Overview

Distribution

Range Description

This species is widespread throughout the island of New Guinea (Indonesia and Papua New Guinea). It is largely absent from the southern lowlands of the island. It has been recorded from sea level up to 1,900 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Feathertail possums can be found in suitable forested habitats, including disturbed forests, throughout New Guinea.

Biogeographic Regions: australian (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The head and body length is 100 to 120mm and the tail length is 123 to 55mm. Adult males weigh about 53 grams, and adult females weigh about 50 grams. Body coloration is dull buff, light brown, to slightly gray in color. The head is streaked with black and white bands that extend from the muzzle to the top of the head. There is a conspicuous black patch just below each ear. The basal part of the tail is well furred, and the remainder is nearly naked. A fringe of stiff hairs outlines the tail in a feather-like pattern hence the name feather-tailed possum. The coat is a soft, thick texture. The claws are sharp and curved and the terminal pads of the digits are not expanded. The eyes are large and the ears are small and naked. The tip of the tail is prehensile. Females have one medially placed teat, and a pouch that opens anteriorly.

Acrobatids differ from other possums in having six pads on their feet instead of five (an adaptation to enhance grip when climbing) and a tail with rows of long stiff hairs along each side, forming a feather-like structure. This is thought of being an adaptation to gliding. Distoechurus pennatus does not have a membrane and cannot glide.

The tongue is 21 mm long. The dorsal surface is covered with a mat of backwardly pointing papillae that is thought to be used as to tool to retrieve nectar and pollen from flowers.

Range mass: 50 to 53 g.

Range length: 100 to 120 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Woolley, P., A. Allison. 1982.
    Observations on the feeding and reproductive status of captive feather-tailed possums, Distoechurus pennatus (Marsupialia: Burramyidae).
    . Australian Mammalogy, 5: 285-287.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is generally found in early regrowth and disturbed tropical moist forest, although it can be found in mature forest habitats. It is fairly resilient to human disturbance, occurring in gardens, but it does require some form of tree cover within its habitat. The average number of pouch young in females is 1.4 young (Flannery 1995).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Feathertail possums are found in areas of disturbed secondary forest, rainforest, scrub forest, and gardens. They also are found in highland rainforest and lower moss forests at altitudes of up to 1,900 meters.

Range elevation: 1,900 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Feathertail possums specialize in high-energy, high-protein foods such as nectar, pollen, and insects. They also feed on soft fruits or exudates such as gums. Most feeding occurs at night, although nursing mothers are sometimes forced to forage during the day to meet the energy demands of lactation. Feathertail possums have a hindgut that is about 10 cm in length and a small intestine of 25 cm long.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; nectar; pollen; flowers; sap or other plant fluids

Primary Diet: carnivore (Insectivore ); herbivore (Nectarivore )

  • Hume, D. 1999. Marsupial Nutrition. New York, New York: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Feathertail possums are pollinators through their nectar-feeding. They may also disperse seeds when they eat fruits.

The number of known bacterial, fungal, and viral diseases infecting possums are minimal but researchers are spending time investigating the affects of Leptospira interrogans, a bacterium and Parastrongyloides trichosuri, a nematode, as potential vectors for biological control.

A disease found in possums only is "Wobbly Possum Disease" (WPD). This disease is characterized by docility, incoordination, loss of balance, and wasting. It also has detrimental affects in body tissue and the brain. WPD can be efficiently transmitted by close contact. Many joeys in direct contact with infected possums contract WPD. Infection may be spread in the wild by several mechanisms, including aggressive encounters in which blood is exchanged, contamination of wounds with urine, ingestion of contaminated food, transfer of mites during den-sharing, and other social encounters. WPD has potential as a biological control agent for possums on the basis that it is readily transmitted between individuals in close contact.

Ecosystem Impact: disperses seeds; pollinates

Commensal/Parasitic Species:

  • Wobbly Possum Disease
  • Bovine Tb

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Feathertail possums are most vulnerable to predators when they are on the ground. The primary terrestrial predators of small possums in Australia are foxes. They may also be preyed on by arboreal snakes and owls.

Known Predators:

  • Cowan, P. 2001. Advances in New Zealand mammalogy 1990-2000: Bushtail possum. Journal of The Royal Society of New Zealand, 31:1: 15-29. Accessed November 29, 2006 at http://animaldiversity.ummz.umich.edu/workspaces/.accounts/item570364710/account_reference_edit_form?reference_ident=1f07da07712653b376aee8b02f0f9a1d.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Not much in known about communication in feathertail possums. In general, possums communicate though vocalizations and urine marking.

Communication Channels: acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

  • Perrott, M., C. Wilks, J. Meers. 2000. Routes of transmission of wobbly possum disease. New Zealand Veterinary Journal, 48:1: 3-8. Accessed November 29, 2006 at http://www.ingentaconnect.com/content/nzva/nzvj/2000/00000048/00000001/art00001.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of feathertail possums. In captivity one lived to 1.5 years. Because they are small possums, it is suggested that they have relatively short generation times.

Range lifespan

Status: captivity:
1.5 (high) years.

Average lifespan

Status: captivity:
1.5 years.

  • Collins, L. 1973. Monotremes and Marsupials. Washington D. C.: Smithsonian Institute Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: One specimen lived about 1.5 years in captivity (Ronald Nowak 1999), and these animals have been known to live for 2 years (Fisher et al. 2001). Without further studies, however, the maximum longevity of this species cannot be correctly estimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating systems in feathertail possums are not well understood. Their close relative, Acrobates pygmaeus, is polygynous.

Reproductive research is lacking for feathertail possums but the related species, Acrobates pygmaeus, reaches sexual maturity at 8 months to one year of age and has two litters per year. Litter size is one or two young and is determined by a number of factors, latitude, altitude, ovulation rate, and the number of teats. They nest in tree holes and females are probably polygynous. Breeding can happen at any time of year in the tropics but births have a seasonal peak in spring.

Breeding interval: Feathertail possums can have up to 2 litters per year.

Breeding season: There is a seasonal peak of births in spring.

Range number of offspring: 1 to 2.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Like other marsupials, feathertail possums gestate and nurse their young until they are weaned. There is little information on other forms of parental investment in feathertail possums.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Low, B. 1978. Environmental Uncertainty and the Parental Strategies of Marsupials and Placentals. The American Naturalist, 112:983: 197-213. Accessed November 28, 2006 at http://www.jstor.org/view/00030147/di006188/00p01817/12?frame=noframe&userID=8fec23ca@uwsp.edu/01cc99331500501b2f3e7&dpi=3&config=jstor.
  • Russell, E. 1982. Parental Investment and Desertion of Young in Marsupials. The American Naturalist, 119:5: 744-748. Accessed November 28, 2006 at http://www.jstor.org/view/00030147/di006234/00p0056f/0?frame=noframe&userID=8fec23ca@uwsp.edu/01cc99331500501b2f3e7&dpi=3&config=jstor.
  • Springer, S., et al. 1989. Rates of single-copy DNA evolution in phalangeriform marsupials. Department of Biology, University of California, Riverside; and University of Wisconsin Zoological Museum, Madison., 4:331: 331-341. Accessed October 04, 2006 at http://mbe.oxfordjournals.org/cgi/reprint/6/4/331.
  • Ward, S. 1998. Number of teats and pre- and post-natal little sizes in small diprotodont marsupials. Journal of Mammology, 79:3: 999-1008. Accessed November 29, 2006 at http://www.jstor.org/view/00222372/ap050320/05a00320/0?frame=noframe&userID=8fec23ca@uwsp.edu/01cc99332400501b25dd3&dpi=3&config=jstor.
  • Woolley, P., A. Allison. 1982.
    Observations on the feeding and reproductive status of captive feather-tailed possums, Distoechurus pennatus (Marsupialia: Burramyidae).
    . Australian Mammalogy, 5: 285-287.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Distoechurus pennatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0031-06|AB241052|Distoechurus pennatus| AATCGCTGACTATTCTCTACCAATCATAAAGATATTGGAACCTTATACCTCTTATTTGGAGCTTGAGCAGGAATAGTAGGAACTGCCCTA---AGCCTCTTAATCCGAGCAGAACTCGGTCAACCCGGCACTTTAATCGGCGAT---GACCAAATCTACAATGTAATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATACCAATTATAATTGGAGGTTTTGGTAACTGATTAGTTCCTTTAATG---ATTGGAGCCCCAGACATAGCATTTCCTCGTATAAACAACATAAGCTTTTGACTCCTTCCTCCATCCTTCCTTCTACTCCTAGCGTCTTCTACTGTCGAAGCTGGAGCAGGAACAGGATGAACTGTATATCCTCCATTAGCTGGCAATTTAGCCCATGCAGGAGCCTCAGTAGATTTA---GCAATCTTTTCTCTCCATTTAGCAGGCATCTCCTCAATCCTAGGAGCTATTAACTTTATCACGACCATCATCAATATAAAACCCCCAGCATTATCCCAATATCAAACCCCCTTATTTGTCTGATCAGTAATAATCACAGCAGTCCTTCTTCTACTTTCACTTCCTGTCTTAGCCGCA---GGAATTACTATACTGCTTACAGACCGAAACCTAAATACTACATTCTTTGACCCCGCAGGAGGAGGAGACCCAATTCTTTATCAACATCTATTTTGATTTTTTGGCCATCCCGAAGTCTACATTCTAATCCTCCCAGGATTTGGTATTATTTCTCACATTGTCACATACTACTCAGGAAAAAAA---GAACCCTTCGGCTACATAGGTATAGTATGAGCCATAATATCCATTGGCTTCCTAGGCTTTATTGTTTGAGCTCATCACATATTTACTGTAGGCCTCG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Distoechurus pennatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Leary, T., Seri, L., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., Aplin, K., Dickman, C., Salas, L. & Flannery, T.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, tolerance to some degree of habitat modification, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Feathertail possums are common in suitable habitats, though detailed population information is not available. These possums are on the IUCN Red List of Threatened Species and are considered low risk/least concern.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a locally abundant species in parts of its range. It appears to be more abundant in the southern part of its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Feathertail possums can be considered pests when active in urban settings. Control methods like poisons and toxins are sometimes used to reduce problem possums. An emerging problem with these eradication methods is that the materials are being sent throughout the food web affecting many species who will prey upon a possum carcass. More research needs to be done on better methods of control, such as fertility control, traps, and behavior changes. Ferrets are becoming a problem because they are carriers of Bovine Tb which can be transmitted to possums. The transmission of this disease to livestock is of major economic concern in Australia and New Zealand.

Negative Impacts: causes or carries domestic animal disease ; household pest

  • Innes, J., G. Barker. 1999. Ecological consequences of tozin use for mammalian pest control in New Zealand- an overview. New Zealand journal of Ecology, 23:2: 111-127. Accessed November 29, 2006 at http://www.nzes.org.nz/nzje/free_issues/NZJEcol23_2_111.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The feather-tail possum is an active part of New Guinea’s indigenous people diet. They are hunted at night in the months of June, July, and August.

The Wola people of New Guinea's Highlands use the prized tails of posssums such as the Feather-tailed to create elaborate headress for cerimonies.

Positive Impacts: food ; body parts are source of valuable material

  • Sillitoe, P. 1988. From head-dresses to head-messages: the art of self-decoration in the highland of Papua New Guinea. Royal Anthropological Institue of Great Britain and Ireland, 23: 298-318. Accessed December 01, 2006 at http://www.jstor.org/view/00251496/dm993947/99p0128p/0?frame=noframe&userID=8fec23ca@uwsp.edu/01cce4406600501b33bd6&dpi=3&config=jstor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Feather-tailed Possum

The feather-tailed possum (Distoechurus pennatus) is a species of marsupial in the Acrobatidae family. It is found in West Papua, Indonesia and Papua New Guinea.[2]

It is the only species in the genus Distoechurus.[1]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 56. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b Leary, T., Seri, L., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., Aplin, K., Dickman, C., Salas, L. & Flannery, T. (2008). Distoechurus pennatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!