Overview

Brief Summary

Biology

Southern pudu are solitary animals and only come together during the breeding season, or 'rut' (8), in April and May (austral autumn) (4). Females typically bare one fawn each year, from November to January (austral spring), after a gestation period of approximately seven months (7) (8). Young are weaned at two months, fully sized at three, and sexually mature at six months for females, eight to twelve for males (6). Offspring may remain with their mother for eight to twelve months before becoming independent (8). This deer is active both day and night, but mostly during the late afternoon, evening and morning, when it forages for leaves, twigs, bark, buds, fruit and seeds. Due to their small size, individuals often have to stand upright on their hind legs or jump onto fallen tree trunks in order to reach higher vegetation (6). This species navigates through the dense vegetation via a network of well-trodden trails, pathways and small tunnels, which lead to feeding and resting areas within their 16 to 26 hectare home range (4) (7). Dung piles are often formed next to these trails, usually near resting places (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The deer belonging to the Pudu genus are the smallest deer in the world (4), so tiny that people have even captured them for pets, thereby contributing to their decline in the wild (5). Similar in appearance to the northern pudu (Pudu mephistopheles), but slightly smaller, the southern pudu has a short, glossy, reddish-brown to dark-brown coat, with underparts and legs slightly lighter, and lips and insides of the ears orangish (4) (6). Fawns are spotted with white, probably for camouflage. With a round body and short legs, the low-slung form is similar to many small forest ungulates, and thought to be an adaptation to slipping more easily through dense undergrowth and bamboo thickets (7). The eyes and ears are small and the tail is very short (4). Males sport short, simple spiked antlers that are shed annually in July (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Southern Pudu occurs in southern Chile (from Maule Province as far as the Strait of Magellan) and some adjacent areas of southwestern Argentina from southwest Neuquén Province, southward along the foothills of the Andes, into southwest Santa Cruz Province (Hershkovitz 1982). The confirmed southern limit in Argentina is south of the National Park Los Acerces in Chubut Province, around 43ºS (Ramilo 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Southern South America

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pudu puda is found in the rainforests in the temperate zones of Argentina and Chile.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in the lower Andes of Chile and Argentina (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Southern pudu are the smallest deer in the world, ranging from 600 to 825 mm in total body length and with a shoulder height from 250 to 430 mm. The coat is composed of long coarse hair. The body color is a buffy agouti pattern. The middle back is a reddish brown color, while the face, outer surface of the ears, narial patch, chin and under side are reddish. The fawns have a white spotted coat. The body is low to the ground with short thick legs. The eyes and the ears are small compared with the body size. The tail is almost non-exsistent. Males have short, less than 100 mm, spike antlers. (Nowak, 1997)

Range length: 600 to 825 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

Average mass: 10000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Southern Pudu inhabits dense temperate forest, between sea level and 1,700 m, where it browses mainly foliage and shoots (Miller et al. 1973, Hershkovitz 1982). It is also common in disturbed forests, as long as it is not harassed by people and especially dogs. It feeds on new leaves and shoots of native trees, avellanas fruit (Gevuina avellana), many forb species, and flowers (Jimenez pers. comm.). It is solitary, except during the rut, and in spring when young accompany mothers (Hershkovitz 1982).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The climate in the habitat of P. puda consists of a short dry summer and a mild wet winter. The yearly rainfall is 74-150 inches. Pudu prefer dense underbrush and bamboo groves because they offer protection from predators. They can be found anywhere from sea level to 3,200 meters elevation. (Grzimek, 1990)

Range elevation: 3200 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The southern pudu prefers temperate rainforest with dense underbrush and bamboo thickets, which offer a good degree of cover from predators. However, it will occasionally venture out into more open habitats to feed (4) (8). Found on high mountainsides up to 1,700 metres above sea level, but also at much lower altitudes and along the coast (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Southern pudu eat fallen fruit, ferns, vines and small tree foliage. Pudus move slowly as they look for food, often standing up on their hind legs to test the wind. They reach food by standing on their hind legs and jumping on fallen trees. They also may press down on ferns and saplings until they break off. Pudu bend over bamboo shoots and walk across them while they are horizontal to feed on upper foliage. They feed on the bark of young saplings approximately 6 to 12 inches off the ground. Pudu can go for long periods without drinking water. They may obtain sufficient water from their food. (Grzimek,1990)

Plant Foods: leaves; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Pudu puda are very susceptible to parasites, a problem made worse by their increasingly frequent contact with domestic dogs. The most common parasites include bladder worms, lung worms, and various types of round worms. (Grzimek, 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
12.5 years.

Average lifespan

Status: wild:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.8 years (captivity) Observations: Males normally do not reproduce until they are about 2 years old (http://www.zoo.org/). It has been reported that these animals may live up to 21 years in captivity (Ronald Nowak 1999), which is plausible but has not been confirmed. One 17.8 year old specimen was still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Pudu mate in the fall and give birth in the spring, from November to January. The gestation period is approximately 202 to 223 days. Only one fawn is born a year. At birth the young weigh less than one kilogram. It takes three months for the fawn to become full sized, and six months for females and eighteen months for males to reach sexual maturity. (Nowak, 1997)

Breeding interval: Southern pudu breed once yearly.

Breeding season: Mating occurs in the fall.

Range number of offspring: 1 (high) .

Average number of offspring: 1.

Range gestation period: 202 to 223 days.

Average age at sexual or reproductive maturity (female): 6 months.

Average age at sexual or reproductive maturity (male): 18 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 900 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
320 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
274 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pudu puda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAATCATAAAGATATTGGTACCCTGTATCTATTGTTTGGTGCTTGAGCAGGCATGGTAGGAACTGCCCTAAGCCTGCTAATCCGTGCTGAACTAGGCCAACCCGGGACCCTACTCGGAGATGACCAAATTTATAATGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGACTCGTCCCCTTAATAATTGGTGCTCCAGACATAGCATTTCCCCGAATAAATAATATAAGTTTTTGACTCTTGCCTCCTTCCTTTTTATTACTCCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTTTACCCCCCTTTAGCTGGCAATTTAGCTCACGCAGGAGCCTCAGTAGACTTGACTATCTTTTCTCTGCACTTAGCAGGCATCTCCTCAATTTTAGGGGCTATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCCATATCACAATATCAAACCCCCTTATTCGTGTGATCTGTACTAATCACTGCAGTACTTCTGCTCCTCTCACTCCCTGTATTAGCAGCCGGAATTACAATGCTACTAACAGACCGAAATCTAAATACAACCTTCTTCGATCCGGCAGGAGGCGGAGACCCTATTCTATATCAACACTTATTCTGATTTTTTGGACATCCTGAAGTATATATTCTTATCTTACCTGGTTTTGGTATAATTTCTCATATCGTAACCTACTATTCAGGGAAAAAAGAACCATTTGGGTATATAGGAATAGTCTGAGCTATAATGTCAATTGGATTTTTAGGATTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTTACATCAGCTACTATAATTATTGCCATTCCAACAGGAGTAAAAGTATTTAGCTGACTAGCAACACTTCATGGAGGCAATATTAAATGATCACCTGCCATAATATGAGCTCTAGGCTTTATTTTCCTTTTCACAGTTGGAGGACTGACCGGAATTGTTCTTGCCAATTCTTCTCTTGACATTGTTCTCCACGACACTTACTATGTAGTTGCACATTTCCACTATGTTTTATCAATAGGGGCTGTATTTGCTATTATAGGAGGATTTGTTCACTGATTTCCACTATTCTCAGGATATACTCTCAATGACACATGAGCTAAAATTCACTTCGTAATTATATTTGTAGGCGTAAATATAACCTTTTTTCCACAACATTTCCTAGGGTTATCCGGTATACCACGACGATATTCTGACTATCCAGACGCATATACAATGTGAAACACAATTTCTTCTATAGGCTCATTCATCTCCCTAACAGCAGTAATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCTAAGCGAGAAGTCTCAACCGTAGAATTAACAACAACAAACTTAGAGTGACTAAACGGGTGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTCAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pudu puda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+3cd

Version
3.1

Year Assessed
2008

Assessor/s
Jimenez, J. & Ramilo, E.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Vulnerable do to an ongoing decline and past population reduction of greater than 30% over the last three generations (12 years), estimated from a decline in habitat quality and availability and persecution my domestic and hunting dogs. It is suspected that this rate will continue and that the species will decline by at least another 30% in the next three generations (12 years).

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Southern South America


Population detail:

Population location: Southern South America
Listing status: E

For most current information and documents related to the conservation status and management of Pudu puda, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pudu are listed as endangered by the International Union for the Conservation of Nature and Natural Resources. The main factors that are threatening P. puda include the destruction of habitat, the introduction of roe and fallow deer from Europe, and domestic dogs. Pudu cannot compete for food with the roe and fallow deer. The population of puda has stabilized in Chile as a result of the tapering off of habitat destruction. The Game Preservation Director of Chile's Natural Forest Administration issued a statement saying that P. puda will survive, as long as its habitat does. Pudu puda is not currently threatened with immediate extinction, but its future is uncertain. Despite a study conducted by the World Wildlife Fund, the number of P. puda in the wild is still unknown. (Grzimek,1990)

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Total population is thought to be less than 10,000 animals (Ramilo pers. comm., Hershkovitz 1982, MacNamara and Eldridge 1987).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is thought to have undergone rapid decline in recent decades as a result of poaching and illegal collecting for zoos and private collections (DSG 1991). Habitat conversion, predation by domestic dogs, and competition with exotic deer and domestic livestock are serious associated threats (Eldridge et al. 1987). In addition, the species is hunted for subsistence use for food and skins, and heavily poached for the captive animal trade (Jimenez pers. comm., Toledo pers. comm.). In Argentina in the last three years there have been a number of road kills of pudus on the internal roads of the national parks. The increase in the number of roads within the distribution area of the pudu should be considered a threat, not only because of the number of road kills but also because of the interference with normal movements and isolation of populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main threat to the southern pudu, which once ranged far more extensively across Chile, is destruction of its temperate forest habitat for cattle ranching, logging and other human developments (5) (8). Habitat fragmentation and loss through conversion of forest into open lands and exotic tree plantations poses a big problem to the survival of the southern pudu, as do road accidents and hunting. There is a technique used whereby feral or unleashed dogs are released into the countryside that specialise in hunting pudus (9) (10) (11). Other threats include the introduction of alien species, such as red deer from Europe, with which the pudu now have to compete for food (7). Domestic dogs may also prey upon this small deer (7), and transmit parasites, to which the southern pudu is particularly susceptible (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I.
A captive breeding program is currently underway (Concepcion University, Chile) and there are plans to reintroduce animals into three national parks (Toledo pers. comm.). Recommended conservation actions include: initiate coordinated research to examine habitat requirements, food habits, and behavioral ecology; determine impact of feral dogs. Feral dogs are also very significant threats in Argentina. Also, determine effect of introduced wild pigs, whose distribution is greater than that of the pudu; there is 100% overlap of the distribution of wild pigs and pudus and undertake status surveys to establish extent of habitat decline and forest fragmentation; use information to identify priority areas for Southern pudu conservation and develop coordinated program to manage species throughout range; strengthen existing protected areas management; interchange of captive animals among captive breeding programs for self maintenance to reduce inbreeding, genetically manage the international captive population to reduce inbreeding; and conduct research on reproduction, nutrition, and behavior.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES), helps protect the southern pudu by banning all international trade in the species, but hunting nevertheless continues and still poses a serious threat (5) (8). Fortunately, the population in Chile has stabilised due to a reduction in the rate of habitat destruction. Pudu populations exist in a number of national parks which need sufficient resources to enforce protection and create effective management plans (8). An international captive breeding programme has been developed for the southern pudu, although there are no plans as yet to release captive-bred individuals back into the wild (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!