p. 61. ISBN 0-691-09055-6. 
  6. ^ a b c Scott, James A. (1986). The Butterflies of North America. Stanford, CA: Stanford University Press. pp. 162–163. ISBN 0-8047-2013-4. 
  7. ^ a b c Iftner, David C.; Shuey, John A.; Calhoun, John V. (1992). Butterflies and Skippers of Ohio. OH: College of Biological Sciences and The Ohio State University. p. 67. ISBN 0-86727-107-8. 
  8. ^ Medley, Scott R.; Eisner, Thomas (January 1996). "Sodium:A male moth's gift to its offspring" (PDF). Proceedings of the National Academy of Sciences 93 (2): 809–813. doi:10.1073/pnas.93.2.809. Retrieved 30 March 2011. 
  9. ^ Wagner, David L. (2005). Caterpillars of Eastern North America. Princeton, NJ: Princeton University Press. p. 82. ISBN 0-691-12144-3. 
  10. ^ Glassberg, Jeffrey (1999). Butterflies through Binoculars: The East. New York City, NY: Oxford University Press. p. 44. ISBN 0-19-510668-7. 
  11. ^ Hall, Donald W.; Butler, Jerry F. (September 1998). "Zebra swallowtail". Featured Creatures. Retrieved 31 March 2011. 

Further reading[edit]

  • Edwin Möhn, 2002 Schmetterlinge der Erde, Butterflies of the world Part XIIII (14), Papilionidae VIII: Baronia, Euryades, Protographium, Neographium, Eurytides. Edited by Erich Bauer and Thomas Frankenbach Keltern : Goecke & Evers ; Canterbury : Hillside Books. ISBN 978-3-931374-87-7 All species and subspecies are included, also most of the forms. Several females are shown the first time in colour.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!