Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Biology

This shy, seldom seen deer is generally solitary or occasionally seen in pairs (6) (7). It feeds predominantly on fruit when available, but will turn to a diet of leaves during periods when fruit is scarce (2) (6). Fungi may also constitute an important part of its diet during the wet season (2). When they sense danger, red brockets have a habit of freezing (7), but they can also run with a leaping gait and, being capable swimmers, will readily take to the water to escape a predator (2) (3). Their dagger-like antlers also makes them capable of damaging combat (3). Calving may take place year round (3) (7), although in some areas there is a peak, such as in Surinam where it mainly takes place from September to April (6). The gestation period is long, lasting from 218 to 228 days (3), and a single young is produced (2). The young deer, which lose their spots after two or three months, mature rapidly and may breed by the age of just 11 months (3). In captivity, an individual lived for over 16 years (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The red brocket is the largest of all brocket deer, and also has the greatest range (3). Named for its foxy red coat, this stout-bodied deer with slender limbs has white fur on the inside of the legs, throat, lips, inner part of the ear and the lower part of the tail (3). Young red brockets have whitish spots on their coat (2). Like the majority of deer species (5), male red brockets have antlers, but they are generally only short, dagger-like spikes. These antlers can be shed at any time of the year, and may be kept for over one year (3). Fourteen subspecies of the red brocket are currently recognised (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The red brocket deer distribution ranges across northern South America from northern Argentina (Misiones, Salta, Jujuy, Tucumán, Formosa, Chaco and Corrientes), Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Surinam, Trinidad, Tobago, and Venezuela (Emmons and Feer 1997; Reid 1997; Medellín et al. 1998; Juliá and Richard, 2001, Wilson and Redder, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Red brockets occur from southern Mexico to northern Argentina up to 2000m elevation.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in Central and South America, from eastern Mexico and Trinidad south to northern Argentina (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Small deer (shoulder height 670-760mm) with chestnut-red body and legs, lighter chestnut belly, and grey head and neck. Males have short, unbranched antlers that are directed backwards. Measurements: Total: 1040-1340mm; Tail: 95-145mm; Hind Foot: 580-800mm; Ear: 86-105mm.

Range mass: 24 to 48 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is the largest species of the Mazama genus. It weighs between 30 and 40 Kg and is 65 cm tall (Duarte, 1996). Ribeiro (1919) and Vieira (1955) believe that this species occurs from Guianas and Peru to Rio Grande do Sul State of Brazil, including Paraguay and Argentina. Junqueira (1940) states that the Red Brocket Deer prefer large forests and riverbanks that are almost always covered with vast vegetation, thereby avoiding the sun. In Argentina, Olrog and Lucero (1981) reported that M. americana inhabits closed fields. As Emmons (1990) stated, this species is adapted to living in forests. According to Bodmer (1997), this species in the Amazon prefer firm, humid forest borders. In the rain forests, Red Brocket Deer are predominantly frugivores with fruit making up around 80% of their diet. During seasonally dry periods the diet of M. americana switches to greater proportions of browse.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These small deer live in dense, moist forest and are found in mature and secondary rainforest, forest edges, gardens, and plantations. Their small size allows them to slip through dense vegetation, and they will readily swim to escape danger.

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brocket deer usually inhabit forests and woodlands from sea level up to 5,000 metres (7). The red brocket appears to prefer fairly dry or moist habitats and generally avoids very wet, flooded areas (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Red brocket deer are selective browsers and prefer to feed on fruit. When fruit is not available, leaves are the primary food source. During the wet season, fungimake up a large part of the diet.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
13.8 years.

Average lifespan

Status: wild:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.1 years (captivity) Observations: In the wild, these animals have been estimated to live up to 12 years (Bernhard Grzimek 1990). One captive specimen lived 17.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In Argentina, red brocket deer reproduce from August to October. In Suriname, does give birth over at least a seven month period, while in Guyana fawning occurs throughout the year. Does typically give birth to one young, but twinning is not uncommon. The gestation period in captivity averages 225 days. Does reach sexual maturity after 13 months, stags are mature at 12 months.

Average birth mass: 538.5 g.

Average gestation period: 225 days.

Average number of offspring: 1.3.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
395 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mazama americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTCTCAACTAACCATAAAGATATTGGCACCCTATACTTACTATTTGGTGCTTGAGCAGGTATAGTAGGAACTGCCTTAAGCCTACTAATCCGTGCTGAACTGGGTCAACCTGGAACTCTACTCGGAGATGATCAAATTTATAATGTAATTGTAACTGCACATGCATTTGTAATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGGTTCGGTAATTGACTTGTTCCATTAATAATTGGTGCTCCAGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCTCCCTCTTTTTTATTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGCTGAACTGTTTATCCCCCTCTAGCTGGCAACCTGGCTCACGCAGGAGCTTCAGTAGACTTAACTATTTTTTCTCTACATTTGGCGGGTGTCTCCTCGATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCTATATCACAATATCAAACCCCTTTATTTGTATGATCTGTATTAATTACTGCCGTATTACTACTTCTCTCACTCCCCGTACTAGCAGCTGGAATTACAATACTACTAACAGACCGAAATTTAAACACAACCTTCTTCGATCCAGCAGGAGGCGGAGACCCCATCCTATATCAACACTTATTCTGATTTTTTGGACACCCTGAAGTGTATATTTTAATCTTACCTGGGTTTGGTATAATTTCCCATATCGTAACTTATTACTCGGGAAAAAAAGAACCATTTGGGTATATGGGGATAGTCTGAGCTATGATATCAATCGGATTTTTAGGATTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATAGACGTTGATACACGAGCCTATTTTACATCAGCTACTATAATTATTGCTATTCCAACAGGAGTAAAAGTCTTTAGTTGACTAGCAACACTTCACGGAGGTAACATTAAATGATCACCTGCTATAATATGAGCCCTAGGCTTTATTTTCCTTTTTACAGTTGGAGGACTAACCGGAATCGTCCTTGCCAATTCTTCTCTTGATATTGTTCTTCACGATACTTACTACGTAGTTGCACATTTCCACTATGTCCTATCAATAGGAGCTGTGTTTGCCATTATAGGAGGGTTTGTCCACTGATTTCCATTATTTTCAGGCTATACTCTTAATGATACATGAGCTAAAATTCACTTTGTAATCATATTTGTAGGTGTAAACATAACCTTTTTTCCACAACACTTCCTAGGACTTTCTGGTATACCACGACGATATTCTGACTACCCAGACGCATATACAATATGAAATACAATCTCTTCTATAGGCTCATTTATCTCCCTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCCAAGCGAGAAGTCTCAACCGTAGAGCTAACAACAACAAATTTAGAGTGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mazama americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Durate, J.M.B., Vogliotti, A. & Barbanti, M.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Data Deficient in light of continued taxonomic uncertainty. Until the systematics of this taxa are better understood it is impossible to evaluate it against the categories and criteria of the IUCN Red List. Until we can define distribution and population size we cannot estimate reduction. In addition we have no evidence that this species will persist outside of forested areas. Thus some populations (which may be species or subspecies) are threatened while others are not, and until we understand the taxonomy we do not have enough information to evaluate it against threats.

History
  • 2000
    Data Deficient
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

CITES Appendix III in Guyana. Red brocket are widespread and common through much of their range. They are scarce in some areas and are threatened by hunting and deforestation.

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007 (1). Subspecies Mazama americana cerasina is listed on Appendix III of CITES in Guatemala (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is suspected to be widespread at low density in northern and northwestern Venezuela. In some areas this species has been overhunted (in densely human populated, rural areas) but likely still occurs at natural densities in the vast sparsely populated areas of the Peruvian Amazon.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting and habitat destruction represent major threats. The species is hunted for meat throughout much of its range (Dietrich pers. comm.). Subsistence hunting of Red Brocket Deer is legal in the Amazonian region of Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the status of most red brocket subspecies is unknown (6), it is clear that in some areas this species faces threats. The red brocket is hunted for meat throughout much of its range, both for subsistence and for sale, with its meat being found extensively in markets of the larger cities of the Amazon Basin (6). Brocket deer are also hunted by people because of the damage they can do to bean and corn crops (7). In certain areas, such as the densely populated areas of the Amazonian region of Peru, the red brocket deer has been reportedly overhunted, while in others, such as Costa Rica, Paraguay and Venezuela, habitat destruction also threatens this species (6). A combination of hunting and habitat destruction may have caused the red brocket to disappear from El Salvador altogether (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in several protected areas across its range. The Red Brocket Deer is one of the focal species in a community-based wildlife management initiative in the Tamshiyacu-Tahuayo Community Reserve of the Peruvian Amazon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The red brocket occurs in numerous protected areas throughout its range (6). The IUCN has been unable to determine the conservation status of this species due to a lack of data, and have therefore classified it as Data Deficient (1). Therefore, research is clearly needed to determine the status of each subspecies, and surveys, ecological studies and investigations into the human use of red brocket have all been suggested (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

They may do some damage to ornamental gardens and plantations planted on the forest edge.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Red brocket are hunted extensively for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red brocket

The red brocket (Mazama americana) is a species of brocket deer from forests in South America, ranging from northern Argentina to Colombia and the Guianas.[1][2] It also occurs on the island of Trinidad in the Republic of Trinidad and Tobago (it also occurred on the island of Tobago until very recent historical times, but appears to have been extirpated there due to wanton poaching of wild game practiced on the island).

It formerly included the Central American red brocket (M. temama) and sometimes the Yucatan brown brocket (M. pandora) as subspecies.[3] Considerable taxonomic confusion still exists for the populations remaining in the red brocket. Pending a solution to this, it has been evaluated as data deficient by the IUCN,[1] though it, as presently defined, is the most widespread species of brocket. It is sympatric with the smaller Amazonian brown brocket over much of its range (the latter tends to have significantly lower population densities). The karyotype of the red brocket was initially described as having 2n = 68, FN = 74, and more recently as having 2n varying from 48 to 54 and FN varying from 54 to 56.[1] This variability may indicate the presence of unrecognized species in the population.[1]

Its body is reddish-brown in color, with a lighter grayish-brown head and neck, and partially blackish legs.[4] The inner thighs and the underside of the tail are white. Fawns are spotted white and lack blackish to the legs.[4] Only the adult male has antlers, and these are small and spike-like. This species is the largest of the brockets. The shoulder height is 67–80 centimetres (26–31 in) and the head and body length 105–144 centimetres (41–57 in).[4] These deer typical weigh 24–48 kilograms (53–106 lb),[4] but exceptional males may get as large as 65 kilograms (143 lb).[5]

The red brocket browses on vegetation, preferring fruit when it is available. It is generally solitary and stays in dense jungles. When alarmed, the animal snorts or stomps its hoof.

References[edit]

  1. ^ a b c d e Durate, J.M.B., Vogliotti, A. & Barbanti, M. (2008). Mazama americana. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 November 2009. Database entry includes a brief justification of why this species is of data deficient.
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Medellín, Rodrigo A.; Alfred L. Gardner; J. Marcelo Aranda (April 1998). "The taxonomic status of the Yucatán brown brocket, Mazama pandora (Mammalia: Cervidae)" (PDF). Proceedings of the Biological Society of Washington 111 (1): 1–14. Retrieved 10 October 2010. 
  4. ^ a b c d Trolle, M., and L. H. Emmons (2004). A record of a dwarf brocket from lowland Madre de Dios, Peru. Deer Specialist Group Newsletter 19: 2–5
  5. ^ Nowak, R. M. (eds) (1999). Walker's Mammals of the World. 6th edition. Johns Hopkins University Press.
  • Emmons, L.H. (1997). Neotropical Rainforest Mammals, 2nd ed. University of Chicago Press ISBN 0-226-20721-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!