Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Biology

This shy, seldom seen deer is generally solitary or occasionally seen in pairs (6) (7). It feeds predominantly on fruit when available, but will turn to a diet of leaves during periods when fruit is scarce (2) (6). Fungi may also constitute an important part of its diet during the wet season (2). When they sense danger, red brockets have a habit of freezing (7), but they can also run with a leaping gait and, being capable swimmers, will readily take to the water to escape a predator (2) (3). Their dagger-like antlers also makes them capable of damaging combat (3). Calving may take place year round (3) (7), although in some areas there is a peak, such as in Surinam where it mainly takes place from September to April (6). The gestation period is long, lasting from 218 to 228 days (3), and a single young is produced (2). The young deer, which lose their spots after two or three months, mature rapidly and may breed by the age of just 11 months (3). In captivity, an individual lived for over 16 years (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The red brocket is the largest of all brocket deer, and also has the greatest range (3). Named for its foxy red coat, this stout-bodied deer with slender limbs has white fur on the inside of the legs, throat, lips, inner part of the ear and the lower part of the tail (3). Young red brockets have whitish spots on their coat (2). Like the majority of deer species (5), male red brockets have antlers, but they are generally only short, dagger-like spikes. These antlers can be shed at any time of the year, and may be kept for over one year (3). Fourteen subspecies of the red brocket are currently recognised (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red brockets are native to the neotropical region ranging from southern Mexico to northern Argentina and from sea level up to 5000 m in elevation.

Biogeographic Regions: neotropical (Native )

  • 2011. "Arkive images of life on earth" (On-line). Accessed September 25, 2011 at http://www.arkive.org/red-brocket/mazama-americana/#text=Habitat.
  • Abril, V. 2010. Elucidating the Evolution of the Red Brocket Deer Mazama americana Complex (Artiodactyla; Cervidae). Cytogenetic and Genome Research, 128: 177-187.
  • Hurtado, G., L. Jorge. 2006. Reproductive biology of female Amazonian brocket. European Journal of Wildlife Research, 3: 171-177.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The red brocket deer distribution ranges across northern South America from northern Argentina (Misiones, Salta, Jujuy, Tucumán, Formosa, Chaco and Corrientes), Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Surinam, Trinidad, Tobago, and Venezuela (Emmons and Feer 1997; Reid 1997; Medellín et al. 1998; Juliá and Richard, 2001, Wilson and Redder, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in Central and South America, from eastern Mexico and Trinidad south to northern Argentina (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Red brockets are the largest members of the genus of brocket deer. The head and neck exhibit a light grayish-brown color. The inner thighs, throat, tail, and inner part of the ears are white. The rest of their bodies are reddish brown to chestnut red in color and young brockets are born with white spots. Males tend to be larger and have spikes to protect against predators. Their shoulder height measures 65 to 80 cm, tail length measures 8 to 15 cm, and the head to body length measures 103 to 146 cm.

Range mass: 20 to 55 kg.

Range length: 103 to 146 cm.

Sexual Dimorphism: male larger; ornamentation

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Red brockets live in dense tropical forests with closed canopies and prefer either moist or really dry climates. They tend to stay near marshes, swamps, and streams along thick vegetative cover. Their small body size helps them to move easily through water and dense vegetation and remain unnoticed by predators. When night falls, red brockets forage on forest edges, in agricultural fields, and in gardens.

Range elevation: 0 to 5000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: rivers and streams

Wetlands: marsh ; swamp

Other Habitat Features: agricultural

  • Gonzalez, S., J. Maldonado, J. Ortega, C. Talarico, L. Bidegaray. 2009. Identification of the endangered small red brocket deer ( Mazama bororo) using noninvasive genetic techniques (Mammalia; Cervidae). Molecular Ecology Resources, 9: 754-758.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is the largest species of the Mazama genus. It weighs between 30 and 40 Kg and is 65 cm tall (Duarte, 1996). Ribeiro (1919) and Vieira (1955) believe that this species occurs from Guianas and Peru to Rio Grande do Sul State of Brazil, including Paraguay and Argentina. Junqueira (1940) states that the Red Brocket Deer prefer large forests and riverbanks that are almost always covered with vast vegetation, thereby avoiding the sun. In Argentina, Olrog and Lucero (1981) reported that M. americana inhabits closed fields. As Emmons (1990) stated, this species is adapted to living in forests. According to Bodmer (1997), this species in the Amazon prefer firm, humid forest borders. In the rain forests, Red Brocket Deer are predominantly frugivores with fruit making up around 80% of their diet. During seasonally dry periods the diet of M. americana switches to greater proportions of browse.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brocket deer usually inhabit forests and woodlands from sea level up to 5,000 metres (7). The red brocket appears to prefer fairly dry or moist habitats and generally avoids very wet, flooded areas (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Red brocket diets consist mainly of fruit and some leaves and fibrous material. During the wet season when food availability is low, ttheir diet may consist mainly of fungi. In extreme cases where fruit and fungi become scarce, it may eat stems, bark, petioles, leaves, and animal matter instead.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Primary Diet: herbivore (Folivore , Frugivore , Granivore , Lignivore)

  • Bodmer, R. 1990. Responses of ungulates to seasonal inundations in the Amazon floodplain. Journal of Tropical Ecology, 6: 191-201.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Red brockets play an essential role within the Amazonian ecosystem. They alter plant communities and the overall structure of the forest by grazing and dispersing seeds. Without red brockets, certain plant seeds would not be dispersed and might become endangered or face extinction. Red brockets are also the main source of food for jaguars and pumas.

Ecosystem Impact: disperses seeds; creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red brockets stand low to the ground, have a reddish-brown fur color to camouflage with the tropical vegetation in the background, and are well adapted for moving through thick vegetative matter. Anti-predatory adaptations behaviors employed by red brockets include freezing, swimming, and camouflage. If a predator decides to chase a red brocket, it will alternate between leaping and freezing behaviors in order to confuse the predator. If red brockets are near a river, they will use their exceptional swimming skills to escape. Known predators of red brockets are pumas, jaguars, and humans. Pumas and jaguars are stealthy hunters that often wait from a distance for the most opportunistic time pounce. Humans have hunted red brockets for meat and trade.

Known Predators:

Anti-predator Adaptations: cryptic

  • Harmsen, B., R. Foster, S. Silver, L. Ostro, C. Doncaster. 2011. Jaguar and puma activity patterns in relation to their main prey. Mammalian Biology, 76: 320-324.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little information is known about the communication and perception of red brockets.

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Red brockets live between 7 and 12 years of age, but due to the elusiveness of this species, it is difficult to obtain sufficient data.

Average lifespan

Status: wild:
12 years.

Average lifespan

Status: captivity:
16 years.

Typical lifespan

Status: wild:
7 to 12 years.

Average lifespan

Status: captivity:
13.8 years.

  • Hurtado, G., L. Jorge. 2007. Assessing the sustainability of brocket deer hunting in the Tamshiyacu-Tahuayo Communal Reserve, northeastern Peru. Conservation- Biological Conservation, 138: 412-420.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.1 years (captivity) Observations: In the wild, these animals have been estimated to live up to 12 years (Bernhard Grzimek 1990). One captive specimen lived 17.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little information is known about the matings systems of red brockets.

In the northeastern Peruvian Amazon, red brocket deer conceive during all months of the year except from September and October. In Surinam, they reproduce from September to April. Depending on where the red brocket deer are located, they may have peaks in conception during the dry seasons. Females between the ages of 0 and 4 years are more capable of birthing two offspring, whereas females between the ages of 4 and 6 years usually only produce one. Females reach sexual maturity around 11 months of age and males reach maturity around 12 months of age.

Breeding interval: There is little information regarding the frequency of red brocket breeding.

Breeding season: Red brockets breed throughout the year depending on rainfall.

Average number of offspring: 1.2.

Range gestation period: 222 to 228 days.

Average weaning age: 6 months.

Range age at sexual or reproductive maturity (female): 11 to 13 months.

Average age at sexual or reproductive maturity (male): 12 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 538.5 g.

Average number of offspring: 1.3.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Little information is known about the parental investment of red brockets.

  • 2011. "Arkive images of life on earth" (On-line). Accessed September 25, 2011 at http://www.arkive.org/red-brocket/mazama-americana/#text=Habitat.
  • Branan, W. 1987. Reproductive ecology of white-tailed and red brocket deer in Suriname. RES. SYMP. NATL. ZOOL. PARK, 6: 344-351.
  • Gonzalez, S., J. Maldonado, J. Ortega, C. Talarico, L. Bidegaray. 2009. Identification of the endangered small red brocket deer ( Mazama bororo) using noninvasive genetic techniques (Mammalia; Cervidae). Molecular Ecology Resources, 9: 754-758.
  • Hurtado, G., L. Jorge. 2006. Reproductive biology of female Amazonian brocket. European Journal of Wildlife Research, 3: 171-177.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mazama americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTCTCAACTAACCATAAAGATATTGGCACCCTATACTTACTATTTGGTGCTTGAGCAGGTATAGTAGGAACTGCCTTAAGCCTACTAATCCGTGCTGAACTGGGTCAACCTGGAACTCTACTCGGAGATGATCAAATTTATAATGTAATTGTAACTGCACATGCATTTGTAATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGGTTCGGTAATTGACTTGTTCCATTAATAATTGGTGCTCCAGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCTCCCTCTTTTTTATTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGCTGAACTGTTTATCCCCCTCTAGCTGGCAACCTGGCTCACGCAGGAGCTTCAGTAGACTTAACTATTTTTTCTCTACATTTGGCGGGTGTCTCCTCGATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCTATATCACAATATCAAACCCCTTTATTTGTATGATCTGTATTAATTACTGCCGTATTACTACTTCTCTCACTCCCCGTACTAGCAGCTGGAATTACAATACTACTAACAGACCGAAATTTAAACACAACCTTCTTCGATCCAGCAGGAGGCGGAGACCCCATCCTATATCAACACTTATTCTGATTTTTTGGACACCCTGAAGTGTATATTTTAATCTTACCTGGGTTTGGTATAATTTCCCATATCGTAACTTATTACTCGGGAAAAAAAGAACCATTTGGGTATATGGGGATAGTCTGAGCTATGATATCAATCGGATTTTTAGGATTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATAGACGTTGATACACGAGCCTATTTTACATCAGCTACTATAATTATTGCTATTCCAACAGGAGTAAAAGTCTTTAGTTGACTAGCAACACTTCACGGAGGTAACATTAAATGATCACCTGCTATAATATGAGCCCTAGGCTTTATTTTCCTTTTTACAGTTGGAGGACTAACCGGAATCGTCCTTGCCAATTCTTCTCTTGATATTGTTCTTCACGATACTTACTACGTAGTTGCACATTTCCACTATGTCCTATCAATAGGAGCTGTGTTTGCCATTATAGGAGGGTTTGTCCACTGATTTCCATTATTTTCAGGCTATACTCTTAATGATACATGAGCTAAAATTCACTTTGTAATCATATTTGTAGGTGTAAACATAACCTTTTTTCCACAACACTTCCTAGGACTTTCTGGTATACCACGACGATATTCTGACTACCCAGACGCATATACAATATGAAATACAATCTCTTCTATAGGCTCATTTATCTCCCTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCCAAGCGAGAAGTCTCAACCGTAGAGCTAACAACAACAAATTTAGAGTGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mazama americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Little is known of the conservation status of red brocket deer.

US Federal List: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Durate, J.M.B., Vogliotti, A. & Barbanti, M.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Data Deficient in light of continued taxonomic uncertainty. Until the systematics of this taxa are better understood it is impossible to evaluate it against the categories and criteria of the IUCN Red List. Until we can define distribution and population size we cannot estimate reduction. In addition we have no evidence that this species will persist outside of forested areas. Thus some populations (which may be species or subspecies) are threatened while others are not, and until we understand the taxonomy we do not have enough information to evaluate it against threats.

History
  • 2000
    Data Deficient
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007 (1). Subspecies Mazama americana cerasina is listed on Appendix III of CITES in Guatemala (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is suspected to be widespread at low density in northern and northwestern Venezuela. In some areas this species has been overhunted (in densely human populated, rural areas) but likely still occurs at natural densities in the vast sparsely populated areas of the Peruvian Amazon.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting and habitat destruction represent major threats. The species is hunted for meat throughout much of its range (Dietrich pers. comm.). Subsistence hunting of Red Brocket Deer is legal in the Amazonian region of Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the status of most red brocket subspecies is unknown (6), it is clear that in some areas this species faces threats. The red brocket is hunted for meat throughout much of its range, both for subsistence and for sale, with its meat being found extensively in markets of the larger cities of the Amazon Basin (6). Brocket deer are also hunted by people because of the damage they can do to bean and corn crops (7). In certain areas, such as the densely populated areas of the Amazonian region of Peru, the red brocket deer has been reportedly overhunted, while in others, such as Costa Rica, Paraguay and Venezuela, habitat destruction also threatens this species (6). A combination of hunting and habitat destruction may have caused the red brocket to disappear from El Salvador altogether (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in several protected areas across its range. The Red Brocket Deer is one of the focal species in a community-based wildlife management initiative in the Tamshiyacu-Tahuayo Community Reserve of the Peruvian Amazon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The red brocket occurs in numerous protected areas throughout its range (6). The IUCN has been unable to determine the conservation status of this species due to a lack of data, and have therefore classified it as Data Deficient (1). Therefore, research is clearly needed to determine the status of each subspecies, and surveys, ecological studies and investigations into the human use of red brocket have all been suggested (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Red brockets occasionally cause damage to agricultural fields.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red brockets provide valuable meat and a means of trade for humans.

Positive Impacts: food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red brocket

The red brocket (Mazama americana) is a species of brocket deer from forests in South America, ranging from northern Argentina to Colombia and the Guianas.[1][2] It also occurs on the island of Trinidad in the Republic of Trinidad and Tobago (it also occurred on the island of Tobago until very recent historical times, but appears to have been extirpated there due to wanton poaching of wild game practiced on the island).

It formerly included the Central American red brocket (M. temama) and sometimes the Yucatan brown brocket (M. pandora) as subspecies.[3] Considerable taxonomic confusion still exists for the populations remaining in the red brocket. Pending a solution to this, it has been evaluated as data deficient by the IUCN,[1] though it, as presently defined, is the most widespread species of brocket. It is sympatric with the smaller Amazonian brown brocket over much of its range (the latter tends to have significantly lower population densities). The karyotype of the red brocket was initially described as having 2n = 68, FN = 74, and more recently as having 2n varying from 48 to 54 and FN varying from 54 to 56.[1] This variability may indicate the presence of unrecognized species in the population.[1]

Its body is reddish-brown in color, with a lighter grayish-brown head and neck, and partially blackish legs.[4] The inner thighs and the underside of the tail are white. Fawns are spotted white and lack blackish to the legs.[4] Only the adult male has antlers, and these are small and spike-like. This species is the largest of the brockets. The shoulder height is 67–80 centimetres (26–31 in) and the head and body length 105–144 centimetres (41–57 in).[4] These deer typically weigh 24–48 kilograms (53–106 lb),[4] but exceptional males may get as large as 65 kilograms (143 lb).[5]

The red brocket browses on vegetation, preferring fruit when it is available. It is generally solitary and stays in dense jungles. When alarmed, the animal snorts or stomps its hoof.

References[edit]

  1. ^ a b c d e Durate, J.M.B., Vogliotti, A. & Barbanti, M. (2008). Mazama americana. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 November 2009. Database entry includes a brief justification of why this species is of data deficient.
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Medellín, Rodrigo A.; Alfred L. Gardner; J. Marcelo Aranda (April 1998). "The taxonomic status of the Yucatán brown brocket, Mazama pandora (Mammalia: Cervidae)" (PDF). Proceedings of the Biological Society of Washington 111 (1): 1–14. Retrieved 10 October 2010. 
  4. ^ a b c d Trolle, M., and L. H. Emmons (2004). A record of a dwarf brocket from lowland Madre de Dios, Peru. Deer Specialist Group Newsletter 19: 2–5
  5. ^ Nowak, R. M. (eds) (1999). Walker's Mammals of the World. 6th edition. Johns Hopkins University Press.
  • Emmons, L.H. (1997). Neotropical Rainforest Mammals, 2nd ed. University of Chicago Press ISBN 0-226-20721-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!