Articles on this page are available in 1 other language: Spanish (31) (learn more)

Overview

Brief Summary

Description

As its common name suggests, the pantropical spotted dolphin is a spotted dolphin that occurs in tropical waters around the world. It is one of the species that fisherman tend to follow as a means of finding yellowfin tuna, which swim with them. Consequently, millions of these dolphins have been killed after becoming entangled in fishing nets. An international effort has reduced the danger in recent years by introducing dolphin-rescue techniques, limiting the accidental kill to a few thousand each year. Why the dolphins and tuna associate is unknown.

Links:
Mammal Species of the World
  • Original description: Gray, J. E., 1846.  On the cetaceous animals. Pp. 13-53, in The zoology of the voyage of H.M.S. Erebus and Terror, under the command of Capt. Sir J. C. Ross, R. N., F. R. S., during the years 1839 to 1843 (Sir J. Richardson and J. E. Gray, eds.) [1844-1875], 1:44.  E. W. Janson, London, 2 vols.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The gregarious pantropical spotted dolphin forms schools that can range in size from less than one hundred to thousands of individuals (4); although it has been observed that these impressively large herds are less common in the eastern tropical Pacific than they once were, as exploitation takes its toll (4). The pantropical spotted dolphin is well known for its tendency to associate with schools of tuna in this region. While this may be due to an overlap in diet, other reasons for this association have also been suggested, such as increased protection from predators (2), as there is safety in numbers. This ocean mammal is a fast swimmer that often engages in a range of aerial acrobatics and will frequently ride the bow waves of boats, except for in tuna fishing grounds where it has learnt to avoid vessels (2) (4). Juveniles in particular are known to make astoundingly high vertical leaps out of the water (2). The pantropical spotted dolphin feeds mainly at night on small fish, squid and crustaceans that rise to near the surface at dusk, with flying fish forming a major part of the diet in some regions. In turn, this dolphin becomes prey for the killer whale (Orcinus orca) and a number of sharks (2). While the breeding system of this species is not known, it is possible that it may be promiscuous, like that of the closely related spinner dolphin (Stenella longirostris) (2). Every two to three years, mature female pantropical spinner dolphins give birth to a calf, after a gestation period of around 11 months (2). The calf is nursed for between one and two years. Females reach sexual maturity at 9 to 11 years, while males become sexually mature between the ages of 12 and 15 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Pantropical spotted dolphins can be identified by their long beak sharply demarcated from the melon, slender body, strongly recurved fin and spotted body. The ventral spots fuse and fade to a medium grey, and the dorsal light spots intensify, sometimes to the point of making the animal appear nearly white above. The tip of the beak is white. Details of coloration and spot intensity vary regionally. The newborn calf is unspotted. Males are on average slightly larger than females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The most distinctive feature of the pantropical spotted dolphin is, as its name suggests, the spots that speckle the body of adults. Newborn calves are unspotted, but by adulthood, a varying amount of light spots cover the upper surface, and dark spots cover the dolphin's underside (2). Underneath this spotting, the slender, stream-lined body is grey, with a darker grey cape extending back from the head and sweeping low underneath the dorsal fin (2) (4). The dorsal fin is narrow and sickle-shaped (4). The long, thin beak of the pantropical spotted dolphin is separated from the melon by a distinct crease (2) (4). In most adults, the tip of the beak is white (2). Male pantropical spotted dolphins are slightly larger than females (2). A subspecies of the pantropical spotted dolphin is recognised, Stenella attenuate graffmani, which inhabits more coastal areas and can be distinguished in appearance by its larger, stockier body, thicker beak and more extensive spotting (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

S. a. attenuata is pantropical, found in all oceans between about 40°N and 40°S, although it is much more abundant in the lower-latitude portions of its range. The range extends to some enclosed seas, such as the Red Sea and Persian Gulf, but does not include the Mediterranean Sea (Perrin 2001, 2002).

S. a. graffmani – The coastal spotted dolphin is found only in a narrow band (<200 km wide) along the coast of Latin America, from southern Mexico to Peru (Perrin 2001; Escorza-Treviño et al. 2005). Recent genetic data suggest there may be several populations contained within this subspecies (Escorza-Treviño et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Stenella attenuata lives in the Atlantic, Indian, and Pacific oceans. It migrates seasonally to the Japanese coast and is the most common cetacean in the Gulf of Mexico. (Lang 1996, Nowak 1997)

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

all oceans, between about 40°N and 40°S
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

distributed worldwide in tropical and some sub-tropical oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Comores, European waters (ERMS scope), Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Reunion, Seychelles, Somalia, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Spreads in the tropical and warm waters around the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide in tropical and some subtropical waters (some extralimital records from cooler waters) (Perrin et al. 1987); mainly between 40 degrees north latitude and 40 degrees south latitude, though mainly at lower latitudes (Jefferson et al. 1993). Mundialmente en aguas tropicales, c lidas, templadas. Desde M¿xico hasta Per£ en el Atl ntico desde M¿xico hasta Venezuela.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The pantropical spotted dolphin is a widely distributed species, occurring in all oceans between 40°N and 40°S (4) (5). Subspecies S. a. graffmani occurs in the eastern tropical Pacific from Mexico to northern Peru (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

S. attenuata is referred to as the pantropical spotted dolphin because its skin becomes spotted as the dolphin grows older. Its dorsal surface is dark gray but covered in paler spots, while its paler ventral surface is covered with dark spots. Another distinguishing feature is the spotted dolphin's bright, white snout. It also has melon, a fatty area located on its forehead. The inshore spotted dolphins tend to be larger in size than offshore dolphins. Males also typically have larger body sizes than females, yet females have longer rostra. The spotted dolphin has between 29 and 37 small, rounded teeth on either side of its upper and lower jaws. It has pectoral fins (on the sides), a dorsal fin (on the central back), and tail flukes. The blowhole, used for breathing and communication, is located on the top of the head. Because S. attenuata has a thin layer of blubber, it has small amounts of stored energy, so it eats high energy foods to make up for the low energy. (Bernard et al. 1989, Lang 1996, Misek et al. 1997, Myers 1997, Nowak 1997, Perrin et al. 1994)

Range mass: 60 to 165 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length: 166 – 257 cm; Weight: up to 119 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 257 cm

Weight: 119000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 1.6-2.6 m males; 1.7-2.5 m females

Weight:
Range: up to 119 Kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In the eastern Pacific the pantropical spotted dolphin is an inhabitant of the tropical, equatorial and southern subtropical water masses. The waters in which the animal occurs with greatest frequency are those underlain by a sharp thermocline at depths of less than 50 m and with surface temperatures over 25°C and salinities less than 34 parts per thousand. These conditions prevail year round in the region north of the Equator called the "Inner Tropical" waters of the eastern Pacific. Occurrence in this core habitat is correlated with apparent multi-species foraging and feeding behaviour. The species also occurs in similar waters south of the Equator that expand and contract greatly with season and year to year (Perrin and Hohn 1994). In the Atlantic, S. attenuata is primarily a dolphin of the high seas and oceanic islands, but in the eastern Pacific a large-bodied subspecies occurs along the coast from Mexico to Peru. Detailed analysis of oceanographic correlates of distribution will be necessary in order to understand fully the habitat requirements of these pelagic dolphins, often the most conspicuous elements of tropical cetacean communities around the world (Ballance and Pitman 1998).

Offshore spotted dolphins feed largely on small epi- and mesopelagic fishes, squids, and crustaceans that associate with the deep scattering layer (Robertson and Chivers 1997). In some areas, flying fish are also important prey. The diet of the coastal form is poorly known, but is thought to consist mainly of larger fishes, perhaps mainly bottom-living species (Perrin 2001, 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

S. attenuata lives in the tropical and subtropical areas of the ocean and seas. Although some live inshore, most members of the species live offshore, where the temperature of the deeper water remains fairly constant. The majority of this species live in between the equator and the Galapagos Islands for the same reason that they tend to live offshore. The home range is hundreds of kilometers in diameter. (Nowak 1997)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1947 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1759 samples.

Environmental ranges
  Depth range (m): 0 - 60
  Temperature range (°C): 13.598 - 29.446
  Nitrate (umol/L): 0.036 - 10.235
  Salinity (PPS): 31.742 - 36.791
  Oxygen (ml/l): 4.400 - 6.082
  Phosphate (umol/l): 0.058 - 0.889
  Silicate (umol/l): 0.787 - 7.399

Graphical representation

Depth range (m): 0 - 60

Temperature range (°C): 13.598 - 29.446

Nitrate (umol/L): 0.036 - 10.235

Salinity (PPS): 31.742 - 36.791

Oxygen (ml/l): 4.400 - 6.082

Phosphate (umol/l): 0.058 - 0.889

Silicate (umol/l): 0.787 - 7.399
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Stenella attenuata live mainly in tropical or warm waters, and are found in both near-shore and oceanic habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Primarily a high-seas pelagic species found in deep water far from land; a larger form inhabits the onshore waters of Mexico and Central America (Perrin, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

As its name suggests, this dolphin inhabits tropical and warm-temperate seas, where it can be found in both near-shore and oceanic habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Makes seasonal migrations within annual home range (Perrin et al. 1987); offshore in fall and winter, onshore in spring and summer (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The spotted dolphin finds its prey, squid and small fish, near the ocean surface. These dolphins have also been known to feed on isopods and pteropods. Lactating females eat significantly more fish than pregnant or normal spotted dolphins. The lactating female's deviation from the norm is presumably because she requires more energy than normal and pregnant dolphins. More protein and also more energy is obtained from eating fish, rather than from eating the same mass of squid. In addition, fish also contain more calcium and phosphorous, which aid in lactation. Lastly, fish have lower water content, which prevents additional water loss in the lactating female since the consumed fish are hypotonic with the sea water. (Bernard 1989, Lang 1996, Nowak 1997)

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Recorded stomach contents include various small epipelagic and mesopelagic fishes and squids and unidentified nemertean worms and crab larvae (Perrin et al. 1987). In eastern tropical Pacific, diet dominated by squid in pregnant females, by fishes in lactating females (Bernard and Horn 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Northern offshore population in the eastern tropical Pacific may have averaged 2.5 million in 1981-1986; the southern offshore stock was estimated at 250,000-500,000 in the 1980s (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In eastern tropical Pacific, commonly associates with yellowfin tuna (as do spinner dolphins and sea birds). Pod size: a few individuals to several thousand. For oceanic populations, annual home range diameter may be several km or more. (Perrin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

The prey of the pantropical spotted dolphin is made up primarily of small epipelagic fish, squid and crustaceans, with some take of mesopelagic animals. The gregarious pantropical spotted dolphin forms schools that can range in size from less than one hundred to thousands of individuals. Spotted dolphin females reach sexual maturity at 9 years, males at 12 years. It is thought to mate year round. Calves are born in May and September following a gestation period 11-12 months. The pantropical spotted dolphin can live for 46 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
46.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 46 years (wild) Observations: There are reports of pregnant females up to the age of 35. Their maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mean age of sexual maturity for northern offshore female spotted dolphins is estimated to be 11.1 years, which is higher than the estimated age of 9.8 years for southern offshore females. On the other hand, males' average age of sexual maturity is 14.7 years. S. attenuata does not have any particular birthing season, although the number of births does rise in spring and autumn months. The time between births is between 26 and 36 months in the eastern Pacific and approximately 48 months near Japan. The gestation period lasts a little less than a year, and the lactation period can last for 1.5 years or longer. Females usually give birth to a single offspring (Bernard et al. 1989, Chivers et al. 1993, Nowak 1997)

Breeding interval: The time between births is between 26 and 36 months in the eastern Pacific and approximately 48 months near Japan

Breeding season: These dolphins breed year round

Average number of offspring: 1.

Range gestation period: 12 (high) months.

Average gestation period: 12 months.

Average weaning age: 18 months.

Average age at sexual or reproductive maturity (female): 9.8 to 11.1 years.

Average age at sexual or reproductive maturity (male): 14.7 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 10000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
3956 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2983 days.

This lactation period is more than three times as long as other large whales. Occasionally females have been known to lactate during a new pregnancy, and some have also been known to give birth to twins, although this is rare. Mother dolphins feed near the surface so that they don't have to leave their calves. Pregnant females up to age 35 have been discovered.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Two calving peaks occur in the eastern tropical Pacific, one in spring and one in fall (Jefferson et al. 1993). Calving interval averages 2-3 years in eastern Pacific, 4-6 years in western Pacific. Males are sexually mature at average age of 15 years, females at average of 10-12 years. Old females may not reproduce. Maximum longevity may exceed 45 years (see Perrin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stenella attenuata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2250-09|NC_012051|Stenella attenuata| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGGGCAGGAATAGTAGGTACCGGTCTA---AGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGCTTTGGGAACTGATTAGTTCCCTTAATA---ATCGGAGCCCCTGACATAGCATTCCCTCGTCTGAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTATTACTAATAGCATCTTCAATAGTTGAGGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACACCTCTCTTCGTCTGATCAGTCTTAGTCACAGCAGTCTTACTCTTACTATCATTACCTGTCCTAGCAGCC---GGAATTACTATACTACTAACTGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTGCCCGGCTTTGGAATAATTTCACACATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCTATAGTTTCTATTGGTTTCCTAGGTTTCATTGTATGAGCTCATCATATGTTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stenella attenuata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Contributor/s

Justification
The abundance estimates available total more than 2.5 million, and additional likely large populations in the Atlantic, Indian and Pacific Oceans have not been assessed. The northeastern population in the ETP declined 76% within the last three generations (69 years), but that decline has ceased and was not large enough to constitute a global decline of 30%. Large impacts of direct catch and bycatch in other regions have not been identified, and it is unlikely that the global population has been reduced by as much as 30%. Therefore, the species is assesed as Least Concern.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Because S. attenuata tend to swim with yellowfin tuna, Pacific fishermen use sightings of these dolphins to help them locate their yellowfin tuna targets. The majority of S. attenuata deaths are a consequence of yellowfin tuna fishing operations. The enormous nets used to catch these tuna can unintentionally entangle dolphins as well as fish. S. attenuata is the dolphin species that has been affected to the greatest extent by the tuna fish industry. Between 1985 and 1990, almost 130,000 were killed each year because of the tuna fish catching methods. Thanks to United States government regulations, such as requiring improvements in fishing equipment, this number has decreased substantially by 100,000 deaths per year. Some spotted dolphins are killed intentionally by Japanese fishermen. Between 500 and 2000 spotted dolphins are harvested annually in order to be eaten by the Japanese. (Bernard et al. 1989, Chives et al. 1993, Nowak 1997, Perrin et al. 1994)

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Worldwide range in warm oceans; population may be near 3 million in eastern tropical Pacific portion of the range; a decline has occurred in the eastern tropical Pacific as a result of mortality in the tuna fishery.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the eastern Pacific, there were an estimated 228,038 coastal spotted dolphins in 2000 (CV=34%; Gerrodette and Forcada 2002a). The north-eastern offshore spotted dolphin (the form most affected by the ETP tuna fishery) numbered about 737,000 in 2003 (CV=15%; Gerrodette et al. 2005), a reduction of 76% from original size in 1959 (Reilly et al. 2005). This population is not showing clear signs of recovery despite the dramatic decline in mortality in recent years (Gerrodette and Forcada 2005). The western/southern offshore stock (which is less affected by the fishery) numbered about 876,075 in 2000 (CV=31%; Gerrodette and Forcada 2002b). In Hawaiian waters, there are an estimated 8,978 (CV=48%) (Barlow 2006). About 438,000 inhabited Japanese waters in the early 1990s (Miyashita 1993). There are estimated to be 34,067 (CV=18%) in the northern Gulf of Mexico (Mullin 2006), and 4,439 (CV=49%) along the east coast of the United States (Waring et al. 2006). Dolar et al (2006) estimated about 14,930 (CV=41%) for the eastern Sulu Sea and 640 (CV=27%) for the Tañon Strait between the islands of Negros and Cebu.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Still widely distributed and abundant, but some populations have declined. Northern offshore population in the eastern tropical Pacific apparently declined by 40-60% from the early 1960s to the mid- to late 1970s; declined from about 4 million in 1975-1980 to an average of 2.5 million in 1981-1986, though fluctuations in oceanographic conditions may have confounded these results (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Offshore spotted dolphins bore the brunt of the massive dolphin kill by tuna seiners from the late 1950s to the 1980s in the eastern Pacific (although the coastal subspecies was also impacted). For example, in the period 1959 to 1972, nearly five million dolphins were killed, and of this number, about three million were from the north-eastern offshore population (Wade 1995). Since the Inter-American Tropical Tuna Commission (IATTC) implemented per-vessel mortality limits on the international fleet, the combined annual mortality for all spotted dolphins in the ETP has decreased greatly, e.g. to only 373 in 2005 (IATTC 2006). Although current mortality is greatly reduced, the north-eastern form appears to be recovering very slowly, if at all, and potential factors such as fishery-related stress, unobserved mortality due to calf separation and orphaning during fishing operations (Archer et al. 2001), possible mortality by small vessels that do not carry observers, under-reporting of mortality, and ecosystem change, have been suggested as possible reasons for the species’ slow recovery (Gerrodette and Forcada 2005).

Spotted dolphins are also taken incidentally in local fisheries along the Central American coast (Palacios and Gerrodette 1996).

Yang et al. (1999) also reported incidental mortality in Chinese fisheries, and Dolar 1994 found incidental spotted dolphin takes in the Philippines. An unknown but suspected large number of pantropical spotted dolphins are taken by the large-mesh pelagic driftnet fishery off eastern Taiwan (J. Wang pers. comm.).

Japan takes large numbers of spotted dolphins for human consumption. The catch in 1982 was 3,799, and annual catches between 1994 and 1997 ranged from 23 to 449 (Perrin 2002). Between 1995 and 2004, the average annual catch was 129 animals (Kasuya 2007). The drive fishery for spotted dolphins began in 1959 and is thought to have caused a slight decline in the minimum age at attainment of sexual maturity in females (Kasuya 1985).

Pantropical spotted dolphins are also taken in hand-harpoon fisheries in the Philippines (Dolar et al. 1994); in Taiwan, where it is the locally preferred species of cetacean for human consumption (J. Wang pers. comm.); and regularly or opportunistically by gillnet and harpoon in India and Sri Lanka (Perrin and Hohn 1994). Drive hunts at Malaita in the Solomon Islands took several hundred or thousands of spotted dolphins annually in the 1960s; the hunts continue at present (Ross et al. 2003, Kahn 2006). Small numbers are taken in numerous small subsistence fisheries for dolphins and whales around the world, e.g. at St. Vincent in the Lesser Antilles (Perrin and Hohn 1994) and Lamalera in Indonesia (Kahn 2004). Most of these kills have not been adequately monitored and the effects on the subpopulations are usually not known.

Dolphins and small whales of several species, including S. attenuata, putatively interfere in hook-and-line fisheries for squid and yellowtail in the Iki Island region of Japan (Kishiro and Kasuya 1993). Bounties have been paid to fishermen for dolphins killed since 1957. During the period 1976-1982 a total of 538 spotted dolphins were killed. The effect of these takes on the regional population is not known (Perrin and Hohn 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Some populations have declined as result of mortality associated with purse-seine tuna fishery in eastern tropical Pacific (Smith 1983, IUCN 1991); takes of 100,000s per year occurred in the 1960s and 1970s (Jefferson et al. 1993); estimated that 70,000 were killed in 1986 (IUCN 1991); annual mortality in the late 1980s was in the 10,000s (Jefferson et al. 1993). Taken also in drive fisheries in Japan and the Solomon Islands, in gillnet and harpoon fisheries in Sri Lanka, and in the Caribbean small cetacean fishery, among others (Jefferson et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The tendency of the pantropical spotted dolphin to associate with tuna schools has been this species' downfall in the eastern tropical Pacific. Fishermen take advantage of this association to help them locate and catch tuna more efficiently (4), and will intentionally capture both tuna and dolphins together, then release the dolphins from the net (6). Either the dolphin is killed in the process, or this can lead to a single dolphin being chased, captured and released many times during its lifetime, causing a great deal of stress (6). In the eastern tropical Pacific, tuna fisheries have killed millions of dolphins since the 1960s (2) (5), reducing some stocks to a fraction of their former size (2). Today, mortality rates have been greatly reduced, yet the populations are not recovering from this devastating exploitation as well as could be expected; the stresses of being repeatedly chased and captured, as well as separation of mothers from their young, are possible reasons cited for the slow growth of the populations (5). Pantropical spotted dolphins are also hunted intentionally in some areas, such as in Japan, Solomon Islands and the Philippines, where they are caught for human consumption and fishing bait (2) (5). They are also taken as bycatch in many fisheries in developing countries around the globe, and in some countries, such as Peru, Ghana and the Philippines, the bycatch is kept and used for human consumption. This has lead to the evolution of directed catches as the markets for the meat develop, resulting in a growing conservation problem (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

Spotted dolphins, as with other species impacted by the ETP tuna purse-seine fishery, are managed both nationally by the coastal countries and internationally by the IATTC. The IATTC has imposed annual stock mortality limits on each purse seine and promulgated regulations regarding the safe release of dolphins (Bayliff 2001).

As the species comprises several subspecies and regional populations, the conservation status of each of these should be assessed separately since the available estimates of abundance and removals suggest that some of them may fall into a Threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Once it had been noticed what enormous numbers of dolphins were being killed in tuna fisheries in the eastern Pacific, actions were implemented to try and reduce these unnecessary deaths. In the 1970s, the United States employed laws and measures aiming to reduce dolphin bycatch to levels approaching zero through improved fishing methods (6). In 1979, the Inter-American Tropical Tuna Commission began a dolphin conservation program, and soon, the idea of dolphin-safe tuna became popular, with the United States only allowing the sale of dolphin-safe tuna by 1994. In 1999, the International Dolphin Conservation Program Agreement came into force, which meant the major tuna fishing countries in the eastern Pacific were bound to certain measures such as having observers on boats and strict dolphin-mortality limits. As a result of all of these actions, dolphin mortality has fallen drastically (6), which will hopefully give the pantropical spotted dolphins, and other dolphin species, a much needed opportunity to recover.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Regulations designed to lessen the number of dolphins killed by tuna fishermen have increased the cost and complexity of the fishery.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The spotted dolphin helps yellowfin tuna fishermen to locate their target. (Nowak 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Some (at least several hundred) are taken directly in fisheries in various parts of the range. One of the dolphin species blamed for interference in a hook-and-line fishery of Iki Island in Japan. See IUCN (1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pantropical spotted dolphin

The Pantropical spotted dolphin (Stenella attenuata) is a species of dolphin found in all the world's temperate and tropical oceans. The species was beginning to come under threat due to the killing of millions of individuals in tuna purse seines. The 1980s saw the rise of "dolphin-friendly" tuna capture methods in order to save millions of the species in the eastern Pacific Ocean and it is now one of the most abundant dolphin species in the world.

Contents

Taxonomy

The species was first described by John Gray in 1846. Gray's initial analysis included the Atlantic spotted dolphin in this species. They are now regarded as separate. Both the genus and specific names come from Latin words meaning thin or thinning.

There are three subspecies recognised in Rice's 1998 survey of cetacean taxonomy. Two of these have not been formally named

S. a. subspecies A, the off-shore form found in the eastern Pacific
S. a. subspecies B, a form found around the Hawaiian islands.
S. a. graffmani, coastal form found from Mexico to Peru

Physical description

The pantropical spotted dolphin varies significantly in size and colouration throughout its range. The most significant division is between coastal and pelagic varieties. The coastal form is larger and more spotted. (These two forms have been divided into subspecies only in eastern Pacific populations — see taxonomy above).

Spots are key defining characteristics in adults, though immature individuals are generally uniformly coloured and susceptible to confusion with the bottlenose dolphin. Populations around the Gulf of Mexico may be relatively spot-free even in adulthood. In the Atlantic, confusion is possible with the Atlantic spotted dolphin.

Broadly speaking the dolphin has a long thin beak. The upper and lower jaws are darkly coloured but are separated by thin white "lips". The chin, throat and belly are white to pale grey with a limited amount of spots. The flanks are separated into three distinct bands of colour — the lightest at the bottom, followed by a thin grey strip in the middle of the flank and a dark grey back. The tall concave dorsal fin is similarly coloured. The thick tail stock matches the colour of the middle band.

The pantropical spotted dolphin is very active and is prone to making large splashy leaps from the sea. It is a common breacher and will often clear the water for a second or more. Bow-riding and other play with boats is common.

In the eastern Pacific, the Dolphin is often found swimming with yellowfin tuna (hence the problem with dolphin deaths caused by tuna fishing — see the human interaction section). However they do not feed on that fish. In fact the two species have a similar diet of small epipelagic fish. In other areas the species may also feed on squid and crustaceans.

Birth length is 80-90 cm. Adults are about 2.5 m long and weigh 120 kg. Sexual maturity is reached at 10 years in females and 12 years in males. Lifespan is approximately 40 years.

Population and distribution

The pantropical spotted dolphin, as its very name implies, is found across all tropical and sub-tropical waters around the world — roughly speaking all oceans and seas between 40° N and 40° S. The total world population is in excess of three million — the second most abundant cetacean after the bottlenose dolphin — of which two million are found in the eastern Pacific. However, this represents a decrease from at least 7 million since the 1950s.

Centres of highest population density are the shallow warmest waters (water temperature in excess of 25 °C). There is also a tendency for groups to concentrate where there is a high temperature gradient.

Human interaction

Dolphin swimming ahead of the NOAA Ship RUDE

The pantropical spotted dolphin's propensity for associating with yellowfin tuna, particularly in the eastern Pacific has in recent history been a very real danger. In the 1960s and 1970s fishermen would capture thousands of dolphin and tuna at once using purse seine nets. The dolphins all died. Over a period of about 25 years 75% of this region's population, and over half the world's total was wiped out. The issue has received wide public attention. Many major supermarkets have found it economically expedient to use tuna suppliers whose fisherman catch tuna by more discriminatory means, and thus advertise their tuna product as dolphin-friendly. Some such products are approved by the Whale and Dolphin Conservation Trust.

According to a study reported in the October, 2008 issue of Marine Ecology Progress Series, negative impacts from fishing activities remain, despite broad “dolphin safe” practices. Instead of reducing numbers through direct mortalities, the study shows that fishing activities have disrupted the reproductive output of the north-eastern pantropical spotted dolphin. The results showed that fishing had a negative impact on calf survival rates and/or birth rates. This could be caused when fishing operations separate mothers from their suckling calves, interfere with the conception or gestation of calves or a combination of the two.[3]

Conservation

The eastern tropical Pacific and Southeast Asian populations of the pantropical spotted dolphin are listed on Appendix II[4] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As the Pantropical Spotted Dolphin can be divided into three subspecies, studies of these distinct populations would be needed to assess conservation efforts.

In addition, the pantropical spotted dolphin is covered by the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU)and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region(Pacific Cetaceans MoU).

Captivity

The pantropical spotted dolphin is also kept in captivity. Little is known about this species longevity in captivity due to the scarcity of legitimate studies.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300085. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Stenella attenuata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ Dolphin Population Stunted by Fishing Activities Newswise, Retrieved on November 24, 2008.
  4. ^ "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Inshore and offshore stocks may warrant taxonomic separation (Douglas et al. 1984). See Perrin et al. (1987) for taxonomic revision and synonyms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!