Overview

Distribution

Range Description

This species occupies a discontinuous and probably fragmented range through the montane forests and their limit with the humid grasslands of the Andes in Colombia, Ecuador, and Peru. Exact range is unknown and distributional gaps between records are unresolved. The only known natural gap is the Maranon dry forest lying in between the Ecuadorian population and the Peruvian population south of the Maranon. The current extent of occurrence (EOO) is estimated to be 90,000-130,000 km² and is split between two populations; the southern population
30,000-35,000 km² and the northern population 60,000-95,000 km².
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits elfin, cloud and montane forests throughout its distribution, and in humid grasslands above the tree-line mainly by the northern population, between 2,000 and 4,000 m. It moves in the undergrowth when it is inside forest. The small size makes the species difficult to detect.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pudu mephistophiles

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAATCGCTGATTATTTTCAACAAACCATAAAGATATCGGTACCTTATATTTACTATTCGGCGCTTGAGCAGGCATAGTAGGAACTGCTCTAAGCCTATTAATCCGTGCTGAGCTGGGTCAACCTGGAACTCTACTCGGAGATGATCAAATTTATAACGTAATTGTAACCGCACATGCATTCGTAATGATTTTCTTTATAGTTATGCCAATTATAATTGGAGGATTCGGCAATTGACTTGTTCCATTGATAATTGGTGCTCCAGATATAGCATTCCCCCGAATAAATAATATGAGTTTTTGACTCCTCCCCCCATCCTTTTTATTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGTACAGGCTGAACTGTTTATCCCCCATTAGCTGGAAATCTAGCTCACGCAGGAGCTTCAGTAGACTTAACTATCTTTTCCCTGCATTTGGCGGGTGTATCTTCAATCCTAGGAGCAATTAACTTTATTACAACAATTATTAATATAAAACCTCCTGCTATATCACAATATCAAACCCCTTTATTTGTATGATCTGTATTAATCACTGCCGTACTACTACTTCTTTCACTCCCTGTACTAGCAGCTGGAATCACAATACTATTAACAGACCGAAATTTAAACACAACCTTCTTCGACCCAGCAGGAGGCGGAGACCCTATCCTATACCAACATTTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTAATCTTACCTGGATTTGGTATAATTTCCCATATCGTAACTTACTATTCAGGAAAAAAAGAGCCATTTGGGTATATGGGTATAGTCTGAGCTATAATATCAATTGGATTTCTAGGGTTTATTGTATGAGCCCACCACATATTTACAGTTGGAATAGACGTTGATACACGAGCTTACTTTACATCAGCTACTATAATTATTGCTATTCCAACTGGAGTAAAAGTATTTAGCTGATTAGCAACACTTCATGGAGGCAATATTAAATGATCACCTGCTATAATATGAGCCTTGGGCTTTATTTTTCTCTTTACAGTTGGAGGATTAACCGGAATTGTCCTCGCCAATTCCTCTCTTGATATTGTTCTTCACGATACTTACTACGTAGTTGCACATTTCCACTATGTTCTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTTGTCCACTGATTTCCACTATTTTCAGGCTATACCCTTAATGACACATGAGCTAAAATTCACTTCCTAATCATATTTGTAGGTGTAAATATAACCTTTTTTCCACAACATTTCCTAGGACTATCTGGTATACCACGACGATATTCTGATTACCCAGATGCATACACAATGTGAAATACTATCTCTTCTATAGGCTCATTTATTTCCTTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTAACCGTAGAACTAACAACAACAAATTTAGAATGATTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACATTAATTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pudu mephistophiles

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Barrio, J. & Tirira, D.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Vulnerable in light of an ongoing decline, and because remaining small populations are fragmented into numerous subpopulations in the high Andes - where no subpopulation exceeds 1,000 mature individuals. This species occurs in very low densities throughout its range, is poorly known and more information is necessary in order to quantitatively measure threats and rates of decline due to hunting and habitat conversion – and thus if it might also qualify for population reduction threat criteria, however, insufficient information is currently available. Indirect estimates based on past distribution and habitat loss would consider the species is in a notable decline due to habitat reduction and expanding human settlements. Although humans rarely hunt the species today, it was intensively persecuted in the middle part of the century.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
  • 1994
    Indeterminate
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Indeterminate
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Populations in central Peru clearly isolated from populations in Peruvian northern Andes, Ecuador and Colombia. There are new records in the former larger gap between populations; however, the gap still covers the breadth of the Maranon dry forest (Barrio, in prep.). Given the habitat type covering the gap, there is no expectation that an individual will ever appear there, besides accidentally.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Northern pudu was intensively exploited by local people from the 1950s to early 1980s (Hershkovitz 1982). However, nowadays habitat conversion and predation by domestic dogs are worse threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II.

Recommended conservation actions include: undertake comprehensive status surveys and develop research program to determine ecology, habitat requirements, population biology, and extent of threats; strengthen existing protected areas management where necessary; in areas where subsistence hunting proves to be a serious threat, seek alternative subsistence schemes or more sustainable harvesting methods; develop conservation education programs and increase law enforcement if necessary. The species occurs in several protected areas across its range; some of these are without management plans and many receive insufficient resources to enable adequate protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!