Overview

Distribution

Western Indian Ocean: Red Sea.
  • Randall, J.E. 2013 Seven new species of labrid fishes (Coris, Iniistius, Macropharyngodon, Novaculops, and Pteragogus) from the Western Indian Ocean. J. Ocean Sci. Foundation 7:1-43. (Ref. 93522)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

9.5 cm SL (male/unsexed; (Ref. 2694))
  • Randall, J.E. 1978 A revision of the Indo-Pacific labrid fish genus Macropharyngodon, with descriptions of five new species. Bull. Mar. Sci. 28(4):742-770. (Ref. 2694)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found solitary or in pairs in coral reef areas and usually aloof. Feeds on invertebrates by picking items from the substratum. Burrows in the sand at the sign of danger (Ref. 5503).
  • Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is distinguished by the following characters: D IX,11; A III,11; pectoral rays 12 (including upper rudimentary ray); complete lateral line, angling downward below last 3 or 4 dorsal rays to straight peduncular portion, 27 pored scales (plus 1 on base of caudal fin); anterior lateral-line scales with 2 or 3 (rarely 4) pores; gill rakers 14-17; body depth 2.6-2.9 in SL; head length (HL) 2.95-3.05 in SL; snout short, 3.3-3.7 in HL; upper jaw with 2 pairs of canine teeth, 1st pair straight and strongly projecting anteriorly, 2nd pair about two-thirds as long, with tips recurved and outflaring; lower jaw with a medial pair of long, straight, forward-jutting, canine teeth, each with an adjacent more slender canine about two-thirds as long, with recurved tip; side of jaws with single row of close-set conical teeth, progressively shorter posteriorly; a very large, slender, forward-projecting, canine tooth posteriorly on upper jaw; lower pharyngeal plate with an enormous central molariform tooth, on each side anteriorly with a row of small conical teeth, continuing as a single row on the long anterior process; each of the pair of upper pharyngeal plates with 2 large, nearly square molars, preceded by a patch of small stout conical teeth; orbit diameter 4.25-4.95 in HL; origin of dorsal fin slightly anterior to a vertical at upper end of gill opening; first dorsal spine 4.25-5.25 in HL; remaining spines progressively longer, 9th 3.1-3.25 in HL; 5th or 6th dorsal soft ray longest, 1.9-2.2 in HL; 3rd anal spine longest, 2.45-3.55 in HL; 5th or 6th anal soft ray longest, 1.95-2.2 in HL; caudal fin slightly rounded, 1.2-1.3 in HL; pectoral fins 1.4-1.5 in HL; pelvic fins 1.35-1.8 in HL, usually reaching to or slightly posterior to origin of anal fin in mature males, usually not reaching anus in females (Ref. 93522).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 4 - 16 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.8 - 12
  Temperature range (°C): 27.134 - 28.006
  Nitrate (umol/L): 0.146 - 0.402
  Salinity (PPS): 34.563 - 35.125
  Oxygen (ml/l): 4.503 - 4.700
  Phosphate (umol/l): 0.207 - 0.223
  Silicate (umol/l): 3.061 - 4.752

Graphical representation

Depth range (m): 0.8 - 12

Temperature range (°C): 27.134 - 28.006

Nitrate (umol/L): 0.146 - 0.402

Salinity (PPS): 34.563 - 35.125

Oxygen (ml/l): 4.503 - 4.700

Phosphate (umol/l): 0.207 - 0.223

Silicate (umol/l): 3.061 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropharyngodon bipartitus bipartitus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATCCGAGCCGAATTAAGCCAGCCCGGCGCTCTCCTTGGAGACGACCAGATTTACAATGTAATCGTAACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATGCCTATTATGATCGGCGGCTTCGGAAACTGACTAATTCCATTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAATGAACAATATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTCCTTCTCTTAGCCTCGTCAGGCGTAGAGGCCGGGGCCGGAACTGGTTGAACAGTCTATCCACCTTTAGCAGGAAACCTAGCCCATGCGGGAGCATCCGTTGACCTAACCATCTTCTCCTTACATTTAGCAGGCATTTCTTCAATTTTAGGTGCAATCAACTTTATTACAACAATTATTAATATGAAACCCCCAGCTATCTCCCAATATCAAACACCCCTGTTCGTCTGAGCCGTTCTAATCACAGCAGTCCTTCTGCTCCTCTCCCTGCCCGTCCTGGCTGCTGGCATTACCATGCTTCTGACTGACCGAAACCTTAATACCACCTTCTTCGACCCCGCCGGGGGAGGGGACCCAATCTTATATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Macropharyngodon bipartitus bipartitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!