Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

This largely nocturnal marsupial feeds primarily on a variety of insects and other invertebrates as it forages in trees and bushes (5), but will consumes fruit. Research suggests that the monito del monte may disperse the seeds of 80 percent of the surrounding plants that have fleshy fruits (6), as the seeds pass through the monito's gut undamaged, and thus this small animal plays a vital role in the temperate forests it inhabits (4). Additionally, it is the sole seed disperser of the mistletoe Tristerix corymbosus; the seeds of this mistletoe must pass through the gut of the marsupial for germination to take place and for the development of a 'holdfast', which enables the plant to adhere to a host tree (6). The future of the mistletoe is therefore intrinsically linked to that of the monito del monte. Monito del montes reportedly live in pairs, at least during the breeding season (2). The monito mates in late winter to early spring, and females give birth in early November (7). The size of the litter is limited by the number of teats, and so the average litter size is two to four. The young remain in the pouch, firmly affixed to the mother's teats for the first two months of life. From late December, the young will begin to leave the pouch for short exploratory excursions, which gradually increase in frequency and duration, whilst continuing to suckle from the mother. Eventually, juveniles accompany the mother on night time foraging trips, and by the end of March, they range free from their mother (7). Monito del montes become sexually mature in their second year (2). In the harsh environment in which they live, the monito del monte requires a number of adaptations to the cold. Its dense fur and small, well-furred ears prevent heat loss (2) (3), and they sleep in nests constructed under the shelter of overhanging rocks, fallen tree trunks or amongst the roots of trees. The nests are constructed from water repellent leaves and are often covered with protective and warm moss. During winter when temperatures drop further and food is scarce, the monito del monte enters hibernation. Before hibernation, the base of the tail swells with an accumulation of fat, and the heart rate drops from 230 beats per minute to less than 30 per minute (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The monito del monte, or 'monkey of the mountains', is not a monkey, but a South American marsupial, which has often been called a 'living fossil' due to it being the only living member of an otherwise extinct order, the Microbiotheria (3). In appearance it looks similar to a large mouse, with silky, short, dense fur that is fawn-grey on the upperparts and dirty yellowish-white underneath. The pale grey face has distinct black rings around the eyes, and the crown and nape of the neck are shaded cinnamon. The ears of the monito del monte are short, rounded and covered with short hair, and its robust limbs relate to its slow, ponderous movements. The tail, which is thick at the base and tapers to a tip, is thickly furred with fawn-coloured fur at the base, turning to straighter dark brown fur towards the tip (2). Females are, on average, significantly longer and heavier than males (4), and like most other marsupials, females can also be distinguished by their distinct abdominal pouch with four mammae, in which the tiny young will develop and grow (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Only found in southern and central Chile, to the south of Concepcion and on the island of Chiloe, and adjacent Argentina. It was recently captured in Argentina in Lake Nahuel Huapi National Park (Birney et al., in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dromiciops gliroides (monito del monte) is found in southern South America, specifically the northern portions of Patagonia, between 36 and 43 degrees South latitude. In addition to mainland South America, it is found on Chiloe Island.

Biogeographic Regions: neotropical (Native )

  • Patterson, B., M. Rogers. 2007. Order Microbiotheria Ameghino, 1889. Pp. 117-119 in A Gardner, ed. Mammals of South America, Vol. Volume I: Marsupials, Xenarthrans, Shrews, and Bats. Chicago, IL: The University of Chicago Press.
  • Rodriguez-Cabal, M., G. Amico, A. Novaro, M. Aizen. 2008. Population characteristics of Dromiciops gliroides (Philippi, 1893), an endemic marsupial of the temperate forest of Patagonia. Mammalian Biology, 73: 74-76.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in south-central Chile, from Concepción south to Chiloé Island, and east to the mountains slightly beyond the Argentine border (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Monitos del monte are small, mouse-like marsupials. Body length (excluding the tail) is between 83 and 130 mm; the tail is between 90 and 132 mm long. This species weighs between 16 and 42 g.

They are superficially mouse-like, with a short rostrum and small, rounded ears. The pelage is short and dense. While the majority of the body is brown to gray in color, white patches can be found on the shoulders and rump. Ventral pelage is lighter in color than dorsal pelage, and ranges from yellowish white to pale gray. Although a whorling pattern is sometimes visible, the most distinct pelage characteristic is the pronounced black eye rings. The tail is moderately prehensile and well-furred, except for a 25 to 30 mm naked underside portion which may improve traction when the animal grasps tree branches.

This species resembles Marmosa species, but possesses shorter limbs, more robust hands and feet, more semicircular upper incisors, and smaller, furrier ears.

Seasonal variation and sexual dimorphism has been observed in Dromiciops gliroides. A study of monitos del monte in Patagonia found that, by the end of summer, females are significantly heavier and longer than males. Although both sexes use their tails are storage organs, females tend to have thicker tails; this suggests that females have higher energy needs during times of hibernation or torpor. While variation in tail thickness is seasonal, it is unclear if females are larger than males year-round.

Geographic variation has also been reported in this species. Previously, two subspecies were recognized based on geography. Mainland monitos del monte were referred to Dromiciops australis australis and those from Chiloe Island were referred to Dromiciops australis gliroides. However, the only noticeable difference in appearance between these types is that island monitos del monte have darker pelage. Due to insufficient distinguishing characters between mainland and island populations, separate subspecies are no longer recognized as distinct.

Range mass: 16 to 42 g.

Range length: 83 to 130 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Beer, A. 2003. Microbiotheria: monitos del monte (Microbiotheriidae). Pp. 273-275 in M Hutchins, D Kleiman, V Geist, M McDale, eds. Grzimek's Animal Life Encyclopedia, Vol. 12, Mammals I. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Dromiciops gliroides live in the cool, humid forests of the Chilean Andes where they inhabit thickets of Chilean Bamboo (Chusquea sp.). This nocturnal, arboreal mammal construct spherical nests of water-repellant bamboo leaves lined with moss or grass. Nests probably serve to protect the animals from the cold, but when temperatures drop during the winter and food becomes scarce, Dromiciops gliroides will hibernate. Feeds primarily on larvae and pupae of insect.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Dromiciops gliroides is found in temperate forests and rainforests. It is mainly found in old-growth Nothofagus forests, but can be found in a variety of habitats ranging from dense thickets of bamboo (Chusquea spp.) to open, secondary forests.

A study of small mammals at elevations from 425 to 1135 m above sea level in Chile found that Dromiciops gliroides was captured more often at higher elevations (between 820 and 1135 m) than at lower elevations (425 to 715 m).

Range elevation: 425 to 1135 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Patterson, B., P. Meserve, B. Lang. 1989. Distribution and abundance of small mammals along an elevational transect in temperate rainforests of Chile. Journal of Mammalogy, 70(1): 67-78.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The monito del monte inhabits dense, cool, humid forests, where it favours thickets of Chilean bamboo (Chusquea species) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Monitos del monte are primarily insectivorous, eating insects, larvae, and pupae found on tree branches and in crevices in bark. Moths and butterflies (Lepidoptera) also make up a large part of their diet. During the austral summer, monitos del monte consume large quantities of mistletoe (Tristerix corymbosus) fruits and other fleshy fruits.

In captivity, monitos del monte eat a wide variety of food, including fruits, vegetables, potatoes, oats, invertebrates, vertebrates, meat, fish, eggs, and cheese.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit

Primary Diet: carnivore (Insectivore )

  • Amico, G., M. Rodriguez-Cabal, M. Aizen. 2009. The potential key seed-dispersing role of the arboreal marsupial Dromiciops gliroides . Acta Oecologica, 35: 8-13.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

In the temperate forests of Patagonia, Dromiciops gliroides is the sole seed dispersal agent of the mistletoe Tristerix corymbosus. The seeds pass undamaged through the digestive tract and are deposited directly onto the bark of host trees. In fact, passage though the gut of D. gliroides is necessary for the seeds to germinate and important for seedling recruitment. This mutualism may have evolved over the last 70 million years, and remains important for biodiversity today. Field observations and captivity studies also found that D. gliroides is capable of dispersing the seeds of the majority of fleshy fruit-producing plant species in the region, including Aristotelia chilensis and Azara microphylla; other small mammals destroy the seeds they consume from these plant species. Mistletoe, a parasitic climbing plant species, is important for maintaining understory plant diversity and facilitating ecosystem processes such as nutrient cycling. Additionally, nearly 100 families of birds and mammals rely on mistletoe for fruit, nectar, and nesting material. Disruption of the mistletoe-monito del monte mutualism could cause extinctions, decreased biodiversity, and increased community susceptibility to drought.

Ecosystem Impact: disperses seeds; keystone species

Mutualist Species:

Commensal/Parasitic Species:

  • Garcia, D., M. Rodriquez-Cabal, G. Amico. 2009. Seed dispersal by a frugivorous marsupial shapes the spatial scale of a mistletoe population. Journal of Ecology, 97: 217-229.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of Dromiciops gliroides include native and introduced birds and mammals, particularly domestic cats (Felis catus). Studies have estimated that monitos del monte make up 10% of the diet of gray foxes (Lycalopex griseus), 3.6% of the diet of Darwin's foxes (Pseudalopex fulvipes), and a small portion of the diet of barn owls (Tyto alba). Monitos del monte produce strong smelling secretions from cutaneous glands, which may deter predators. They also exhibit a threat posture with teeth exposed, particularly if aroused from torpor.

Known Predators:

Anti-predator Adaptations: cryptic

  • Jaksic, F., J. Jimenez, R. Medel, P. Marquet. 1990. Habitat and diet of Darwin's fox (Pseudalopex fulvipes) on the Chilean mainland. Journal of Mammalogy, 71(2): 246-248.
  • Rau, J., D. Martinez, J. Low, M. Tilleria. 1995. Predation by gray foxes (Lycalopex griseus) on cursorial, scansorial, and arboreal small mammals in a protected wildlife area of southern Chile. Revista Chilena de Historia Natural, 68(3): 333-340.
  • Trejo, A., V. Ojeda. 2004. Diet of barn owls (Tyto alba) in forested habitats of northwestern Argentine Patagonia. Ornitologia Neotropical, 15(3): 307-311.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Monitos del monte communicate via sound. At night they produce trilling calls that end in a coughing noise as well as buzzing noises. Other modes of communication are not known. Similarly, although males and females form pairs during the breeding season, population and social structure during other times of the year are unknown.

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although the lifespan of Dromiciops gliroides in the wild is unknown, the longest lifespan in captivity is 26 months.

Range lifespan

Status: captivity:
26 (high) months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals but they live at least 3 years, probably longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Monitos del monte become sexually mature after their second year and breed in the austral spring (August to September). Breeding pairs form shortly beforehand. They are not known whether these pairs persist after mating.

Mating System: monogamous

Monitos del monte typically reach sexual maturity at age 2 and breed once yearly. Males and females form pairs and mate in August or September. Before parturition occurs, females construct small, rounded nests (about 200 mm in diameter) from sticks and water-repellent bamboo. These nests are located 1 to 2 m above the ground. Young are born approximately 3 to 4 weeks after conception and climb into the well-developed, anteroventral opening of the marsupium, where they remain attached to one of the four teats for approximately 2 months. Litters of up to 5 young have been reported, but females are unable to feed more than 4 offspring at a time. Although the young begin to exit the marsupium for short durations beginning in December, they do not become completely independent until March.

Breeding interval: Monitos del monte breed once yearly.

Breeding season: Monitos del monte breed in the austral spring (August to September).

Range number of offspring: 1 to 5.

Range gestation period: 3 to 4 weeks.

Average weaning age: 5 months.

Average time to independence: 5 months.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 3.

Female monitos del monte suckle their altricial young for approximately 5 months (from early November to late March). Prior to the independence of offspring, females carry them in the marsupia or on their backs during "nocturnal family excursions."

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Munoz-Pedreros, A., B. Lang, M. Bretos, P. Meserve. 2005. Reproduction and development of Dromiciops gliroides (Marsupialia: Microbiotheriidae) in temperate rainforests of southern Chile. Gayana (Concepcion), 69(2): 225-233.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dromiciops gliroides

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0615-06|NC_005826|Dromiciops gliroides| AACCGTTGACTATTCTCAACAAACCATAAAGATATTGGCACCCTTTACTTACTATTTGGTGCTTGAGCAGGAATAGTTGGTACAGCTCTA---AGCCTATTAATCCGAGCTGAGCTTGGCCAACCTGGAACCCTGATTGGGGAT---GATCAGATTTATAATGTAATTGTTACCGCTCACGCATTTGTCATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGGTTTGGCAACTGACTAGTTCCTCTAATA---ATTGGAGCACCTGACATAGCTTTCCCTCGCATAAACAATATAAGCTTCTGATTATTACCCCCTTCATTCCTCCTATTGCTTGCATCATCTACAGTTGAAGCCGGGGCTGGAACCGGATGAACAGTCTATCCTCCTCTGGCTGGCAATTTAGCCCACGCAGGAGCCTCCGTGGACCTT---GCCATTTTTTCACTTCACCTTGCAGGAATTTCATCTATTCTAGGAGCTATTAATTTCATTACAACCATTATTAATATGAAACCACCAGCTATATCTCAATATCAAACTCCACTATTTGTCTGATCAGTAATAATCACGGCAGTTCTTCTCCTTCTATCCCTCCCAGTTCTAGCTGCA---GGAATTACTATATTACTTACAGATCGCAACCTAAATACGACATTCTTTGATCCAGCAGGTGGAGGAGACCCAATCTTGTATCAACATCTCTTCTGATTCTTTGGCCACCCTGAAGTATACATTCTTATTCTTCCAGGTTTCGGTATTATTTCACACATTGTAACTTACTACTCTGGCAAAAAA---GAACCATTCGGTTATATAGGAATAGTATGAGCAATAATGTCCATTGGATTCCTAGGCTTCATTGTATGAGCCCACCACATGTTTACAGTAGGACTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dromiciops gliroides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Diaz M. & Teta, P.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is considered to be Near Threatened in light of an ongoing population decline inferred from habitat conversion to agriculture and from logging activities. Almost qualifies as threatened under criterion A. Further information is needed on the distribution, area of occupancy and effects of the numerous threats on populations of this species, as it may be more threatened than currently suspected. This species is restricted to a habitat type which is being exploited and should be monitored.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although currently classified as near threatened on the IUCN Red List, Dromiciops gliroides is threatened by an increasing number of anthropogenic activities. The introduction of species such as domestic cats (Felis catus), deforestation, and cattle grazing are associated with decreased abundances of monitos del monte and habitat fragmentation. A study of forest fragmentation found that human activity can reduce preferred tree types and increase susceptibility to predation. Monitos del monte, like many small mammals, are unable to cross even small deforested areas. Monitos del monte are also hosts to blood parasites (Hepatozoon) and ticks (Ixodes neuquenensis), which can further reduce the numbers of these important marsupials.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

  • Marin-Vial, P., D. Gonzalez-Acuna, J. Celis-Diez, P. Cattan, A. Guglielmone. 2007. Presence of Ixodes neuquenensis Ringuelet, 1947 (Acari: Ixodidae) on the endangered Neotropical marsupial monito del monte (Dromiciops gliroides Thomas, 1894, Microbiotheria: Microbiotheriidae) at Chiloe Island, Chile. European Journal of Wildlife Research, 53: 73-75.
  • Merino, S., R. Vasquez, J. Martinez, J. Celis-Diez, L. Gutierrez-Jimenez, S. Ippi, I. Sanchez-Monsalvez, J. Martinez-de la Puente. 2009. Molecular characterization of an ancient Hepatozoon species parasitizing the "living fossil" marsupial "monito del monte" Dromiciops gliroides from Chile. Biological Journal of the Linnean Society, 98: 568-576.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Its population has declined over recent years. Currently, D. gliroides has been catalogued as a rare species in Chile,
due to its reduced population size. Furthermore, the high degree of fragmentation in the Maulino forest, allows to suppose that the local population of Dromiciops as well as that of the Reserva Los Ruiles and Los Queules could be in danger of extinction.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened by a loss of restricted habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Over recent years, the monito del monte population has declined, probably due to the loss of its already limited habitat (1). The forests of south-central Chile face severe pressure from human activities and development. For many years, forests have been cut for timber and fuelwood, and since the 1970s, large swathes of forest have been cleared for pine and eucalyptus plantations. Urbanisation, in the form of tourism developments and the construction of highways and hydroelectric complexes, also impacts the natural habitat in this region (8). The presence of the introduced murine rat (Rattus norvegicus) in some areas is also worrying (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in several protected areas. More research is necessary to determine the impact of the numerous possible threats to populations - especially logging and agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The monito del monte occurs in at least two protected areas, the Reserva Nacional Los Ruiles (9) and the Valdivian Coastal Range Reserve, Chile. The Valdivian Coastal Range Reserve was created in 2005 by The Nature Conservancy, WWF, Conservation International and local conservation organisations, and protects 12 percent of the rare temperate rainforest of the region (10) (8), offering important protection for the habitat of the monito del monte. In addition, scientists on the island of Chiloé are researching the ecology and natural history of this species (11); such information is required to inform future conservation actions, and will hopefully ensure the survival of this fascinating 'living fossil'.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In Chile, there are several superstitions about Dromiciops gliroides. For example, monitos del monte are erroneously described as bad luck, venomous, and causes of disease. In extreme cases, people have burned their houses down after seeing monitos del monte in their places of residence. However, monitos del monte have no negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Monitos del monte play a key role in seed dispersal for fleshy fruit-producing plants in temperate forests; these mutualisms are important for the maintenance of biodiversity. Monitos del monte may also be important for reducing insect pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Monito del monte

The monito del monte (Spanish for "little mountain monkey"), Dromiciops gliroides, also called chumaihuén in mapudungun is a diminutive marsupial native only to southwestern South America (Chile and Argentina). It is the only extant species in the ancient order Microbiotheria, and the sole New World representative of the superorder Australidelphia (all other New World marsupials are members of Ameridelphia). The species is nocturnal and arboreal, and lives in thickets of Chilean bamboo in the Valdivian temperate rain forests of the southern Andes,[2] aided by its partially prehensile tail.[3] It eats primarily insects and other small invertebrates, supplemented with fruit.[3]

Contents

Phylogeny and biogeography

It has long been suspected that South American marsupials were ancestral to those of Australia, consistent with the fact that the two continents were connected via Antarctica in the early Cenozoic. Australia’s earliest known marsupial is Djarthia, a primitive mouse-like animal that lived about 55 million years ago. Djarthia had been identified as the earliest known australidelphian, and this research suggested that the monito del monte was the last of a clade which included Djarthia.[4] This implied that the ancestors of the Monito del Monte might have reached South America via a back-migration from Australia. The time of divergence between the Monito del Monte and Australian marsupials was estimated to have been 46 million years ago.[3] However, in 2010, analysis of retrotransposon insertion sites in the nuclear DNA of a variety of marsupials, while confirming the placement of the Monito del Monte in Australidelphia, showed that its lineage is the most basal of that superorder. The study also confirmed that the most basal of all marsupial orders are the other two South American lineages (Didelphimorphia and Paucituberculata, with the former probably branching first). This indicates that Australidelphia arose in South America (along with the ancestors of all other living marsupials), and probably reached Australia in a single dispersal event after Microbiotheria split off.[5][6][7]

An artistic rendering of the Monito del Monte

Size

Body length is 11–12.5 cm. Tail length is 9–10 cm.[citation needed]

Reproduction

The monito del monte normally reproduces in the spring and can have a litter size varying anywhere from one to four young. The females have a pseudovagina, and a fur-lined pouch containing four mammae. When the young are mature enough to leave the pouch they are nursed in a nest, and then carried on the mother’s back. The young remain in association with the mother after weaning. Males and females both reach sexual maturity after 2 years.[1][8][9][10]

Habitat

Monitos del monte mainly live in trees, where they construct spherical nests of water resistant bamboo leaves. These leaves are then lined with moss or grass, and placed in well protected areas of the tree. The nests are sometimes covered with grey moss as a form of camouflage. These nests provide the monito del monte with some protection from the cold, both when it is active and when it hibernates. It stores fat in the base of its tail for winter hibernation. It lives in the dense, humid forests of highland Chile and Argentina.[11][12][13]

Role as a seed disperser

A study performed in the temperate forests of southern Argentina showed a mutualistic seed dispersal relationship between D. gliroides and Tristerix corymbosus, also known as the Loranthacous mistletoe. The monito del monte is the single dispersal agent for this plant, and without it the plant would go extinct. The monito del monte eats the fruit of T. corymbosus, and thus disperses the seeds. Scientists speculate that the coevolution of these two species could have begun 60–70 million years ago.[14][15]

References

  1. ^ a b Gardner, Alfred L. (16 November 2005). "Order Microbiotheria (p. 21)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10600004. 
  2. ^ a b Diaz, M. & Teta, P. (2008). Dromiciops gliroides. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as near threatened
  3. ^ a b c "Monito del monte (Dromiciops gliroides)". EDGE of Existence programme. Zoological Society of London. 2006-08-09. http://www.edgeofexistence.org/mammals/species_info.php?id=42. Retrieved 2009-07-05. 
  4. ^ Beck, Robin M. D.; Godthelp, Henk; Weisbecker, Vera; Archer, Michael; Hand, Suzanne J. (2008-03-26). Hawks, John. ed. "Australia's Oldest Marsupial Fossils and their Biogeographical Implications". PLoS ONE (Public Library of Science) 3 (3): e1858. doi:10.1371/journal.pone.0001858. PMC 2267999. PMID 18365013. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2267999. Retrieved 2009-07-08. 
  5. ^ Schiewe, Jessie (2010-07-28). "Australia's marsupials originated in what is now South America, study says". LATimes.Com. Los Angeles Times. http://www.latimes.com/news/science/la-sci-marsupial-20100728,0,5549873.story. Retrieved 2010-08-01. 
  6. ^ Inman, M. (2010-07-27). "Jumping Genes Reveal Kangaroos' Origins". PLoS Biology (Public Library of Science) 8 (7): e1000437. doi:10.1371/journal.pbio.1000437. PMC 2910652. PMID 20668663. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2910652. 
  7. ^ Nilsson, M. A.; Churakov, G.;, Sommer, M.; Van Tran, N.; Zemann, A.; Brosius, J.; Schmitz, J. (2010-07-27). Penny, David. ed. "Tracking Marsupial Evolution Using Archaic Genomic Retroposon Insertions". PLoS Biology (Public Library of Science) 8 (7): e1000436. doi:10.1371/journal.pbio.1000436. PMC 2910653. PMID 20668664. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2910653. 
  8. ^ Spotorno, Angel E.; Marin, Juan C.; Yevenes, Marco; Walker, Laura I.; Donoso, Raul Fernandez; Pinchiera, Juana; Barrios, M. Soleda; Palma, R. Eduardo (December 1997). "Chromosome Divergences Among American Marsupials and the Australian Affinities of the American Dromiciops". Journal of Mammalian Evolution (Springer) 4 (4): 259–269. doi:10.1023/A:1027374514503. http://www.springerlink.com/content/kn01971285l48143/. Retrieved 2009-07-09. 
  9. ^ Brugni, Norma; Flores, Veronica R. (September 2007). "Allassogonoporus dromiciops n. sp. (Digenea: Allassogonoporidae) from Dromiciops gliroides (Marsupialia: Microbiotheriidae) in Patagonia, Argentina". Systematic Parasitology (Springer) 68 (1): 45–48. doi:10.1007/s11230-006-9083-1. PMID 17401634. http://www.springerlink.com/content/k74417081j2713m1/. Retrieved 2009-07-10. 
  10. ^ Lidicker, Jr., William Z., Michael T. Ghiselin (1996). Biology. Menlo Park, California: The Benjamin/Cummings Publishing Company. 
  11. ^ Macdonald, David (1995). Encyclopedia of Mammals. New York City: Facts on File. 
  12. ^ Nowak, Ronald M., Chris R. Dickman (2005). Walker's Marsupials of the World‎. JHU Press. 
  13. ^ Lord, Rexford D. (2007). Mammals of South America. JHU Press. 
  14. ^ Garcia, Daniel; Rodríguez-Cabal, Mariano A.; Amico, Guillermo C. (March 2009). "Seed dispersal by a frugivorous marsupial shapes the spatial scale of a mistletoe population". Journal of Ecology (British Ecological Society) 97 (2): 217–229. doi:10.1111/j.1365-2745.2008.01470.x. http://www3.interscience.wiley.com/journal/121637721/abstract. Retrieved 2009-07-10. 
  15. ^ Amico, Guillermo C.; Rodriguez-Cabal, Mariano A.; Aizen, Marcelo A. (January–February 2009). "The potential key seed-dispersing role of the arboreal marsupial Dromiciops gliroides". Acta Oecologica (Elsevier) 35 (1): 8–13. doi:10.1016/j.actao.2008.07.003. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!