Overview

Brief Summary

Biology

Pairs can mate for life, although 'divorces' are not uncommon (3). During the breeding season, that runs from June to March, they are extremely territorial; males usually defend their territory through calling displays but may occasionally fight intruding birds (5). Females produce one of the proportionally largest eggs of any bird, comprising about 15 percent of her body weight (3) (5). The enormous egg is laid within the burrow. Two eggs may be laid in a clutch, but they are laid three to four weeks apart (3). Up to three different clutches can be laid in a year (5). The male North Island brown kiwi has the role of incubating the egg, and he develops a bare patch of skin on his belly (known as a 'brood patch') that facilitates the transfer of heat to the developing egg (5). Incubation takes 75 to 90 days (3) and the male will leave the egg to forage during the night, concealing the burrow entrance whilst he is gone (5). Chicks hatch fully-feathered and will venture out of the nest when about a week old, but they keep returning to the nest each day until they leave their natal territory at four to six weeks of age (3) (5). Kiwis are nocturnal, terrestrial birds, spending the day in burrows dug into the ground with powerful claws (4) (5). Invertebrates constitute the majority of the diet, and insects are found by probing beneath leaf litter with the long beak (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The kiwi is New Zealand's national bird, and is a name often associated with inhabitants of these islands (4). The North Island brown kiwi is one of five species of kiwi found in New Zealand (1). These birds have a spiky brown plumage, streaked with reddish brown (2). The long, thin bill is ivory and, uniquely for birds, has nostrils located at the end (2) (4). As flightless birds, kiwis may look quite bizarre as they lack visible wings (2); indeed, the genus name Apteryx means 'wingless' in Latin (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Apteryx mantelli was once widespread throughout the North Islands and northern South Islands of New Zealand. Remaining populations are isolated and fragmented. Birds are locally common in Northland, and mostly sparsely distributed in the Coromandel Peninsula, Bay of Plenty, Gisborne to the northern Ruahine Range, and from Tongariro to Taranaki. Stable populations are present on Little Barrier (c.1,000 birds), Kawau and Pounui Islands (Heather and Robertson 1997, H. A. Robertson in litt. 1999). Hybrids are present on Kapiti Island (H. A. Robertson in litt. 1999). The total population was estimated at 25,300 birds in 2008 (Holzapfel et al. 2008), down from an estimated 35,000 (± c.25%) birds in 1996 (Robertson 2003). Numbers have probably declined by at least 90% since 1900, and are declining at 2.5% per annum in unmanaged mainland populations (Robertson et al. 2011). The previously estimated decline of 5.8% per annum (McLennan et al. 1996) is now thought to have been too pessimistic and based on a small sample size subject to several acute mortality events (Robertson et al. 2011). The total A. australis 'Okarito' population is thought to be 300 individuals (Holzapfel et al. 2008) restricted to 10,000 ha of coastal podocarp-hardwood forest between the Okarito River and the Waiho River (Tennyson et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

North Island (New Zealand).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to New Zealand and previously widespread throughout the northern two-thirds of the North Island, this species has now declined in many districts (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It favours dense, subtropical and temperate forests, but is also found in shrublands, scrub, regenerating forest, exotic pine plantations and pasture (Marchant and Higgins 1990). Diet Invertebrates are the primary food (Heather and Robertson 1997). Breeding Clutch size is one or two (with single clutches more frequent in high-density populations [Ziesemann et al. 2011]) and there are up to three clutches in a year (Colbourne 2002, Ziesemann et al. 2011). The male carries out almost all of the incubation (Colbourne 2002), which is amongst the longest for any bird at between 74 and 84 days (Calder et al. 1978). Laying was recorded in every month between June and November in a high-density population in 2007 (Ziesemann et al. 2011). Chicks hatch fully-feathered, and first leave the nest unaccompanied after about a week. It is long-lived, with generation time taken to be 10-15 years (H. A. Robertson in litt. 1999). More chicks were found to hatch in reused nests than in previously unused burrows (Ziesemann et al. 2011).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits dense subtropical and temperate forests, and scrubland (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apteryx mantelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTATTACTCGATGACTCTTCTCAACTAACCATAAAGATATCGGTACACTATATCTCATTTTCGGTGCATGAGCAGGCATAGTGGGCACCGCCCTCAGCCTACTCATCCGAGCCGAACTCGGCCAACCAGGAACCCTACTAGGAGATGACCAAATCTACAACGTCATTGTCACCGCCCATGCTTTTGTAATAATCTTCTTCATAGTAATACCCGTAATAATCGGAGGCTTCGGGAACTGACTTGTCCCCCTCATAATTGGCGCTCCAGACATGGCATTCCCGCGAATAAATAACATAAGCTTCTGACTTCTACCTCCCTCCTTCCTACTCTTGTTAGCATCATCTACTATTGAAGCTGGAGCAGGGACAGGATGGACAGTATACCCTCCATTAGCCGGAAACCTTGCCCATGCAGGTGCATCTGTAGACCTCGCCATCTTTTCACTTCATCTAGCAGGTATCTCCTCAATCTTAGGAGCAATCAACTTCATTACTACAGCAATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACACCCCTATTCGTATGGTCTGTACTAATTACTGCCATTCTCCTCCTACTGTCCCTTCCAGTGCTTGCTGCTGGCATTACAATGCTTCTCACAGATCGAAACCTTAATACTACATTCTTTGACCCTGCTGGAGGAGGAGACCCTGTGCTATACCAACATCTATTCTGATTCTTTGGTCACCCTGAAGTCTATATCTTAATTCTACCCGGCTTCGGAATAATCTCACACGTAGTAACCTATTATGCAGGTAAAAAAGAACCCTTCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apteryx mantelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bce+3bce+4bce

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Robertson, H. & Weeber, B.

Justification
Mainland populations of this species may be decreasing extremely rapidly, based on annual declines, predation and loss of habitat. However, owing to the stability of island populations, and intensive predator control in select mainland populations, the overall decline is likely to be slower, but still very rapid, thus warranting Endangered status.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In 1996, the total population was estimated to number 35,000 individuals. Holzapfel et al. (2008) estimated a total population of 8,000 individuals in the Northland population, 1,000 in the Coromandel population, and 8,000 in both the western and eastern North Island populations in 2008. Colbourne et al. (2005) reported that the Okarito population was at a minimum of c.160 individuals in 1995 and had increased to c.200 by 2000. It was estimated to have increased further to 300 individuals by 2008. The total population estimate is precautionarily retained as 35,000 individuals until these data are confirmed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The most significant threat to the survival of the species is predation of adults by dogs and ferrets Mustela furo (Robertson 2010), with predation of young kiwi by Stoat Mustela erminea and cats also affecting populations (McLennan et al. 1996, Basse et al. 1999, Holzapfel et al. 2008, Robertson 2010). Significant spikes of mortality can occur, for example, a single dog killed c.500 birds in six weeks (Taborsky 1988), and over 70 incidents of dogs killing kiwi in Northland occurred between 1990 and 1995 (Pierce and Sporle 1997). The smaller male kiwi may be at greater risk of predation by ferrets, resulting in a skewed sex ratio and reduced effective population size (Robertson 2010). In one population prior to management at least 94% of chicks died before reaching breeding age (McLennan et al. 1996). About half were killed by introduced predators, in particular, stoat Mustela erminea and cats (McLennan et al. 1996). Juvenile kiwi become too large for stoats above about 800g, which takes about four months to achieve (McLennan et al. 2004). The clearance of habitat fragments continues to threaten small populations (Hutching 1995, Miller and Pierce 1995), but the rate of loss of native habitat has declined markedly and this is not currently considered a driver for population reductions (Robertson 2010). New avian diseases and pathogens are a potential threat, particularly with the importation of non-native but closely related ratites to New Zealand (Holzapfel et al. 2008). The Okarito population is at risk from stochastic events due to its small size and isolation and suffers from low fecundity (Holzapfel et al. 2008). No recruitment was observed from 12 breeding attempts monitored in this population prior to any management intervention (Colbourne 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Island brown kiwis have undergone a dramatic decline and as much as 90 percent of the population may have been lost since the start of the 20th Century (2). Research since the early 1990s has revealed that kiwi numbers in unmanaged areas of the North Island have been declining by about four percent a year (5). These birds evolved on an island that lacked terrestrial mammalian predators and have been devastated by the introduction of species such as dogs, stoats and cats (5); a single dog is known to have killed roughly 500 birds in one six-week period (2). Around 95 percent of chicks never reach sexual maturity, primarily as a result of predation, but also as the results of accidents such as falls from cliffs, drowning and encounters with traps or poison set for possums (3) (5). The loss of much of New Zealand's habitat has exacerbated these threats by isolating surviving populations and predators in fragmented pockets of remaining habitat (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Monitoring is intensive and nationally coordinated, and uses call-counts, specially-trained dogs searching for banded birds, and radio-tracking (Robertson et al. 2010). Key populations are managed by controlling predators by the use of trapping and poisoned baits (Robertson 1998), with leg-hold predator traps are raised above the ground to prevent accidental trapping (H. A. Robertson in litt. 1999). Kiwi aversion training for hunters' dogs is being trialled, although there is no evidence that this is a viable long-term solution (Robertson et al. 2010). A programme of removing and incubating eggs and returning subadults once these are large enough to fend off predators has been developed since 1995 under the name Operation Nest Egg (ONE, or BNZONE as the funding has been provided by the Bank of New Zealand) (Colbourne et al. 2005, Pickard 2009, Robertson et al. 2010). A dedicated rearing facility was constructed at which 942 eggs received from the wild produced 475 young released back into the wild between 1995 and 2008 (Pickard 2009), with survival in captivity greatly improving during this time (Colbourne et al. 2005, Pickard 2009). BNZONE has been demonstrated to be the most effective tool for the species, resulting in a 12.5% annual population increase within managed sites, due to 83% chick survival (Robertson et al. 2010). Due to the cost and need to locate nests this approach is only practical within areas up to 10,000 ha and should be used to turn around declines in the most threatened and restricted populations and subspecies (Colbourne et al. 2005). Many national and overseas captive populations are held (Heather and Robertson 1997).

Conservation Actions Proposed
Carry out landscape-scale pest control at sufficient intervals at the sites that are currently unmanaged, specifically for mustelids, rats, cats and dogs (Holzapfel et al. 2008). Clarify the taxonomy of the Okarito population. Conduct research into reasons for low productivity in the Okarito population. Evaluate islands for possible translocation of Okarito birds. Intensively manage the Okarito population, and at least one population of each regional taxon using the BNZONE programme to increase the population size (Holzapfel et al. 2008). Consider establishing a further population of Okarito birds in North Okarito Forest (B. Weeber in litt. 2000). Undertake population modelling for all taxa. Investigate landscape-scale remote monitoring techniques for sparse populations (Holzapfel et al. 2008). Promote legislative and policy changes to protect populations and encourage high-quality advocacy at all levels (Robertson 1998, Holzapfel et al. 2008). Educate and inform the public and encourage community involvement in Kiwi conservation (Robertson 1998, Holzapfel et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The North Island brown kiwi is the subject of a concerted and wide-ranging conservation programme managed by the New Zealand Department of Conservation and Bank of New Zealand Save the Kiwi (3) (4). A number of different strategies are being employed, including the protection of wild nests and chicks by trapping predators, the artificial incubation of eggs and chicks in predator-free environments until they are big enough and old enough to cope with stoats and cats, and breeding of captive birds for release into the wild (3) (4). In the species' stronghold of Northland, the Whangarei Kiwi Sanctuary has been established whilst on the Coromandel Penninsula, Moehau Kiwi Sanctuary protects the individuals located there (5). Where there is active management of populations and predator control, North Island brown kiwi numbers have shown dramatic increases (5). It is hoped that the many conservation measures in place will help to preserve New Zealand's national bird for generations to come.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

North Island Brown Kiwi

The North Island brown kiwi (Apteryx mantelli; Apteryx australis or Apteryx bulleri[3] as before 2000, still used in some sources), is a species of kiwi that is widespread in the northern two-thirds of the North Island of New Zealand and, with about 35000 remaining,[2] is the most common kiwi. This bird holds the world record for laying the largest eggs relative to its body size.[4]

Taxonomy[edit]

Until 2000, the brown kiwi (then Apteryx australis) was thought to include the rowi and the tokoeka, in addition to the North Island brown kiwi. However using genetic codes from each of the above it was determined that the tokoeka was a separate species, it took the Apteryx australis name, leaving the brown kiwi with its current Apteryx mantelli name. Soon after, in 1998, more genetic tests were done with the rowi and it was determined that it (the rowi) was a separate species (Apteryx rowi). In 2004 an injured bird was found with streaked white around the head and identified by Massey University.[5] The white feathering is likely due to a rarely seen genetic variation sometimes described as a partial albino. Few documented cases exist with only a painting of one found in Otorohanga in the 18th century and a specimen in the Canterbury Museum. The injured bird recovered and was introduced into a breeding programme.

The brown kiwi was first described as Apteryx australis by Abraham Dee Bartlett, in 1813, based on a specimen from Dusky Sound, South Island, New Zealand.[6] This is a monotypic species.[7]

Breeding population and trends
LocationPopulationDateTrend
North Island[8]25002008Decreasing -4% yr
Little Barrier Island[2]25001996Stable
Ponui Island[2]Stable
Kapiti Island [8]Stable
Kawau Island[2]Stable
Total (New Zealand)5000[2]1996Decreasing -2% yr[8]

Range and habitat[edit]

Brown kiwi are found throughout the North Island, occurring near Northland, Coromandel, Eastern North Island, Aroha Island, Little Barrier Island, Kawau Island, Ponui Island, and the Wanganui Region. The North Island brown kiwi has demonstrated a remarkable resilience: it has adapted to live on scrub-like farm land, pine (an introduced tree) plantations, and their native forests, but it still prefers dense, sub-tropical and temperate forest.[9]

Description[edit]

Females stand about 40 cm (16 in) high and weigh about 2.8 kg (6.2 lb) the males about 2.2 kg (4.9 lb). The plumage is streaky red-brown and spiky. The North Island brown kiwi is the only species of kiwi found internationally in zoos.[citation needed]

Behaviour[edit]

Brown Kiwi chick

These kiwi, like all kiwi, feed on invertebrates. They have 2-3 clutches a year with 2 eggs in each clutch. Chicks are fully feathered at hatching and leave the nest and can fend for themselves within 1 week.[9]

Conservation[edit]

The North Island brown kiwi is endangered, per the IUCN Redlist,[1] with the major threat coming from predators, such as dogs, cats, and stoat Mustela erminea. 94% of chicks die before breeding in areas where mammalian pest control is not carried out.[9] It has an occurrence range of 38,400 km2 (14,800 sq mi), with a population, estimated in 2000, of 35,000.[2]

Nationwide studies show that on average only 5 per cent of kiwi chicks survive to adulthood. However, in areas under active pest management, survival rates for North Island Brown Kiwi can be far higher. For example, prior to a joint 1080 poison operation undertaken by DOC and the Animal Health Board in Tongariro Forest in 2006, 32 kiwi chicks were radio-tagged. 57% of the radio-tagged chicks survived to adulthood. Thanks to ongoing pest control, the adult kiwi population at Tongariro has almost doubled since 1998.

Footnotes[edit]

  1. ^ a b BirdLife International (2012). "Apteryx mantelli". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g BirdLife International (2008)
  3. ^ A History of the Birds of New Zealand
  4. ^ Guinness World Records 2013, Page 050, Hardcover Edition. ISBN 9781904994879
  5. ^ http://masseynews.massey.ac.nz/2004/Press_Releases/11_09_04.html
  6. ^ Davies, S. J. J. F. (2003)
  7. ^ Clements, J (2007)
  8. ^ a b c Save the Kiwi (2008)
  9. ^ a b c BirdLife International

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!