Overview

Distribution

Range Description

Following (Czernay 1987) M. rufina is restricted to the Andes. It was originally found in montane forest and paramos at altitudes between 1500-3500 m.a.s.l. (Eisenberg and Redford 1999), from the Central Andes in Colombia to Huancabamba valley in northern Peru. It is currently restricted to remnant forest patches and paramos in Colombia, Ecuador and Peru. In Colombia it occurs in the states of Nariño, Huila, Cauca, Valle del Cauca, Tolima, Risaralda, Quindío, Caldas, and Boyacá (Alberico et al. 2000). M. rufina has not been recorded for the Oriental Andes of Colombia (Cuervo et al. 1986, Alberico et al. 2000). Although M. rufina is not included in the list of mammals of Antioquia state (Cuartas-Calle and Muñoz-Arango 2003), photographic evidence of its presence and of its being hunted was recorded at the “Páramo de Belmira” in the Central Andes of Antioquia (Delgado-V. Obs. Pers. 2003), which is the northern most record for this species. In Ecuador it was recorded in the western and eastern Andes along the Chimborazo region axis (Tirira 2001). In Peru it is distributed on the eastern flank of the Andes in the watersheds of the Amazon river.

The southern limit of M. rufina is the Huacabamba valley which also acts as a biogeographical barrier for other mammal species (Hershkovitz 1959, 1982, Eisenberg and Redford 1999). The northern limit of their distribution is not well known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Records from Ecuador include ‘ceja de selva’, elfin forest, and grasslands (3,600 m), cloud forest / montane ‘Yungas’ forests, and sub Andean forests (1,400 m). Records from Peru include the same vegetation types as in Ecuador and Colombia, but without records in grasslands or over 3,600 m. The main habitat of M. rufina is paramos and tropical montane cloud forests above 1500 m. The paramos are high altitude grasslands (Boom et al. 2001), which are dominated by Calamagrostis spp. and gigantic Andean rosette plants from the genus Espeletia (Luteyn 1992). The tropical montane cloud forest is a type of vegetation that has special climatic conditions causing cloud and mist to be regularly in contact with the forest vegetation (Bruijnzeel and Veneklaas 1998). These forests support ecosystems of distinctive floristic and structural forms with lower canopy and thicker understory than lowland forests (Grubb et al. 1963).

Along its distribution, M. rufina shares the same habitat with the northern pudu (Pudu mephistophiles) (Hershkovitz 1982); the mountain tapir (Tapirus pinchaque) (Lizcano et al. 2002); and the Andean bear (Tremarctos ornatus) (Peyton 1999). Details of its ecology are unknown, although it seems to be solitary, active by day as well as at night, and expected to be a browser/frugivore in the forest understorey. They are shy and secretive animals, rarely seen because of their nocturnal habits. They live either alone or in pairs and normally within a small territory. They usually defecate in latrines probably located at the boundaries of their territories.

The Brocket deer is a frequent visitor of salt licks (Lizcano and Cavelier 2004). In the Central Andes of Colombia its diet is composed of 40 species of plants mainly herbs, from which it prefers plants of Solanum spp. and Begonia umbellata (Lizcano 2006). They rely on their small size and knowledge of the habitat in which they live to escape predators, diving into thick vegetation when detected. Occasionally they present freezing behavior before escaping. Nothing is known of reproduction or life in captivity. Oxalis sp. has been identified among plant species eaten by Mazama rufina. No research has been conducted to study the home range.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mazama rufina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAATCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCTTATATTTACTATTCGGCGCTTGAGCAGGCATAGTAGGAACTGCTCTAAGCCTATTAATTCGTGCTGAACTGGGTCAACCTGGAACTCTACTCGGAGATGATCAAATTTATAACGTAATTGTAACCGCACATGCATTCGTAATGATTTTCTTTATAGTTATGCCAATTATAATTGGAGGATTCGGCAATTGACTTGTTCCATTGATAATTGGTGCTCCAGATATAGCATTTCCCCGAATAAATAACATGAGTTTTTGACTCCTCCCCCCATCCTTTTTATTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGTACAGGCTGAACTGTTTATCCCCCATTAGCTGGAAATCTAGCTCACGCAGGAGCTTCAGTAGACTTAACTATCTTTTCCCTGCATTTGGCAGGTGTATCTTCAATCCTAGGAGCAATTAACTTTATTACAACAATTATTAATATAAAACCTCCTGCTATATCACAATATCAAACCCCTTTATTTGTATGATCTGTATTAATCACTGCCGTTCTACTACTTCTTTCACTCCCTGTACTAGCAGCTGGAATCACAATACTATTAACAGACCGAAATTTAAACACAACCTTCTTCGACCCGGCAGGAGGCGGAGACCCCATCCTATACCAACACTTATTCTGATTCTTTGGACACCCCGAAGTATATATTTTAATCTTACCTGGATTTGGTATAATTTCCCATATCGTAACTTACTATTCAGGAAAAAAAGAGCCATTTGGGTATATGGGTATAGTCTGAGCTATAATATCAATTGGATTCCTAGGGTTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATAGACGTTGATACACGAGCTTACTTTACATCAGCTACTATAATTATTGCTATTCCAACTGGAGTAAAAGTATTTAGCTGATTAGCAACACTTCATGGAGGCAATATTAAATGATCACCTGCTATAATATGAGCCTTGGGCTTTATTTTTCTCTTTACAGTTGGAGGATTAACCGGAATTGTTCTCGCCAATTCCTCTCTTGATATTGTTCTTCACGACACTTACTACGTAGTTGCACATTTTCACTATGTTCTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTTGTCCACTGATTTCCACTATTTTCAGGCTATACCCTTAATGACACATGAGCTAAAATTCACTTCCTAATCATATTTGTAGGTGTAAATATAACCTTTTTTCCACAACATTTCCTAGGACTATCTGGTATACCACGACGATATTCTGATTATCCAGATGCATACACAATGTGAAATACTATCTCTTCTATAGGCTCATTTATTTCCTTAACAGCAGTCATACTGATAATTTTTATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTAACCGTAGAACTAACAACAACAAATTTAGAATGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACATTAATTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mazama rufina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4c; C1

Version
3.1

Year Assessed
2008

Assessor/s
Lizcano, D. & Alvarez, S.J.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Vulnerable due to an ongoing population decline, inferred to be greater than 30%, over a period of 3 generations (21 years) considering both the past (10 years) and future (11 years) estimated from loss of primary habitat. In addition remaining small populations are estimated to continuing declining at a rate of at least 10% over the next 3 generations. This species occurs in an area targeted for the use and expansion of illicit crops, which is currently reducing the species range but has potential to become a greater threat. New highway construction and mining also pose additional future threats to the species.

Criteria A & C: Declining population
Population decline occurred in the past and is projected for the future. Threats to this species have not ceased and are not reversible. An inferred population decline based on habitat reduction suggests assignment to the category of VU A4c. Additionally an estimated continuing decline in habitat range of at least 10% of within 10 years or three generations, support the status of VU C1.

Criterion B: Geographic range size
Extent of occurrence (EOO), based on a habitat model of museum records in Colombia, Ecuador, and Peru shows a habitat reduction of 47 % of their original habitat. Most of the 30 % reduction happened in the last ten years, at least in Colombia, as result of severe deforestation and agriculture. Habitat destruction has occurred for decades in the range of the Dwarf Red Brocket. At least 50% of the expected range in Colombia is somehow degraded due to colonization, deforestation, and burning for coffee agriculture and cattle grazing (see Threats).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Its density is low ranging from 0.06 (individuals/km²) in mature forest to 0.3 (individuals/km²) in ecotone paramo-montane forest. Its preferred habitats are paramo and forest-paramo ecotone over secondary and mature forest (Lizcano 2006). Collection sites in Colombia may be grouped into 3 to 5 locations distributed in the National Park Los Nevados, Las Hermosas, Nevado del Huila, and Doña Ana, and potentially in Pichachos, Macarena, Sumapaz, and Chingaza. Collection sites of Ecuador correspond to locations at Sangay and Podocarpus National Parks. In Peru collection sites are in and around Tabaconas – Namballe (Maravi et al. 2003). Current distribution and abundance need to be further assessed. A decreasing population trend is inferred from habitat destruction..

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat destruction occurs due to small scale cattle ranching and agriculture practiced by local communities through forest cutting and burning of montane grasslands and shrublands. Illegal plantations of opium and Coca may be the main cause of habitat destruction in some areas of Colombia (Alvarez 2007). Mining, road construction and colonization expand habitat loss. Climate change might also result in area or quality decrease of available habitat for the species in the future, since cloud forests and paramos are broadly affected by atmospheric temperature increase (Foster 2001). Hunting occurs as a source of meat and medicinal products at the local level but needs assessment. They are preyed on by a small number of South American predators, such as puma and feral dogs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Some populations are present in Colombian Central Andes protected areas and Ecuadorian Andean national parks and ecological reserves, but hunting still occurs and its effect on the populations is unknown. Brocket deer are a highly preferred hunting trophy and its meat is considered a delicacy by campesinos and indigenous groups in the Andes. M. rufina is considered a near threatened species in Colombia (Alberico et al. 2000, Rodriguez-Mahecha et al. 2006), and in Ecuador (Tirira 2001). M. rufina is protected under the Colombian law according to “Decreto 2811 de 1974”. This species is not included in the CITES appendices. This taxon needs to be locally and regionally recognized as a potentially threatened species; for this, more field surveys, ecological studies and educational / management work with communities focusing on habitat destruction and hunting are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Little red brocket

The Little Red Brocket (Mazama rufina), also known as the Ecuador Red Brocket,[2] is a small, little-studied deer native to the Andes of Colombia, Ecuador and northern Peru, where found in forest and páramo at altitudes between 1,400 and 3,600 metres (4,600 and 11,800 ft).[1] It is one of the smallest brocket deer. The coat is reddish, and the legs and crown are blackish.[3] As recently as 1999, some authorities included both the Pygmy Brocket (M. nana) and Merida Brocket (M. bricenii) as subspecies of the Little Red Brocket.[4]

The Little Red Brocket may have formed an important part of the diet of the people of the Pleistocene Las Vegas culture.[5]

References[edit]

  1. ^ a b Lizcano, D. & Alvarez, S.J. (2008). Mazama rufina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 June 2007. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Trolle, M., and L. H. Emmons (2004). A record of a dwarf brocket from lowland Madre de Dios, Peru. Deer Specialist Group Newsletter 19: 2-5
  4. ^ Nowak, R. M. (eds) (1999). Walker's Mammals of the World. 6th edition. Johns Hopkins University Press.
  5. ^ Salazar, Ernesto (2003). "Historie del Ecuador: Los primeros habitantes". La Hora (in Spanish). Archived from the original on 2008-04-08. Retrieved 2008-07-14. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!