Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The pampas deer occurs in insular populations in western, northern, and central Argentina, eastern Bolivia, central and southern Brazil, Paraguay, and Uruguay. Prior to the 1800's, the species was abundant throughout the grasslands of South America (Wemmer 1998). The Pampas deer was a widespread species occupying a range of open habitats, including grasslands, pampas and the Brazilian savanna known as the Cerrado, in eastern South America from 5º to 41ºS (Cabrera 1943; Jackson 1987; Merino et al. 1997; González et al. 1998; 2002; González, 2004; Weber and González 2003). However, the area encompassed by these habitats has been dramatically reduced to less than 1% of that present in 1900 (González et al., 1998). Currently, Pampas deer populations are generally small and highly isolated (Jackson and Langguth 1987; González et al. 1998: 2002). The largest extant populations are found in Brazil, in the northeast cerrado ecosystem where about 2,000 individuals live, and in the Pantanal where 20,000 to 40,000 exist (Pinder 1994), and was rediscovered in the South a small population in Paraná State estimated in less of 100 individuals Braga et al.2005, . In Uruguay there are two main populations: El Tapado (Salto Department) with 800 individuals, and Los Ajos (Rocha Department) with approximately 300 deer (Weber and González, 2003 ). At the turn of the century, the Argentinean population was likely very large since over 500,000 km² of grassland habitat was available. However, today only three small populations remain: Corrientes (Ituzaingo Department) with about 170 individuals (Merino and Beccaceci, 1999), in San Luís Province) with approximately 800-1000 individuals (Merino et al. 1997) and coastal Bahía de Samborombóm (Buenos Aires Province) with about 200 individuals (Merino et al. 1997) and in Santa Fé “Bajos Submeridionales” area there is a small population estimated less 50 individuals lives in an area of 23,000 ha. (Vera Department, Pautasso et al. 2002a and b). A small population may still be extant in the southeastern part of Bolivia (Weber and González, 2003). Small populations of Pampas deer may still be extant in the National Park Noel Kempff Mercado (Santa Cruz Department), in southwestern Bolivia (Anderson 1985; 1993; Tarifa 1993). However, it is restricted to relatively small patches of suitable habitat and may have become locally extinct in some of them.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The pampas deer once lived throughout the natural grasslands of eastern South America situated between latitudes 5 and 40S. Now the distribution is restricted to local populations. Jackson (1987), Nowak (1991).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Brazil, Argentina, Uruguay, Bolivia, Paraguay

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ozotoceros bezoarticus is a medium-sized, lightly built cervid. Head and body length is 110 - 140 cm, shoulder height is 70 - 75 cm. The prevailing color of the upper parts and limbs is reddish brown or yellowish gray. The face, crown, and tail are darker. Coat color is richer on the back than toward the extremities. Cream-colored areas occur as tarsal tufts, inside the ears, around the eyes, chest, throat, underparts, and underside of the tail. There is no marked difference between summer and winter pelage. Pelage of newborns is chestnut with a row of white spots on each side of the back and a second line from the shoulders to the thighs. The spots disappear by about 2 months of age, leaving a russet juvenile coat.

Males are slightly larger but there is no marked sexual dimorphism in size, weight, or pelage. Only males have antlers, that consist of three tines: a lower or front prong of the main fork and the upper or posterior prong divided. A synchronized antler cycle exits. Antlers are shed in mid winter, a new set begins to grow immediately and racks are cleaned of velvet by early summer.

It was suggested a latitudinal size gradient with northern animals larger. Three subspecies have been described based on geographic variation of the color coat. Ozotoceros bezoarticus bezoarticus is pale red-brown, O. b. leucogaster is tawny-brown, and O. b. celer is bay.

Jackson (1986, 1987), Nowak (1991), Gonzalez et al. (1991).

Range mass: 30 to 40 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occupies a range of open habitats, in particular grassland areas and the cerrado shrublands. In Argentina, coastal salt marshes are also utilized.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The pampas deer occupies a wide variety of open grassland habitats at low elevations. These habitats include areas temporarily inundated by fresh or estuarine water, rolling hills, and areas with winter drought and no permanent surface water. In some places the grass is high enough to completely cover a standing deer. However, much of the original range has been modified by agriculture and other human activities. Jackson (1987), Nowak (1991).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Ozotoceros bezoarticus is herbivorous, but its exact diet is unknown. It seems that the pampas deer selects new green growth, although shrubs also are browsed and seed-heads of grasses consumed (Jackson 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
21.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.9 years (captivity) Observations: One captive specimen lived for 21.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ozotoceros bezoarticus is a seasonal breeder. Gestation is slightly more than 7 months. Females are capable of giving birth at 10-month intervals. Pregnant females can be distinguished visibly about 3 months before parturition and the udder is evident 1 to 2 weeks before birth. The majority of fawns born in the spring (September to November), although births have been recorded in almost all months. The pampas deer virtually always bears a single fawn.

In captivity, the first discernible sexual behavior in males occurs when they are about 1 year of age; adult males are capable of mating year-round. Sexual maturity in captive females may occur at 12 months.

Jackson (1985; 1987); Langguth and Jackson (1980).

Average birth mass: 2100 g.

Average gestation period: 213 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ozotoceros bezoarticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAATCACAAAGATATTGGTACCCTATATTTATTATTCGGTGCTTGAGCAGGCATAGTAGGAACTGCCCTAAGCCTACTAATCCGTGCTGAACTGGGTCAACCCGGTACTCTACTCGGAGATGACCAAATTTATAATGTAATTGTCACCGCACATGCATTTGTGATAATTTTCTTTATAGTTATACCAATTATAATCGGAGGATTTGGTAATTGACTTGTCCCCTTAATAATTGGTGCTCCAGATATAGCATTTCCTCGAATAAATAACATAAGCTTTTGACTTCTACCCCCTTCATTTTTACTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTCTATCCCCCTTTAGCTGGCAATCTAGCTCACGCAGGAGCCTCAGTTGACCTAACTATCTTTTCCCTACATTTAGCAGGCATTTCTTCAATTTTAGGGGCTATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCCATATCACAATATCAGACTCCCTTATTCGTCTGATCTGTACTAATTACTGCAGTACTACTGCTCCTTTCACTTCCTGTATTAGCAGCCGGAATTACAATACTATTAACAGACCGAAATCTAAATACAACCTTTTTCGACCCAGCAGGAGGTGGAGATCCTATTTTATATCAGCACTTATTCTGATTTTTTGGACACCCTGAAGTATACATTCTTATCTTACCTGGATTTGGTATAATTTCTCACATCGTAACCTATTATTCGGGGAAAAAAGAACCATTTGGGTATATAGGAATAGTCTGAGCTATAATATCAATTGGATTTTTAGGATTTATTGTATGAGCCCATCACATGTTTACAGTTGGAATAGACGTTGATACACGAGCCTATTTTACATCAGCTACTATAATTATTGCTATTCCAACCGGAGTAAAAGTATTTAGTTGACTAGCAACACTTCATGGAGGCAACATTAAATGATCACCTGCCATAATATGAGCTTTAGGTTTTATTTTTCTTTTTACAGTTGGAGGACTAACTGGAATTGTTCTTGCCAATTCTTCCCTTGACATTGTTCTTCACGATACTTATTACGTAGTTGCACATTTTCACTATGTTTTATCAATGGGGGCTGTATTTGCTATTATAGGAGGATTTGTGCACTGATTCCCACTATTCTCAGGATATACCCTTAATGATACATGAGCTAAAATCCATTTTGTAATTATATTTGTAGGTGTGAATATAACCTTTTTTCCACAACATTTCCTAGGATTATCTGGTATACCACGACGATATTCTGACTACCCAGACGCATATACAATGTGAAATACAATTTCTTCTATAGGCTCATTTATTTCTCTAACAGCAGTTATACTAATAATTTTTATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCTCAACCGTAGAATTAACAACAACAAATTTAGAGTGACTAAATGGATGTCCTCCACCATACCATACATTTGAAGAACCTACATACATCAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ozotoceros bezoarticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gonzalez, S. & Merino, M.L.

Reviewer/s
Black, P. (Deer Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is considered to be Near Threatened in light of an ongoing decline, however, not currently at a rate sufficient to qualify for Vulnerable under criterion A2c or A3c. Habitat conversion to agriculture and cattle farming, and hunting and persecution by feral dogs are constant threats, and the species is confined to a human dominated landscape with only patches of remaining habitat. Although the pampas deer is adaptable to some degree of habitat modification, it should be monitored to ensure rates of decline do not increase. The former range of the pampas deer has been dramatically reduced to less than 1% of that present in 1900 (González 1993, 1996). Habitat fragmentation is a serious threat to the existing population (González, 2004) .

History
  • 2002
    Near Threatened
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Ozotoceros bezoarticus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ozotoceros bezoarticus occurred in great numbers, especially on the pampas of Argentina and Uruguay. Numbers declined rapidly through loss of habitat, transmission of disease from domestic livestock, and continued uncontrolled hunting. The pampas deer is on Appendix 1 of CITES and is designated an endangered species by the IUCN. Jackson (1987), Groombridge (1993).

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is not update information of total population size there are partical estimation for population specifically in the Southern part of South America. The general trend is not possible to estimate for the species. The populations from Argentina and Uruguay show a decline trend (González et al., 2002). A minumum estimate for the total population size is 20,000 (Pinder, 1994), while the miximum population size is estimated at 80,000 (Pinder, 1994) individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat conversion for agriculture and competition with domestic livestock have been reported as threats to the pampas deer (Wemmer 1998). Other threats include over-exploitation for food, hides, and sport, predation by feral dogs, and possibly bovine disease (Wemmer 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included on CITES Appendix I. Recommended conservation actions include further population surveys, ecological research, strengthening of existing management of protected areas, creation of new protected areas, establishment of a collaborative captive breeding program, and enlisting the co-operation of local landowners in maintaining this species (Wemmer 1998). Some measures must be implemented to develop privately owned protected areas in order to preserve these last populations. These measures must include exoneration of taxes by government agencies and other fiscal incentives to stimulate private conservation action (González, et al., 2002.)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ozotoceros bezoarticus competes for food and space with domestic livestock, especially sheep (Jackson 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The role of Ozotoceros bezoarticus in the culture of the Indians was comparable to that played by the bison in the lives of the plains Indians of North America. Later, the pampas deer was hunted commercially for skins for exportation and stomach stones (bezoares) for pseudomedicinal use. Over 2 million skins of Ozotoceros are estimated to have been exported from Argentina in the years 1860-70, and many more were captured in other countries. Official statistics for 1880 indicate that 61,401 skins of pampas deer were shipped from the port of Buenos Aires (Argentina). Also, the pampas deer was hunted locally for food, sport, skins, and stomach stones. Jackson (1987), Nowak (1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pampas deer

Pampas deer (Ozotoceros bezoarticus) live in the grasslands of South America at low elevations.[2] They are known as venado or gama in Spanish and as veado-campeiro in Portuguese. Their habitat includes water and hills, often with winter drought, and grass that is high enough to cover a standing deer.[3] Many of them live on the Pantanal wetlands, where there are ongoing conservation efforts, and other areas of annual flooding cycles. Human activity has changed much of the original landscape.[4] They are known to live up to 12 years in the wild, longer if captive, but are threatened due to over-hunting and habitat loss.[5] Many people are concerned over this loss, because a healthy deer population means a healthy grassland, and a healthy grassland is home to many species, some also threatened. Many North American birds migrate south to these areas, and if the Pampas deer habitat is lost, they are afraid these bird species will also decline.[6] There are approximately 80,000 Pampas deer total, with the majority of them living in Brazil.[7]

Taxonomy and evolution[edit]

The Pampas deer are part of the New World deer, another term for all South American deer species. Fossil records indicate that New Word deer traveled to South America from North America as part of the Great American Interchange around 2.5 million years ago, following the formation of the Isthmus of Panama. It is believed that they rapidly evolved into different species, with only a few surviving today. Due to the large continental glaciers and the high soil acidity in areas where there were no glaciers, a huge part of the fossil record has been destroyed, so there is no indication what the New World deer used to look like. Fossil records begin with clear differentiation and are close to what they currently look like. The Pampas deer evolved as plains dwellers. Their direct ancestor first appeared during the Pleistocene period (the Ice Age) during the Pampean Formation.[8][9]

Scientists believe the deer evolved with no culling predators because when alarmed, they stamp their feet, have a particular trot and whistle, and deposit odor.[2] The Pampas deer share a similar gene pattern with another deer species called Blastocerus. Unique to those two species, they have two fused chromosomes.[2]

The Pampas deer have 3 subspecies: O. b. bezoarticus that live in eastern and central Brazil, south of the Amazon river into Uruguay. O. b. leucogaster that live in southwestern Brazil, to southeastern Bolivia, to Paraguay and into northern Argentina. O. b. celer from the southern part of Argentina. They are the most rare and are an endangered species.[2] Pampas deer are the most polymorphic mammals. This large genetic variation reflects the fact that there were millions at one time. Their current high nucleotide diversity shows that they had very large numbers even in just the recent past; so recent it is not reflected in their genes yet.[8]

Physical characteristics[edit]

Pampas deers have tan fur, lighter on their undersides and insides of legs. Their coats do not change with the seasons. They have white spots above their lips and white patches on their throats.[2] Their shoulder height is 0.70m to 0.075m.[3] Their tails are short and bushy, 10 cm to 15 cm long, and when they run, they lift their tail to reveal a white patch, just like white-tailed deer.[2]

Males weigh about 40 kg and females about 33.5 kg, so they are a small species of deer, with relatively little sexual dimorphism. Males have small, lightweight antlers that are 3-pronged, which go through a yearly cycle of shedding in August or September, with a new grown set by December. The lower front main prong of the antlers is not divided, but the upper prong is. Females have hair whorls that look like tiny antlers stubs. Females and males have different stances during urination[clarify].[2] Males have a strong smell secreted from glands in their back hooves that can be detected up to 1.5 km away.[3]

Biology and behavior[edit]

Pampas deer running in Serra da Canastra National Park.

Social Behavior: In Argentina, the mating season is December to February. In Uruguay, the mating season is February to April. Courtship behavior is submissive, such as low stretching, crouching, and turning away. The male initiates courtship with a low stretch. He makes a soft buzzing sound. He nuzzles the female and may flick his tongue at her, and averts his eyes. He stays near her, and may follow her for a long time, smelling her urine. Sometimes the female responds to courtship by lying on the ground.[2]

Pampas deer do not defend territory or mates, but do have displays of dominance. They show dominance by keeping their heads up and trying to keep their side forward, and use slow, deliberate movements. When bucks are challenging each other, they rub their horns into vegetation and scrape them on the ground. They may urinate into the scrape they've made, and sometimes defecate. They rub the scent glands on their heads and faces into plants and objects. They usually do not fight, but just spar with each other, and they do commonly bite. Sparring is initiated by the smaller buck touching noses with the larger buck.[2] Groups are not separated by gender, and bucks will drift between groups. There are usually only 2-6 deer in a group, but there can be many more in good feeding areas. They do not have monogamous pairs, nor are there harems.[2][3]

When they feel they may be in danger, they hide low in the foliage and hold, and then bound off about 100–200 meters, often looking back at the disturbance. Because they bound in long flat jumps and have not been observed to run, they are not thought to be endurance runners. If they are alone, they may just quietly slip away. Females with a fawn will fake a limp to distract a predator, or if they are unsure of a situation, such as if a human appears.[2]

They will often stand on their hind legs to reach food or see over something. They are sedentary, with no seasonal or even daily movements. They usually feed regularly during the day, but sometimes have nocturnal activity.[3] The Pampas deer are very curious and like to explore. Although this is endearing to observers, their lack of fleeing at the site of humans makes them easier for poachers to kill.[2]

Diet[edit]

Pampas deer have been seen eating new green growth, shrubs, and herbs. Most of the plant life they consume grows in moist soils. To see if Pampas deer compete with cattle for food, their feces were studied and compared to cattle feces. They do in fact eat the same plants, but in different proportions. The pampas deer eat less grass and more forbs (flowering broad leafed plants with soft stems) and browse (shoots, leaves, and twigs), respectively. During the rainy season, 20% of their diet consists of new grasses. They will move with the availability of food, particularly the flowering plants. The presence of cattle increases the amount of sprouting grass, which is preferred by Pampas deer, furthering the idea that the deer do not compete with cattle for food.[10] Opposing research shows that Pampas deer avoid areas inhabited by cattle, and when cattle are absent have much larger home ranges.[6]

Reproduction/calves[edit]

Fawns can be seen at any time of year, but there is a peak in September and November. Females separate themselves from the group to give birth, and keep the fawn hidden away. After giving birth, the female goes into heat and usually mates within the next 48 hours. The fawns are small and spotted, and lose their spots at about 2 months old. Usually only one fawn weighing about 2.2 kg is born after a gestation period lasting over 7 months. At 6 weeks, they can eat solid food and begin to follow their mother. They stay with their mothers for at least a year, and also reach sexual maturity at about a year.[3]

Threat of extinction[edit]

The Pampas deer of southern Argentina once were very abundant but now considered a threatened species by the IUCN. The IUCN separates the subspecies O. b. celer in southern Argentina as endangered. The diseases that particularly plague O. b. celer are gut parasites and food and mouth diseases. Their overall decline is due in part from hunting and poaching, but also from habitat loss due to agriculture, diseases from domesticated and feral livestock, competition from more recently introduced wildlife, and general over-exploitation. There is less than 1% of their natural habitat left that was present in 1900.[8] The deer in Argentina and Uruguay have no natural predators, which formerly were cougars and jaguars. Those in Brazil still have cougars to fear. Some areas of population loss are easily tracked to poaching because of the few number of deer in an area. In the mid-1970s, 10 individuals out of a group of 16 located in Punta Medanos were killed by poachers. The rest were wiped out by extensive human activity. Lack of funding and technology have made it difficult for biologists to track and help the deer population, but donations and grants from organizations and universities in the United States have helped immensely with the situation. In 1975, there were less than 100 of subspecies O. b. celer, but by 1980 there were 400. The population has been continuing to increase, although not at that high of a rate. Some of the discrepancy is due to the fact that later they found groups they did not know existed.[7]

Unfortunately, local people will often blame the deer for outbreaks of disease in their livestock, particularly the disease brucellosis in cattle. In one instance, the Uruguayan government was going to kill some of their Pampas deer population. Research by field veterinarians had shown that Pampas deer rarely carry the disease, so the government gave them time to assess deer health. Funded by the Disney Conservation Fund, they were able to prove that the deer pose no threat of spreading disease to livestock.[6]

Trade for commercial purposes is banned. They are legally protected in Argentina, and they have a private and federal reserve set aside for the deer. In some areas, strictly controlling poaching is all that was necessary to quickly increase the population size. Increasing public knowledge and controlling road building has also helped. They reproduce well in captivity, and are sometimes reintroduced into the wild.[8]

In 2006, Global Positioning Systems were placed on 19 Pampas deer, although 8 of those did not record data. The individuals were monitored from between 4–18 days for researches to collect data on their movements, to better understand how to help them.[11]

Relations with humans and culture[edit]

The Pampas deer have been harvested into the millions. Between 1860 and 1870, documents for the port of Buenos Aires alone show that two million Pampas deer pelts were sent to Europe. Many years later, as roads were built through the pampas, cars made it even easier for poachers to get to the deer. They were also killed for food, medicinal purposes, and for sport. As of 2003, there are fewer than 2,000 of them in Argentina and Uruguay. Both Argentina and Uruguay have declared the Pampas deer "natural monuments" but the hunting continues, although much less frequently now. The decimation of the Pampas deer has been likened to that of the bison of North America. Also similar to the bison, is the role they played in the life of the Native Americans of Uruguay and Argentina, being used for food, hides, and medicine. The Native Americans at first participated in the harvesting of the Pampas deer pelts for sale, and in spite of that, the deer population stayed strong until the Native Americans of those countries were defeated by European settlers. The settlers brought large agricultural expansion, uncontrolled hunting, and new diseases to the deer with the introduction of new domestic and feral animals.[3]

Some landowners have set aside some of their property as a reserve for the deer, as well as keeping cattle instead of sheep. Sheep graze much more on the land and are more of a threat to the deer. The owners that choose cattle are doing it as a service, because more money is made from raising sheep than cattle. Conservationists encourage this trend by sharing research that more edible vegetation is available on ranches with cattle and deer during times of drought than on ranches with cattle and sheep.[6]

References[edit]

  1. ^ Gonzalez, S. & Merino, M.L. (2008). Ozotoceros bezoarticus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 November 2009. Database entry includes a brief justification of why this species is of near threatened.
  2. ^ a b c d e f g h i j k l Geist, Valerius. Deer of the world their evolution, behaviour, and ecology. Mechanicsburg, Pa: Stackpole Books, 1998
  3. ^ a b c d e f g P., Walker, Ernest. Walker's Mammals of the world. Baltimore: Johns Hopkins UP, 1991
  4. ^ Harris, Monica B., Walfrido Tomas, Guilherme Mourao, Carolina J. Da Silva, Erika Guimaraes, Fatima Sonoda, and Eliani Fachim. "Safeguarding the Pantanal Wetlands: Threats and Conservation Initiatives." Conservation Biology 19 (2005): 714-20
  5. ^ Moore, Don. "A Delicate Deer." Wildlife Conservation 106 (2003): 6-7
  6. ^ a b c d Villa, A. R., M. S. Beade, and D. Barrios Lamunière. "Home range and habitat selection of pampas deer." Journal of Zoology 276 (2008): 95-102
  7. ^ a b IUCN Mammal Red Data Book. Gland, Switzerland: IUCN, 1982
  8. ^ a b c d Gonzales, S., J. E. Maldonado, J. A. Leonard, C. Vila, J. M. Barbanti Duarte, M. Merino, N. Brum-Zorilla, and R. K. Wayne. "Conservation genetics of the endangered Pampas deer (Ozotoceros bezoarticus)." Molecular Ecology 7 (1998): 47-56
  9. ^ Grzimeks Animal Life Encyclopedia Mammals (Grzimek's Animal Life Encyclopedia). Vol. 15. Detroit: Gale Cengage, 2003
  10. ^ People In Nature Wildlife Conservation in South and Central America. New York: Columbia UP, 2005
  11. ^ Zucco, Carlos, and Guilherme Mourao. "Low-Cost Global Positioning System Harness for Pampas Deer." The Journal of Wildlife Management 73 (2009): 452-57

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!