Articles on this page are available in 1 other language: Spanish (30) (learn more)

Overview

Brief Summary

Biology

A highly gregarious animal, the striped dolphin may associate in schools of over 1000, but is more usually seen in same-age groups of 100 to 500 individuals (6). It is a very active swimmer, performing leaps and breaching frequently. Communication between striped dolphins is by clicks and whistles (7). The striped dolphin feeds opportunistically, but the diet is mainly composed of cephalopods, crustaceans and fish, particularly lantern fish. The diet varies with geographical location (8). The mating season also varies with region. Males reach sexual maturity between 7 and 15 years and females between 5 and 13 years. The gestation period lasts 12 to 13 months and results in a single calf measuring less than a metre and weighing just 11 kilograms. The calf will stay with the female in a 'mothers-and-calves' school until it is weaned at 16 months. Females typically give birth every four years (6) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

"The striped dolphin is the largest of the five relatively small dolphins in the genus Stenella. Shy and wary of boats in some areas of the Pacific, and seen riding the bow waves of boats in other places, these dolphins make long, shallow leaps when porpoising. They also perform a maneuver called ""roto-tailing."" Leaping high, they twist their tails vigorously several times before reentering the water. Large schools of several hundred animals have been seen, but groups of fewer than 200 are more common. There are several kinds of groups. Mature animals, between seven and fifteen years old, form sexually mixed groups and breed. Males then leave and join male-only group while the females go through pregnancy and calving in their own groups. After a year or two, offspring are mature enough to separate from their mothers and join in juvenile schools."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Meyen, F.J.F., 1833.  Beiträge sur Zoologie gesammelt auf einer Reise um die Erde Saugethiere, 16:610.  Nova Acta Academiae Caesareae Leopoldino-Carolinae, 16:551-610.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Striped dolphins have a fusiform body, like all dolphins, with tall dorsal fins, long, narrow flippers, and a prominent beak. They are named for their characteristic stripe patterns. They are blue-gray in color with a dark dorsal cape and light coloring on their ventral (under) side. A blue-black stripe extends along the length of their body, and they have black stripes on their flippers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Stenella coeruleoalba is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth (rather than baleen). It is a member of the dolphin family with a characteristic prominent median notch in the flukes, a smooth crease-less throat and sharply pointed teeth. The striped dolphin reaches up to 2.6 m in length. It has long and slender flippers and small tail flukes. The dorsal fin is tall and narrow-based and located on the middle of the back. The head is smoothly sloping with a distinct snout. It has a complex colour pattern, with shades of black to dark grey on the back changing sharply to light grey on the sides and white underneath. It has a prominent black stripe that runs from the eye to the anus, and usually other shorter black stripes originating at the eye.Striped dolphins are usually found in large pods of up to 500 individuals. Mixed schools with other species have been recorded. Their surface behaviour is typical of dolphins with leaps and bow-riding a common sight. Dives may last up to 20 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

With the classic dolphin shape, the striped dolphin's most remarkable feature is the distinctive pattern of blue and white stripes along the body. It is mainly blue with a white to light grey stripe following the spine. The sides are darker than the belly (4). The beak is fairly long and prominent, the dorsal fin is tall, and the flippers are long and narrow with black stripes (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This is a widely-distributed species, found in tropical and warm-temperate waters of the Atlantic, Pacific, and Indian oceans, as well as many adjacent seas, including the Mediterranean. Northern and southern range limits are about 50°N and 40°S, although there are extralimital records from the Kamchatka Peninsula, southern Greenland, Iceland, the Faroe Islands, and the Prince Edward Islands. They are uncommon in the Sea of Japan, East China Sea, off eastern Taiwan and Ryukyuan waters, and a few extralimital records are known from the Persian Gulf and Red Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Stenella coeruleoalba is found in warm-temperate and tropical seas throughout the world. S. coeruleoalba has been observed in the Mediterranean Sea, eastern and western Pacific Ocean, Atlantic Ocean, Indian Ocean, Caribbean Sea, and in the northern Gulf of Mexico (Baird et. al., 1993; Archer and Perrin, 1999).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circum-global between 50°N and 40°S
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Nova Scotia south to at least Jamaica and in the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, Eritrea, European waters (ERMS scope), French Exclusive Economic Zone [Atlantic part], Greek Exclusive Economic Zone, Gulf of Mexico, Gulf of St. Lawrence, Irish Exclusive economic Zone, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea and the Mediterranean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Tropical and temperate waters near continental shelf.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Tropical, subtropical, and warm temperate oceans. Reportedly the most common cetacean in Mediterranean Sea. Proposed discrete stocks: one off South Africa, one or two in the eastern tropical Pacific, and another in the western North Pacific (see IUCN 1991). Widely distributed and relatively common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The striped dolphin is found in all temperate and tropical waters, throughout the Atlantic Ocean, Pacific Ocean, Indian Ocean, Mediterranean Sea and Black Sea (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Stenella coeruleoalba, otherwise known as striped dolphins, are a fascinating member of the family Delphinidae. S. coeruleoalba ranges in body length from 220cm to 236cm. Like many other delphinids, striped dolphins have a fusiform body, tall dorsal fins, long, narrow flippers, and a prominent beak (Archer and Perrin, 1999). S. coeruleoalba can be identified from other delphinids by their distinctive color and stripe patterns. Striped dolphins are typically bluish-gray in color with a dark dorsal cape and light (usually white) ventral coloration. They are called 'striped' dolphins because of the dark bluish-black stripe running across the entire length of the body, from the eye to the anus, and because they possess black flipper stripes (Archer and Perrin, 1999).

Range mass: 135.9.5 to 0.16 kg.

Average mass: 0.15 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Body length: 220cm -236cm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 270 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly longer than females.

Length:
Range: 1.8-2.5 m

Weight:
Range: 110-156 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Striped dolphins are primarily found in warm temperate and tropical oceanic regions and are seen close to shore only where deep water approaches the coast (Van Waerebeek et al. 1999). In the North Pacific they are associated with oligotrophic waters of the central North Pacific gyre and with more productive regions associated with upwelling areas in the eastern tropical Pacific and along the edges of the California and Kuroshio Current systems (Miyazaki et al. 1974; Reilly 1990; Archer and Perrin 1999; Balance et al. 2006). In the western North Atlantic, striped dolphins appear to prefer continental slope waters offshore of the Gulf Stream (Leatherwood et al. 1976; Schmidly 1981; Perrin et al. 1994). In the Mediterranean, striped dolphins are associated with highly productive, oceanic waters beyond the continental shelf (Notarbartolo di Sciara et al. 1993; Forcada et al. 1994; Frantzis et al. 2003; Gannier 2005). Off South Africa, the species is oceanic, occurring beyond the continental shelf at depths of over 1,000 m, and its distribution is correlated with the warm Agulhas Current (Ross 1984).

The diet of the striped dolphin consists primarily of a wide variety of small, midwater and pelagic or benthopelagic fish, especially lanternfish, cod, and squids (Wurtz and Marrale 1993; Hassani et al. 1997; Archer 2002). Striped dolphins apparently feed in pelagic to benthopelagic zones, to depths as deep as 200-700 m, in continental slope or oceanic regions.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Striped dolphins occupy both offshore and inshore warm-temperate and tropical waters. S. coeruleoalba appears to avoid sea surface temperatures of less than 20 degrees C (Van Waerebeek et. al., 1998).

Aquatic Biomes: benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2957 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1770 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.894 - 29.365
  Nitrate (umol/L): 0.035 - 10.235
  Salinity (PPS): 31.551 - 39.131
  Oxygen (ml/l): 4.396 - 7.195
  Phosphate (umol/l): 0.041 - 0.897
  Silicate (umol/l): 0.818 - 6.989

Graphical representation

Temperature range (°C): 6.894 - 29.365

Nitrate (umol/L): 0.035 - 10.235

Salinity (PPS): 31.551 - 39.131

Oxygen (ml/l): 4.396 - 7.195

Phosphate (umol/l): 0.041 - 0.897

Silicate (umol/l): 0.818 - 6.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

They are found in warm-temperate and tropical seas throughout the world and occupy both offshore and inshore waters above 20 °C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Warm temperate and tropical seas; inhabits offshore and coastal waters; usually offshore in most areas. Young are born in the water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The striped dolphin is an oceanic species, found down to several hundred metres, but may occasionally come close to shore in deeper areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The striped dolphin inhabits temperate and tropical pelagic waters (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In the western Pacific, makes seasonal migrations between pelagic and coastal areas; summers in pelagic waters, winters apparently in East China Sea (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

S. coeruleoalba seems to have an opportunistic feeding habit. Examining the stomach contents of many striped dolphins, researchers have found S. coeruleoalba to mainly feed on cephalopods, crustaceans, and bony fishes (Wuertz and Marrale, 1993). There is some variation in diet between ranges of S. coeruleoalba. Mediterranean striped dolphins seem to prey primarily on cephalopods (50-100% of stomach contents), while northeastern Atlantic striped dolphins most often prey on fish, frequently cod (Archer and Perrin, 1999). The ranges of observed prey indicate that striped dolphins primarily feed in pelagic or benthopelagic zones of the ocean, often along the continental slope (at the edge of the continental shelf where the ocean floor plunges steeply four to five kilometers) (Archer and Perrin, 1999).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mainly various mesopelagic fishes, as well as shrimp and squid (Leatherwood and Reeves 1983). Feeding depth may extend below 200 m (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious; commonly in groups of a few hundred, sometimes in herds of several thousand; group size in the Atlantic apparently tends to be smaller than that in the Pacific (IUCN 1991); groups are segregated by age class (Leatherwood and Reeves 1983, IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Striped dolphins are a gregarious species found in groups between a few to over 1,000 with average school sizes ranging from 100-500 dolphins. Schools consist of either: juveniles, breeding adults, or non-breeding adults. Calves typically join the juvenile school about 1-2 years after weaning. Females typically join the non-breeding adult school during the transition to sexual maturity. Striped dolphins are very agile and are known to breach (jump out of the water), bow ride, and "roto-tail" = a behavior where they make high arcing jumps then rapidly rotate the tail several times before re-entering the water. Striped dolphins communicate using clicks and whistles like many other dolphins.

They feed on cephalopods, crustaceans, and bony fishes. Their diet varies by region. Mediterranean striped dolphins tend to feed on cephalopods and northeastern Atlantic striped dolphins feed primarily on fish such as cod. Striped dolphins feed in pelagic or benthopelagic zones, often along the continental slope .

Male striped dolphins reach sexual maturity between ages 7-15, females between 5-13 years. In the western North Pacific range of the striped dolphin, mating season takes place in winter and in early summer. In the Mediterranean, mating season takes place in the fall. The gestation period lasts between 12-13 months during which time fetuses grow at an approximate rate of 0.29 cm/day. The nursing period lasts for about 16 months. Females typically have a four year calving interval, resting for 2-6 months between lactation and the next mating season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
50.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 57.5 years (wild) Observations: It has been estimated that these animals may live up to 57.5 years in the wild. One 48.5 year-old females has been found pregnant (Archer and Perrin 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The age of sexual maturity is quite variable within sexes. Males reach sexual maturity between the ages of 7 and 15, and females become sexually mature between 5 and 13 years of age. The mating season of the striped dolphin is in the winter and early summer in the western north Pacific, while it occurs in the fall in the Mediterranean (Archer and Perrin, 1999). The gestation period of striped dolphins lasts 12-13 months. Females typically have a four year calving interval, having a resting period of approximately 2-6 months between lactation and the next mating (Calzada et al., 1996).

Breeding interval: Females typically have a four year calving interval

Breeding season: The mating season of the striped dolphin is in the winter and early summer in the western north Pacific, while it occurs in the fall in the Mediterranean

Average number of offspring: 1.

Range gestation period: 12 to 13 months.

Range weaning age: 16 (high) months.

Average weaning age: 16 months.

Range age at sexual or reproductive maturity (female): 5 to 13 years.

Range age at sexual or reproductive maturity (male): 7 to 15 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 10000 g.

Average number of offspring: 1.5.

Fetuses grow at an approximate rate of 0.29cm/day. At birth, striped dolphins are 90-100cm long (differing slightly between ranges) and weigh approximately 11.3kg (Calzada, Aguilar, Sorensen, and Lockyer, 1996). Young calves then nurse for almost 16 months. (Archer and Perrin, 1999; Calzada et. al., 1996).

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the western Pacific, mating peaks in winter, spring, and possibly late summer; gestation lasts about 1 year; adult females produce single calf every 3 years; weaning completed at about 1.5 years; sexual maturity in 5-9 years, though newly mature males may not mate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stenella coeruleoalba

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2448-09|EU557097|Stenella coeruleoalba| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGGGCAGGAATAGTAGGTACCGGTCTA---AGTTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATCTTCTTTATAGTTATACCTATCATAATTGGAGGTTTCGGGAACTGATTAGTCCCCTTAATA---ATCGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCTTCAATAATTGAGGCCGGCGCAGGTACAGGCTGAACTGTCTACCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACTATTTTCTCTCTACATTTAGCCGGTGTCTCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATCATTAATATAAAACCACCCGCTATAACTCAATACCAAACACCCCTCTTCGTCTGATCAGTCTTAGTCACAGCAGTCTTACTTTTACTATCATTACCTGTTCTAGCAGCC---GGAATTACTATGCTACTAACCGATCGAAATCTAAACACAACCTTTTTCGATCCGGCAGGAGGAGGTGACCCAATCTTATATCACAACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTACCCGGCTTTGGAATAATTTCACACATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCTATAGTTTCTATTGGTTTCCTAGGTTTTATTGTATGAGCTCATCATATATTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stenella coeruleoalba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Contributor/s

Justification
Given the estimated population of over 2 million individuals worldwide, despite mortality due to direct and incidental takes in many parts of the world, there is no evidence of a major global decline that would warrant listing in a category of threat.

History
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

S. coeruleoalba is currently listed at Lower Risk in the IUCN - Red List. It is further categorized as being "Conservation Dependent," meaning that the species is in a taxa that is the focus of a conservation program. Without a conservation program, the striped dolphin will qualify for a threatened/endangered status within five years.

Habitat degradation, commercial fisheries, and killing dolphins for their meat all contribute to striped dolphin population declines.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix II of CITES (3). It is also listed on Appendix II of the Convention on Migratory Species (4). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. In the UK all cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Based on sighting data in 1983-91, the total striped dolphin abundance for several populations in the western North Pacific was estimated as 570,000 (CV = 19%; Miyashita 1993). Two areas of concentration of striped dolphins in the western North Pacific were identified. The first, estimated to comprise about 52,682 animals (CV = 95%), was found between 20° and 30°N. The second, a large concentration of around 497,725 (CV = 18%) animals, was located between 30° and 40°N. Relatively few striped dolphins (about 19,631; CV = 70%) were present in the nearshore waters off Japan (Kasuya 1999). In the coastal portion of this range, the population has probably been depleted by directed takes (Kasuya 1999); however, questions of population identity remain (IWC 1994). In the eastern tropical Pacific, the most recent population estimate from a 2003 line-transect survey was 1,470,854 (CV=15%) (Gerrodette et al. 2005) Abundance estimates within 555 km (300 nautical miles) of the U. S. West Coast have averaged about 19,000 (CV = 28%) between 1991-2005 (Barlow and Forney, in press). An estimated 13,143 (CV=46%) occur in Hawaiian waters (Barlow 2006). Balance and Pitman (1998) found that S. coeruleoalba was the second-most abundant species sighted in the western tropical Indian Ocean (14% of all cetaceans, compared 33% for the eastern tropical Pacific and 10% for the Gulf of Mexico).

Striped dolphins are the most abundant cetacean in the Mediterranean. The population in the western Mediterranean excluding the Tyrrhenian Sea was estimated in 1991 to be 117,880 (95%CI=68,379-214,800) (Forcada et al. 1994). There is no estimate for the eastern Mediterranean Sea. Goujon (1996) conducted a sighting survey in 1993 in the fishing grounds of the albacore tuna driftnet fishery in the Bay of Biscay and estimated the abundance of striped dolphins as 74,000. During 2003-2004, there were an estimated 3,325 (CV=48%) in the northern Gulf of Mexico (Waring et al. 2006), and 94,462 (CV=40%) in the western North Atlantic off the US east coast (Waring et al. 2008).

Morphological and genetic studies strongly suggest that the Mediterranean and eastern North Atlantic populations are isolated from each other, with little or no gene flow across the Strait of Gibraltar (Calzada and Aguilar 1995; García-Martínez et al. 1995; Archer 1997; Gaspari 2004). Within the Mediterranean there is some evidence of population structure based on restriction in gene flow between areas and significant differences in tissue pollutant levels (Calzada and Aguilar 1995; Monaci et al. 1998; Gaspari 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The largest directed catches have occurred in Japanese waters, in drive and hand-harpoon fisheries at several locations that date back to at least the Meiji period (1868-1912). Catch statistics are incomplete before 1978, but annual recorded takes exceeded 15,000-20,000 striped dolphins in some years. Catches were reduced beginning in 1981 and have since varied between 358 (in 1987) and 4,783 (1981), averaging 2,512 during the period 1981-89. Between 1988-1994, the average catch was 1,045 (Kasuya 1999). The average take between 1995-2004 was 502 individuals (Kasuya 2007), and there has been an annual quota of 725 since 1993 (through 2006). Fragmented information on morphology, life history, pollutant levels and genetics suggests that the striped dolphins taken by Japanese fisheries are from more than one subpopulation, with varying proportions among fisheries and perhaps over time (IWC 1993).

In Taiwan, some striped dolphins are harpooned opportunistically (John Wang pers. comm.). Striped dolphins are also taken in the drive fishery at Malaita in the Solomon Islands (Ross et al. 2003) and by harpoon and gillnet in Sri Lanka and St. Vincent (Perrin et al. 1994, Ilangakoon et al. 2000a&b). Other such small indigenous fisheries may exist elsewhere.

In the Mediterranean and Northeast Atlantic small numbers were taken in Spain, France and Italy for human consumption. They were also hunted for use as bait for shrimp traps and longlines (Reyes 1991). Illegal catches continue in southern Spain and probably in other areas (SGFEN 2001; Aguilar 2006).

Incidental catches occur throughout the range in various types of fishing gear, especially purse seines and gillnets, including in the northeastern Indian Ocean, the eastern tropical Pacific, the north-eastern Atlantic, the Mediterranean, in the North Pacific, off the coast of Japan, and in other coastal large-mesh pelagic driftnet and pelagic longline fisheries (Archer and Perrin 1999). Bycatch probably also occurs in similar fisheries in tropical and warm-temperate waters around the world. Although rare, striped dolphins have been caught in the Natal shark nets in South Africa (Perrin et al. 1994).

High-seas drift gillnet fisheries operated throughout the central and western North Pacific between about 35˚N and 47˚N, increased during the 1970s, and peaked during the 1980s before a United Nations moratorium came into effect in January 1993. Bycatch estimates are only available for 1990, when about 3,000 striped dolphins were estimated killed (Hobbs and Jones 1993). During the 1970s and 1980s, the combined high-seas driftnet fisheries likely killed tens of thousands of striped dolphins, but this level would not have been high enough to cause population declines (Hobbs and Jones 1993).

Incidental captures in pelagic driftnets have been a major source of mortality all over the western Mediterranean in the past. These nets are still being illegally used, e.g. by Moroccan, French, Italian and Turkish vessels, resulting in extensive dolphin mortality. The Spanish driftnet fishery in the Alborán Sea reportedly killed 145-183 striped dolphins per season in the early 1990s (Silvani et al. 1999); this fishery was halted in 1995 but the nets were transferred to Moroccan boats, which continue operating and are estimated to kill in the order of 1,555-2,092 striped dolphins per year (Tudela et al. 2004). The Italian driftnet fishery has been reported to kill 5,000-15,000 dolphins, mostly striped dolphins, per year (Di Natale 1992). The French thonaille driftnet fishery has been estimated to take about 180-472 striped dolphins per season (Imbert et al. 2001). Reports from other fishing activities are sparse and collected non-systematically, but they indicate that striped dolphin mortality in at least pelagic purse-seines, longlines and gillnets is widespread (Di Natale and Notarbartolo di Sciara 1994).

Large incidental kills in pelagic trawl and driftnet fisheries off western Europe are a source of concern (IWC 1998, Tregenza and Collet 1998). Antoine et al. (2001) found that by-catch rates in the tuna drift-net fishery in the northeastern Atlantic were 90 % composed of Delphinus delphis and Stenella coeruleoalba. Mean catch rate by trip in 1992-1993 years were 4.7 striped dolphins per km of net and per day. Such rates are similar to those estimated in other driftnet fisheries. Goujon (1996) estimated the annual additional mortality rate linked to driftnets in the Bay of Biscay albacore tuna fishery to be 1.8% for the striped dolphin. In the southwest Atlantic, by-catch of S. coeruleoalba was noted by Zerbini and Kotas (1998) off Brazil.

Tissue levels of organochlorine compounds, some heavy metals and selenium in Mediterranean striped dolphins are high and exceed threshold levels above which detrimental effects commonly appear in mammals (Cardellicchio et al. 2000; Monaci et al. 1998; Aguilar 2000). Organochlorine pollutants, in particular, are found at levels that greatly exceed thresholds of reproductive impairment in bottlenose dolphins elsewhere (Aguilar 2006). Blubber concentrations of DDT and PCB, the two main organochlorine pollutants, have been slowly declining in the last two decades (Aguilar and Borrell 2005) but are still high. High PCB levels have the potential to depress reproductive rates in striped dolphins (Munson et al. 1988). Extremely high concentrations of heavy metals, DDT and PCBs are also reported in specimens from Japan (Tanabe et al. 1983). The 1990-92 epizootic devastated the whole Mediterranean population of striped dolphins, producing many thousands of deaths (Bortolotto et al. 1992, Aguilar and Raga 1993). The primary cause of the die-off was a morbillivirus infection (Domingo et al. 1990), but PCBs and other organochlorine pollutants with potential for immunosuppressive effects may have triggered the event or enhanced its spread and lethality (Aguilar and Borrell 1994).

Commercially exploited fish and cephalopod species are important components of striped dolphin diet in the Mediterranean (Pulcini et al. 1993; Blanco et al. 1995). As many stocks of important striped dolphin prey (e.g. the European anchovy) are known to have been depleted, reduced prey availability resulting from conflict with commercial fisheries is considered a potentially important threat (Reyes 1991; Aguilar 2006) and may have contributed to the 1990-19992 epizootic (Aguilar 2000).

In 2004 and 2005, two series of unusual strandings in Taiwan included striped dolphins (Wang and Yang 2007). The cause(s) of the deaths of these animals have not been determined but it is likely that human (but non-fishing) activities were responsible. The largest directed catches have occurred in Japanese waters, in drive and hand-harpoon fisheries at several locations that date back to at least the Meiji period (1868-1912). Catch statistics are incomplete before 1978, but annual recorded takes exceeded 15,000-20,000 striped dolphins in some years. Catches were reduced beginning in 1981 and have since varied between 358 (in 1987) and 4,783 (1981), averaging 2,512 during the period 1981-89. Between 1988-1994, the average catch was 1,045 (Kasuya 1999). The average take between 1995-2004 was 502 individuals (Kasuya 2007), and there has been an annual quota of 725 since 1993 (through 2006). Fragmented information on morphology, life history, pollutant levels and genetics suggests that the striped dolphins taken by Japanese fisheries are from more than one subpopulation, with varying proportions among fisheries and perhaps over time (IWC 1993).

In Taiwan, some striped dolphins are harpooned opportunistically (J. Wang pers. comm.). Striped dolphins are also taken in the drive fishery at Malaita in the Solomon Islands (Ross et al. 2003) and by harpoon and gillnet in Sri Lanka and St. Vincent (Perrin et al. 1994, Ilangakoon et al. 2000a&b). Other such small indigenous fisheries may exist elsewhere.

In the Mediterranean and Northeast Atlantic small numbers were taken in Spain, France and Italy for human consumption. They were also hunted for use as bait for shrimp traps and longlines (Reyes 1991). Illegal catches continue in southern Spain and probably in other areas (SGFEN 2001; Aguilar 2006).

Incidental catches occur throughout the range in various types of fishing gear, especially purse seines and gillnets, including in the northeastern Indian Ocean, the eastern tropical Pacific, the north-eastern Atlantic, the Mediterranean, in the North Pacific, off the coast of Japan, and in other coastal large-mesh pelagic driftnet and pelagic longline fisheries (Archer and Perrin 1999). Bycatch probably also occurs in similar fisheries in tropical and warm-temperate waters around the world. Although rare, striped dolphins have been caught in the Natal shark nets in South Africa (Perrin et al. 1994).

High-seas drift gillnet fisheries operated throughout the central and western North Pacific between about 35˚N and 47˚N, increased during the 1970s, and peaked during the 1980s before a United Nations moratorium came into effect in January 1993. Bycatch estimates are only available for 1990, when about 3,000 striped dolphins were estimated killed (Hobbs and Jones 1993). During the 1970s and 1980s, the combined high-seas driftnet fisheries likely killed tens of thousands of striped dolphins, but this level would not have been high enough to cause population declines (Hobbs and Jones 1993).

Incidental captures in pelagic driftnets have been a major source of mortality all over the western Mediterranean in the past. These nets are still being illegally used, e.g. by Moroccan, French, Italian and Turkish vessels, resulting in extensive dolphin mortality. The Spanish driftnet fishery in the Alborán Sea reportedly killed 145-183 striped dolphins per season in the early 1990s (Silvani et al. 1999); this fishery was halted in 1995 but the nets were transferred to Moroccan boats, which continue operating and are estimated to kill in the order of 1,555-2,092 striped dolphins per year (Tudela et al. 2004). The Italian driftnet fishery has been reported to kill 5,000-15,000 dolphins, mostly striped dolphins, per year (Di Natale 1992). The French thonaille driftnet fishery has been estimated to take about 180-472 striped dolphins per season (Imbert et al. 2001). Reports from other fishing activities are sparse and collected non-systematically, but they indicate that striped dolphin mortality in at least pelagic purse-seines, longlines and gillnets is widespread (Di Natale and Notarbartolo di Sciara 1994).

Large incidental kills in pelagic trawl and driftnet fisheries off western Europe are a source of concern (IWC 1998, Tregenza and Collet 1998). Antoine et al. (2001) found that by-catch rates in the tuna drift-net fishery in the northeastern Atlantic were 90 % composed of Delphinus delphis and Stenella coeruleoalba. Mean catch rate by trip in 1992-1993 years were 4.7 striped dolphins per km of net and per day. Such rates are similar to those estimated in other driftnet fisheries. Goujon (1996) estimated the annual additional mortality rate linked to driftnets in the Bay of Biscay albacore tuna fishery to be 1.8% for the striped dolphin. In the southwest Atlantic, by-catch of S. coeruleoalba was noted by Zerbini and Kotas (1998) off Brazil.

Tissue levels of organochlorine compounds, some heavy metals and selenium in Mediterranean striped dolphins are high and exceed threshold levels above which detrimental effects commonly appear in mammals (Cardellicchio et al. 2000; Monaci et al. 1998; Aguilar 2000). Organochlorine pollutants, in particular, are found at levels that greatly exceed thresholds of reproductive impairment in bottlenose dolphins elsewhere (Aguilar 2006). Blubber concentrations of DDT and PCB, the two main organochlorine pollutants, have been slowly declining in the last two decades (Aguilar and Borrell 2005) but are still high. High PCB levels have the potential to depress reproductive rates in striped dolphins (Munson et al. 1988). Extremely high concentrations of heavy metals, DDT and PCBs are also reported in specimens from Japan (Tanabe et al. 1983). The 1990-92 epizootic devastated the whole Mediterranean population of striped dolphins, producing many thousands of deaths (Bortolotto et al. 1992, Aguilar and Raga 1993). The primary cause of the die-off was a morbillivirus infection (Domingo et al. 1990), but PCBs and other organochlorine pollutants with potential for immunosuppressive effects may have triggered the event or enhanced its spread and lethality (Aguilar and Borrell 1994).

Commercially exploited fish and cephalopod species are important components of striped dolphin diet in the Mediterranean (Pulcini et al. 1993; Blanco et al. 1995). As many stocks of important striped dolphin prey (e.g. the European anchovy) are known to have been depleted, reduced prey availability resulting from conflict with commercial fisheries is considered a potentially important threat (Reyes 1991; Aguilar 2006) and may have contributed to the 1990-19992 epizootic (Aguilar 2000).

In 2004 and 2005, two series of unusual strandings in Taiwan included striped dolphins (Wang and Yang 2007). The cause(s) of the deaths of these animals have not been determined but it is likely that human (but non-fishing) activities were responsible.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Comprises a minor component of dolphins killed by purse-seine tuna fishery in eastern tropical Pacific. There is some concern about the levels of direct and indirect catching in various parts of the range (IUCN 1991). Population off Japan declined from the mid-1940s through at least the early 1980s, due to overexploitation (see Baird et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Once a substantial threat, by-catch has been reduced from 14,000 striped dolphins a year between 1950 and 1969 in the western Pacific, to a current incidental catch of 2,000 to 4,000 individuals. Fishermen kill dolphins caught in their nets as they present competition for fish (7). Hunting has also been known to take place, particularly in Japan, but is not considered a major threat, and Japan has voluntarily reduced its catch. Water pollution as a result of the release of heavy metals causes lung disease, and the over-fishing of anchovies has harmed populations in some areas (4). In the Mediterranean Sea, a morbillivirus caused the death of more than 1,000 animals between 1990 and 1992. The epidemic was possibly caused by poor environmental conditions (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

Striped dolphins are one of the main small cetacean species involved in small cetacean harpoon and drive fisheries in Japanese waters. The impact of these takes on the populations should be reassessed.

The current ban on driftnet fishing in the Mediterranean should be implemented and enforced as a matter of priority.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, the striped dolphin is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (5). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by 7 European Countries, this includes the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Striped dolphins are in constant competition with humans over prey. The dolphins and fisheries compete over anchovies, tuna, and cod. Fisherman often kill striped dolphins that are caught in their fishing nets. The number of striped dolphins killed in the western Pacific was estimated at 14,000 each year between 1950-1969, but more recently has decreased to between 2,000 and 4,000 per year (  http://www.cetacea.org/striped.htm, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Striped dolphins provide much entertainment to sailors and travelers, as they flip, twist, and breach alongside the waves created by ships and boats. In addition, they are sometimes hunted for meat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted by fishermen (harpooning, herding) in Japan for many centuries (annual catch in 1960s and 1970s was 10,000-20,000; 16,000 in 1980; 2918 in 1986). Included in native catch of small cetaceans around southwest Pacific islands (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Striped dolphin

The Striped Dolphin (Pseudorca crassidens) is an extensively studied dolphin that is found in temperate and tropical waters of all the world's oceans. It is a member of the family Delphinidae of toothed whales.

Contents

Taxonomy

The Striped Dolphin is one of five species traditionally included in the genus Stenella; however, recent genetic work by LeDuc et al. (1999) indicates that Stenella, as traditionally conceived, is not a natural group. According to that study, the closest relatives of the Striped Dolphin are the Clymene Dolphin, the Common Dolphins, the Atlantic Spotted Dolphin, and "Tursiops aduncus, which was formerly considered a subspecies of the Bottlenose Dolphin. The Striped Dolphin was described by Franz Meyen in 1833. The specific name coeruleoalba (from Latin caeruleus 'dark blue' and albus 'white') refers to the characteristic blue and white stripes on the flanks.

Physical description

The Striped Dolphin has a similar size and shape to several other dolphins that inhabit the waters that it does (see Pantropical Spotted Dolphin, Atlantic Spotted Dolphin, Clymene Dolphin). However its colouring is very different and makes them relatively easy to notice at sea. The underside is blue, white or pink. There are one or two black bands that circle the eyes, and then run across the back, to the flipper. These bands widen to the width of the flipper which are the same size. There are two further black stripes running from behind the ear - one is short and ends just above the flipper. The other is longer and thickens along the flanks until it curves down under the belly just prior to the tail stock. Above these stripes the dolphin's flanks are coloured light blue or grey. All appendages are black as well. At birth, individuals weigh about 10 kg (22 pounds) and are up to a meter (3 feet) long. By adulthood they have grown to 2.4 m (8 ft) (females) or 2.6 m (8.5 ft) (males) and weigh 150 kg (330 lb) (female) or 160 kg (352 lb) (male). Research suggest that sexual maturity was reached at 12 years in Mediterranean females and in the Pacific at between 7 and 9 years. Longevity is about 55–60 years. Gestation lasts approximately 12 months and there is a three or four year gap between calving.

In common with other dolphins in its genus, the Striped dolphin moves in large groups - usually in excess of up to thousands of individuals in size. Groups may be smaller in the Mediterranean and Atlantic. They may also mix with Common Dolphins. The Striped dolphin is as capable as any dolphin at performing acrobatics - frequently breaching and jumping far above the surface of the water. Sometimes, it approaches boats in the Atlantic and Mediterranean but this is dramatically less common in other areas, particularly in the Pacific where it has been heavily exploited in the past.

The Striped Dolphin feeds on small pelagic fish and squid.

Population and distribution

The Striped Dolphin likes temperate or tropical, off-shore waters. It is found in abundance in the North and South Atlantic Oceans, including the Mediterranean and Gulf of Mexico, the Indian Ocean and the Pacific Ocean. Roughly speaking it occupies a range running from 40° N to 30° S. It has been found in water temperatures ranging from 10 to 26 degrees Celsius, though the standard range is 18-22 degrees. In the western Pacific, where the species has been extensively studied, a distinctive migration pattern has been identified. This has not been the case in other areas. The dolphin appears to be common in all areas of its range, though that may not be continuous in areas of low population density do exist. The total population is in excess of two million.

Human interaction

Japan has hunted Striped Dolphins in the western Pacific since at least the 1940s. In the heyday of "striped dolphin drives", at least 8,000 to 9,000 individuals were killed each year and in one exceptional year 21,000 individuals were killed. Since the 1980s, following the introduction of quotas, this number has fallen to around 1,000 kills per year. Conservationists are concerned about the Mediterranean population which is threatened by pollution, disease, busy shipping lanes and heavy incidental catches in fishing nets.

Attempts have been made to keep the Striped Dolphin in captivity. However these have all failed, with animals dying within two weeks due to failure to feed.

Diet

The adult Striped Dolphin eats fish, squid, octopus, krill, and other crustaceans. Mediterranean striped dolphins seem to prey primarily on cephalopods (50-100% of stomach contents), while northeastern Atlantic striped dolphins most often prey on fish, frequently cod. They mainly feed on cephalopods, crustaceans, and bony fishes. They feed anywhere within the water column where prey is concentrated and they can dive to depths of 700 metres to hunt deeper-dwelling species.

Conservation

The Eastern tropical Pacific and Mediterranean populations of the Striped dolphin are listed on Appendix II [3] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS), since they have an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the Striped dolphin is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS), the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS), the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU) and the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU)

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300089. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Stenella coeruleoalba. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  1. LeDuc, R.G., W.F. Perrin and A.E. Dizon (1999). Phylogenetic relationships among the delphinid cetaceans based on full cytochrome b sequences. Marine Mammal Science, vol. 15, no. 3:619-648.
  2. Striped Dolphin by Frederick I. Archer II in Encyclopedia of Marine Mammals pp. 1201–1203. ISBN 978-0-12-551340-1
  3. Eds. C.Michael Hogan and C.J.Cleveland. 2011. Striped dolphin. Encyclopedia of Earth with content partner EOL, National Council for Science and Environment, Washington, DC
  4. Whales Dolphins and Porpoises, Mark Carwardine, Dorling Kindersley Handbooks, ISBN 0-7513-2781-6
  5. National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, ISBN 0-375-41141-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two stocks may be present in the eastern tropical Pacific, with a distributional break between about 10 and 17 degrees north latitude (see Baird et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!