Overview

Brief Summary

Taxonomy

Most of the common names like sloth or perezoso, as well as its scientific name “Bradypus” from the Greek for slow feet, refer to the monotony of the movements and sluggishness of the members of this family (Cabrera, 1940).

Morphology
The head is round, hardly differentiated from the remarkably long and mobile neck. The body is thick-set, short, and with great mobility of the vertebral column; the arms are slender and very long, a full third longer than the legs; the tail is short and stubby.The whole animal is covered with long coarse but soft and silky hair, which serves as a thatch in rain and with the dense under fur, as a real protection against the attack of many foes. The general colour of this species is grizzled drab, with irregular patches of dirty white on the dorsal surface. The males are highly coloured for mammals, having bright orange ear patches and a rounded spot of the same colour in the middle of the back.Very rarely an adult female sloth will have dull orange ear patches, but never the brilliant back marking (Beebe,1926).The pale-throated sloth can be distinguished from other species of sloth by its paler throat (white or yellowish buff) in combination with the pale forehead and the lack of dark facial marks (Gardner, 2007).The neck contains nine cervical vertebrae.The forelimbs are slightly longer than the hind limbs and each forefoot has three long claws.The sloth’s digits are bound together with gristle and flesh so the claws are fairly immoveable; the strong sharp claws are almost semicircular, measuring up to about 7.5 cm (Merret, 1983).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Size
Head and body length averages 50-60 cm and tail length 5 to 6 cm.Bradypus have a body weight of 4 - 4.5 kg (Merret, 1983).

Reproduction
Reproduction is thought to occur throughout the year, with one young born annually, following a gestation period of 4 to 6 months (Hayssen et al., 1993). Most births occur at the beginning of the dry season from late July to September in northern Guyana (Beebe, 1926).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Bradypus tridactylus the pale throated three-toed sloth sleep or rest for about 20 hours a day. Three-toed sloths inhabit forests and spend practically their entire life in the trees, where they hang beneath the limbs or sit in a fork.Sloths are beautifully adapted to arboreal life. Their movements are slow and deliberate as they select the boughs to cling to with great care and safety.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

B. tridactylus occurs in the Guyana Shield region, from Venezuela south of the Orinoco (although its distribution crosses at the delta region) into northern Brazil (south to the Amazonas/Solimões), through to Guyana, Suriname and French Guiana. It does not occur south of the Amazon river.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The three-toed sloth inhabits tropical rain forests from southern Central America to north-eastern Argentina (  http://www.ed.final.gov/linc/spring96/projects/rainforest/rainhtual1996).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Habitat
Three-toed sloths inhabit forests and spend practically their entire life in the trees, where they hang beneath the limbs or sit in a fork (Nowak,1999).The species is almost exclusively arboreal, but also swims well. The sloth is capable of moving distances of several miles, travel that may require moving over ground and swimming across rivers (Gardner, 2007).

Distribution
This species occurs in the Guyana Shield region, from Venezuela south of the Orinoco (although its distribution crosses at the delta region) into northern Brazil (south to the Amazonas/Solimões), through to Guyana, Suriname and French Guiana. The species has also been found in eastern Colombia by the department of Caquetá (IUCN).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bradypus tridactylus is a strange animal. It has almost no tail or external ears, and its head is slightly rounded with a blunt nose. The body is covered with long and course hair. Very small green algae sometimes live mutualistically in the pits of the hair, which gives the sloth an overall greenish appearance that camouflouges it in the forest canopy. Male sloths have a bright yellow or orange patch on the back. The females have two mammae in the chest region. The three-toed sloth is armed with long, compressed, arched, hollowed claws, of which the middle claw is the largest. Bradypus tridactylus grows to a length of between 1.5 and 2.5 ft. The limbs are long and weak, with anterior extremities that are nearly double the length of the posterior. The three-toed sloth has 9 neck vertebrate, which grant it extreme flexibility (Cuvier).

Range mass: 2.25 to 5.5 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bradypus tridactylus is found in lowland and montane tropical moist forest. It has been recorded on tepuis (table-top mountains). Adult sloths are dark coloured with black spots on shoulders, back and haunches. The head and throat are yellow. Males can be distinguished from females by their dorsal orange-yellow patch with a broad black central line (Hayssen 2009). Both males and females reach reproductive age at three to six years. A single young is born after a gestation of six months (Taube et al. 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The three-toed sloth lives high in the canopy of tropical rainforests (www.hillside.sowashco/95-96/palmquist/rainforest/rainhtual).

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The three-toed sloth is herbivorous. It feeds exclusively on twigs, buds, and leaves of trees of the genus Cecropia. Because of its limited diet, the species does not do well in captivity (  http://www.geocites.com/Hollwood/set/1478/Sloth.html , 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Movement
Sloths sleep or rest for about 20 hours a day (Beebe, 1926). The three-toed sloth is mainly active during the day but can be active at night (Sunquist and Montgomery, 1973)Sloths are beautifully adapted to arboreal life. Their movements are slow and deliberate as they select the boughs to cling to with great care and safety. The species is almost exclusively arboreal, but does move over ground and also swims well. The sloth is capable of moving distances of several miles, travel that may require moving across ground and swimming rivers (Gardner, 2007).It is a mistaken idea that sloths spend all of their lives upside-down. When travelling and feeding, they do hang suspended, but quite as often they are climbing or clinging on vertical stems, or actually sitting down, as when asleep (Beebe, 1926).

Sociability
With the exception of mother-young pairs, Bradypus tridactylus are usually solitary and exhibit aggressive behaviour when confined together in captivity (Gardner, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: There are no detailed studies of longevity in this species but it has been estimated they live up to 40 years in the wild (Bernhard Grzimek 1990). These animals are difficult to breed in captivity (Ronald Nowak 1999), and hence their maximum longevity must b classified as unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Bradypus tridactylus mates high in the safety of the trees. After birth the males do not display any parental care. It gives birth to a single, very small young, usually in the beginning of the dry season, March - April. Gestation typically lasts 5-6 months. After birth, the offspring enjoys belly-to-belly nurturing for six months. At four months, it can begin to feed on foliage, having first sampled it at two weeks of age from its mother's lips. Sloths inherit not only their mother's preference for particular kinds of leaves but also the specialized gut flora to digest them. When a young sloth has mastered the rudiments of arboreal life, its mother simply departs, leaving it to its life in the tropical canopy (World Book,1996; www.press.jhu.edu/books/walker/).

Average gestation period: 141 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1642 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolution

Armadillos, anteaters and sloths are grouped into five families within the mammalian order Xenarthra. The xenarthran time tree shows that armadillos diverged from anteaters and sloths c.70 million years ago (Ma), anteaters and sloths diverging later around c.60 Ma. Molecular dating also reveals that the two living genera of sloths diverged c.20 Ma. Molecular dates suggest that the palaeonvironmental changes that occurred during the Cenozoic(66-0 Ma) in South America have influenced the evolutionary history of the Xenarthra (Delsuc & Douzery, 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bradypus tridactylus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0640-06|NC_006923|Bradypus tridactylus| ACCCGCTGACTATTCTCAACAAACCACAAGGACATCGGAACCTTGTACTTGTTATTTGGCGCCTGAGCCGGAGTAGTAGGCACTGCCTTA---AGCCTACTGATTCGAGCCGAACTGGGACAACCAGGAACCCTGCTAGGCGAC---GATCAAATTTATAATGTTATTGTTACCTCACACGCATTCATCATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGCTTCGGAAACTGACTAATCCCTCTGATA---ATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGTTTCTGATTGTTACCCCCGTCATTTTTACTCCTGCTAGCCTCCTCCATAGTAGAAGCAGGTGCAGGCACGGGCTGAACCGTGTACCCACCCCTAGCAGGCAACCTAGCTCATGCAGGTGCATCAGTCGACTTA---ACTATCTTCTCTCTGCACCTGGCAGGAATCTCATCAATTCTAGGTGCTATTAACTTTATTACCACCATCATTAACATAAAACCCCCTGCTATATCTCAATACCAAACCCCTCTATTTGTTTGATCTGTGCTAGTAACGGCAATCCTCCTCCTCCTCTCACTCCCGGTCCTGGCCGCC---GGAATCACCATACTCCTAACAGACCGCAACCTGAATACCACATTCTTTGACCCTACCGGAGGAGGGGACCCCATTCTATATCAACATCTATTCTGATTCTTCGGACACCCTGAAGTATATATTCTCATCCTGCCAGGCTTCGGCATGATCTCACATATTGTCACATACTACTCCGGGAAAAAA---GAACCCTTTGGCTACATGGGTATAGTATGGGCTATGGTATCAATCGGGTTCTTAGGCTTCATCGTCTGAGCCCATCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bradypus tridactylus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Chiarello, A. and Moraes-Barros, N.

Reviewer/s
Abba, A.M. & Superina, M.

Contributor/s
Moraes-Barros, N.

Justification
Bradypus tridactylus is listed as Least Concern in view of its wide distribution in one of the most pristine areas of the Amazon basin, and its having been recorded as locally relatively abundant.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Bradypus tridactylus has become so highly specialized for arboreal life that it is severly handicapped if removed from the forest canopy. Also, this mammal does not survive in captivity very well. With the rapid decimation of the rain forests, due to the activities of lumber companies and a growing number of farmers and miners, these mammals will certainly be affected (www. geocites.com/Hollwood/set/1478/Sloth.html).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation status
The IUCN lists this species as ‘Least Concern’ in view of its wide distribution in one of the most pristine areas of the Amazon basin, and its having been recorded as relatively locally abundant .(IUCN, 2009).Bradypus tridactylus are widespread and locally abundant within a spectrum of protected areas, from inner city parks to wilderness reserves (Vizcaino & Loughry, 2008).

Threats
All species of Bradypus may be threatened by habitat destruction and excessive hunting (Nowak, 1999).The main predators are the
  • jaguar
  • ocelot
  • anaconda
  • harpy eagle
  • margay cat
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population density estimates vary from 1.7 animals per km² in French Guiana (Taube et al. 1999) to 221 animals per km² in Manaus, Brazil (Chiarello 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this sloth species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Bradypus tridactylus has been recorded from many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The three-toed sloth in its remote habitat rarely has the chance to affect a human life. It is food to jaguars and ocelots, from which skins are used for human enjoyment. (www.geocites.com/Hollwood/set/1478/Sloth.html).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pale-throated sloth

The pale-throated sloth (Bradypus tridactylus) is a species of three-toed sloth that inhabits tropical rainforests in northern South America. It is similar in appearance to, and often confused with, the brown-throated sloth, which has a much wider distribution. Genetic evidence suggests that the two species diverged only around 400,000 years ago, although the most recent evidence suggests the split is closer to 6 million years.[3][4]

Contents

Description

Pale-throated sloths have a rounded head with a blunt nose and small external ears. The limbs are long and weak, with the arms being nearly twice the length of the hindlimbs. The hands and feet each have three digits, armed with long, arched claws, with the middle claw being the largest and most powerful.[citation needed] Males are 45 to 55 centimetres (18 to 22 in) in head-body length, with a short, 4 to 6 centimetres (1.6 to 2.4 in), tail, and weigh from 3.2 to 6 kilograms (7.1 to 13 lb). However, the females are noticeably larger, being from 50 to 75 centimetres (20 to 30 in) in length, and weighing 3.8 to 6.5 kilograms (8.4 to 14 lb).[5]

The body is covered with coarse guard hairs up to 10 centimetres (3.9 in) long, with a finer undercoat. Green algae live mutualistically between the microscopic scales on the surface of the guard hairs, giving the sloth a somewhat greenish appearance that serves as camouflage. Adults are blackish-grey over most of the body, with darker patches distributed over the backs, shoulders, and hips. Males have a bright yellow or orange patch on the back, divided by a central black stripe. Pale-throated sloths are difficult to distinguish from the closely related brown-throated sloth, but, as their name implies, have a pale yellow patch on the throat.[5]

The eyes are large and forward facing for binocular vision, with round pupils. Unusually, they appear to lack any cone cells in the retina, suggesting that the sloth is unable to see color. Despite its apparently small ears, the pale-throated sloth has excellent hearing; it has also been reported to have a good sense of smell.[5]

Anatomy

The sloth has nine cervical vertebrae, giving it extreme flexibility. As a result, a pale-throated sloth can bend its head backwards and forwards through 270° and rotate it through 330°. It possesses a pair of foramina in the anterodorsal nasopharynx, a feature that distinguishes it from its sister species. The females have two mammae in the chest region, a simple uterus. Males have no discrete prostate gland, no scrotum, and only rudimentary seminal vesicles.[5]

The mouth is lined by a black colored mucosa, although the large and heavy tongue is pink. The palate is wrinkled in texture, and the tongue is lined with numerous grooves, apparently adaptations to the sloth's diet. Like other three-toed sloths, it has just five teeth on each side of the upper jaw, and four on each side of the lower jaw; these are all simple and rounded in shape, with the front teeth in the upper jaw being much smaller than the others. The esophagus is short, but the stomach is large and complex, and there is also a large diverticulum in the cecum. [5]

Distribution and habitat

The pale-throated sloth is found only in the tropical forests of northern South America, including Guyana, Suriname, French Guiana, western Venezuela and Colombia, and Brazil north of the Amazon River.[2] There are no recognised subspecies.

Behavior and biology

Pale-throated sloths are solitary,[6] herbivorous animals that spend almost their entire lives in trees. Depending on habitat, population densities of anything from 1.7 to 221 per square kilometre (4.4 to 570 /sq mi) have been reported.[2] They eat only leaves, including those of Cecropia, Ceiba, Elizabetha, and Hevea. Known predators include jaguars, margays, harpy eagles, and anacondas.[5]

The pale-throated sloth can hang so securely with its hooklike claws that it even falls asleep in this position. It may even stay suspended in the trees for some time after it dies. They have been reported to spend over eighteen hours each day asleep, and move through the tree canopy only very slowly. They periodically descend from the trees to defecate, depositing a pile of small pellets in a hole dug into the ground. Despite their arboreal lifestyle, they are effective swimmers. Their call is a bird-like whistle described as an "ai-ai" sound.[5]

In addition to their mutualism with green algae, pale-throated sloths are also commensal with sloth moths, and with certain species of beetle. These insects live in the sloth's fur, and lay their eggs in its dung, on which their larvae feed.[5]

Reproduction

Mating takes place in the trees, with the pair either face to face, or with the male on the female's back. The female gives birth to a single infant after a gestation period of about six months.[7]

The young are born already fully furred, and with open eyes. The young animal clings to the mother's underside for the first month of life, by which time it has reached a weight of around 300 grams (10 oz). They begin to take solid food at three weeks, and are fully weaned some time after the first month. The young initially have soft greyish-brown fur, which darkens and becomes rougher as they age.[5] They reach sexual maturity at around three years.[7]

References

  1. ^ Gardner, Alfred (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 100. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11800007. 
  2. ^ a b c Chiarello, A. & Moraes-Barros, N. (2011). "Bradypus tridactylus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/3037. Retrieved 18 January 2012. 
  3. ^ Barros, M.C. et al. (2003). "Phylogenetic analysis of 16S mitochondrial DNA data in sloths and anteaters". Genetics and Molecular Biology 26 (1): 5–11. doi:10.1590/S1415-47572003000100002. 
  4. ^ Moraes-Barros, M.C. et al. (2011). "Morphology, molecular phylogeny, and taxonomic inconsistencies in the study of Bradypus sloths (Pilosa: Bradypodidae)". Journal of Mammalogy 92 (1): 86–100. doi:10.1644/10-MAMM-A-086.1. 
  5. ^ a b c d e f g h i Hayssen, V. (2009). "Bradypus tridactylus (Pilosa: Bradypodidae)". Mammalian Species 839: 1–9. doi:10.1644/839.1. 
  6. ^ Taube, E. et al. (1999). "Distribution of two sympatric species of sloths (Choloepus didactylus and Bradypus tridactylus) along the Sinnamary River, French Guiana". Biotropica 31 (4): 686–691. doi:10.1111/j.1744-7429.1999.tb00418.x. 
  7. ^ a b Taube, E., et al. (2001). "Reproductive biology and postnatal development in sloths, Bradypus and Choloepus: review with original data from the field (French Guiana) and from captivity". Mammalian Species 31 (3-4): 173–188. doi:10.1111/j.1365-2907.2001.00085.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!