Overview

Comprehensive Description

Biology

Inhabits lagoon and sheltered seaward reefs (Ref. 9710). Occurs singly or in pairs; females often found in small groups (Ref. 9710). Feeds on invertebrates by picking items from the substratum. Burrows in the sand at the sign of danger (Ref. 5503).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: ranging south to Natal, South Africa; excluding the Red Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

13.0 cm TL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range ? - 30 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.8 - 12
  Temperature range (°C): 27.134 - 28.006
  Nitrate (umol/L): 0.146 - 0.402
  Salinity (PPS): 34.563 - 35.125
  Oxygen (ml/l): 4.503 - 4.700
  Phosphate (umol/l): 0.207 - 0.223
  Silicate (umol/l): 3.061 - 4.752

Graphical representation

Depth range (m): 0.8 - 12

Temperature range (°C): 27.134 - 28.006

Nitrate (umol/L): 0.146 - 0.402

Salinity (PPS): 34.563 - 35.125

Oxygen (ml/l): 4.503 - 4.700

Phosphate (umol/l): 0.207 - 0.223

Silicate (umol/l): 3.061 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and sheltered seaward reefs. Feeds on invertebrates by picking items from the substratum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropharyngodon bipartitus bipartitus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATCCGAGCCGAATTAAGCCAGCCCGGCGCTCTCCTTGGAGACGACCAGATTTACAATGTAATCGTAACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATGCCTATTATGATCGGCGGCTTCGGAAACTGACTAATTCCATTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAATGAACAATATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTCCTTCTCTTAGCCTCGTCAGGCGTAGAGGCCGGGGCCGGAACTGGTTGAACAGTCTATCCACCTTTAGCAGGAAACCTAGCCCATGCGGGAGCATCCGTTGACCTAACCATCTTCTCCTTACATTTAGCAGGCATTTCTTCAATTTTAGGTGCAATCAACTTTATTACAACAATTATTAATATGAAACCCCCAGCTATCTCCCAATATCAAACACCCCTGTTCGTCTGAGCCGTTCTAATCACAGCAGTCCTTCTGCTCCTCTCCCTGCCCGTCCTGGCTGCTGGCATTACCATGCTTCTGACTGACCGAAACCTTAATACCACCTTCTTCGACCCCGCCGGGGGAGGGGACCCAATCTTATATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Macropharyngodon bipartitus bipartitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!