Overview

Brief Summary

Biology

Heaviside's dolphins, often seen in small groups of two to ten individuals (2), are not as lively or boisterous as some other dolphins, but nevertheless, have been occasionally seen riding the bow waves of boats (5). They feed on a wide variety of prey found in their coastal habitat, including small schooling fish, fish dwelling on the sea floor, and squid (2). While little is known about the breeding biology of Heaviside's dolphin, it is assumed to be similar to that of closely related species. Males are thought to reach sexual maturity between the age of five and nine years, and females bear their first calf between six and nine years of age. Mating takes place in spring to late summer, and after a gestation period of 10 to 11 months, the calves are born. Mature females are believed to calve every two to four years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

One of the most poorly known dolphins and also amongst the smallest (2) (5), Heaviside's dolphin has a blunt head, rounded, paddle-like flippers (2), and bold markings. The front half of the stocky body is grey and the rear half is largely bluish-black. The flippers are dark and dark patches encircle the eyes and blowhole. The underside is white, as are the 'armpits' behind the flippers, and a distinct white finger-shaped marking extends from the belly along each flank (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Heaviside dolphins according to MammalMAP

Heaviside dolphins (Cephalorhynchus heavisidii) were originally named ‘haviside’ dolphins after Captain Haviside who brought a specimen of the cetacean from the coast of Namibia to the UK in the early 19th century.  An accidental typo resulted in the cetacean being called a ‘heaviside dolphin’ and the name stuck!

Heaviside dolphins are small and robust.  They are roughly the size of an average human.  An adult Heaviside dolphin is approximately 1.7 meters in length and weighs an average of 60 – 70 kgs.  They do not have beaks so they are often mistaken for porpoises.

Heaviside dolphins are often seen in small groups of 2 – 10 animals.  They are shyer than their cetacean cousins but they do occasional bow ride nearby boats.  They diet comprises of a variety of prey items found along their coastal habitat that stretches from along the coast of southern Angola to the southern tip of South Africa.  Hake and kingklip make up to 50% of its diet.  Octopods make up 25% and the remainder comprises of a mix of smaller fish.

There is no data available on the reproductive behaviour of Heaviside dolphins.  There is also no data available on longevity.  No wonder the IUCN Red list classifies Heaviside dolphins as a data deficient species.   However, threats have been identified for this species.  These animals are prone to entanglement in a variety of inshore fishing gear (e.g., beach seines, purse seines, trawls, and gillnets).

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Cephalorhynchus heavisidii is found in coastal waters off of Africa’s Southwestern coast, from central Angola to the southern-most tip of South Africa. This species usually remain within 8 to 10 km of the shoreline, but has been sighted up to 45 nautical miles from the coast. While some studies suggest that Cephalorhynchus heavisidii does not migrate significant distances, and that there are resident dolphins in some areas, this is not well established. One study tracked a juvenile male that swam 158 km north of where he was tagged. Another juvenile male traveled 137 km north of his tagging site over a 17 month period, suggesting that average daily movements might be small. This species appears to have low population densities of around 5 individuals per 160 km.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Heaviside’s dolphins have a limited range, restricted to southwestern Africa (Angola to South Africa), with records from about 17°S to the southwestern tip of the continent. They are commonly seen along the west coast of South Africa in the Cape Town region (Rice 1998; Dawson 2002). Records extend along the entire west coast of South Africa and Namibia, and into southern Angola (J-P Roux pers. comm.), but as the cetacean fauna of Angola is poorly known, it is uncertain how far north the species’ distribution extends there (Best and Abernethy 1994).

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

East South Atlantic off SW Africa
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species has an extremely small range, occurring only off the west coast of South Africa and Namibia. Sightings are most common around Walvis Bay, Namibia and Cape Town, South Africa (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult Heaviside’s dolphins typically weigh between 60 and 70 kg, with an average body length of 1.74 m. Maximum girth is roughly 67% of the length of the body. Each individual has between 48 and 70 teeth. They are distinguished from other dolphins by their blunt head, robust body, triangular dorsal fin, and rounded paddle-like flippers. Heaviside's dolphins have a dark gray anterior surface with a dark blue-black patch beginning midway between the dorsal fin and the snout, and extending about halfway down the ventral surface of the body. White markings on their underside form a three-pronged fork, with another white rhomboidal patch on the chest and two smaller diamond-like patches just posterior to the flippers. They also have a dark blue-black stripe, which extends from the blowhole to the cape. Sexual dimorphism has not been reported in this species.

Range mass: 60 to 75 kg.

Average length: 1.74 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Cephalorhynchus heavisidii is found exclusively in the Atlantic Ocean. Although it is most often found in waters less than 100 m deep, it has been sighted at depths up to 180 m. It is usually found in waters that are between 9 and 15ºC, but has been found in waters as warm as 19ºC. More than 87% of sightings occur in the Benguela Current.

Range depth: 180 (high) m.

Average depth: 100 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a coastal, shallow-water dolphin seen mainly in waters less than 100 m deep (Best and Abernethy 1994). It is generally associated with the cold, northward-flowing Benguela Current. Rice and Saayman (1984) speculated that some subpopulations may be resident in particular areas year-round, although this was questioned by Best and Abernethy (1994). Satellite-linked tagging indicated that in summer female Heaviside’s dolphins occupied home ranges of up to 1,000-2,000 km² over periods of up to 54 days, with a strong onshore-offshore diurnal pattern of movement (Elwen et al., 2006). More than 85% of sightings were in water with surface temperatures of 9-15°C (Best and Abernethy 1994).

The diet of Heaviside’s dolphin consists mainly of juvenile hake (individuals well below the modal length of commercially caught fish) (Sekiguchi et al., 1992). Other demersal fishes, pelagic schooling fishes, and cephalopods (including octopus) are also taken (Best and Abernethy 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Heaviside's dolphins inhabit coastal waters, generally less than 200 metres deep. They can be seen during the surf zone, particularly during the summer (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The primary prey of Cephalorhynchus heavisidii includes hake and kingclip, which comprises nearly 49% of their diet. Octopods is also an important prey item for C. heavisidii, which makes up about 22% of their diet. The remainder of their diet generally consists of kingfish, gobies, and squid. Dolphins have fusiform, or torpedo shaped bodies, which allows them to swim at high speeds to avoid predation and catch prey.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cephalorhynchus heavisidii preys upon a number of different fish and cephalopods. Although this species is not a major prey item of any particular organism, body parts of dolphins have been found in the gut contents of killer whales and sharks. There is no information available regarding parasites of Cephalorhynchus heavisidii, nor has it been recorded to take part in any mutualistic or commensalistic relationships with other organisms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Though Cephalorhynchus heavisidii is not typically vulnerable to predation, humans pose a potential threat due to by-catch. In general, dolphins are subject to retaliatory killings by local fisherman and are sometimes slaughtered for their meat, which is considered a delicacy in Japan. However, the biggest threat to dolphins seems to be accidental killing. Drift fishing nets catch everything in their paths, including dolphins, and prevent them from reaching the surface for air. It has been estimated that drift fishing nets have killed more than 30 million dolphins worldwide since the 1960's.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Heaviside’s dolphins communicate visually, as dolphins have exceptional underwater vision. They also use tactile communication, swimming near other individuals and rubbing against one another to build affiliative relationships. Acoustically, they are able to communicate through a series of whistles and clicks ranging between 1.5 and 11.0 KHz. They communicate chemically by releasing pheromones from pores in their anal glands. Heaviside’s dolphins also rely heavily on echolocation to perceive their surroundings.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; echolocation ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no information available regarding the average lifespan of Cephalorhynchus heavisidii in captivity or in the wild. The average lifespan of most wild delphinids ranges from 17 to 25 years, with a few living into their early 50s. Although similar averages are found for captive dolphins, few captive individuals live past their 20s. In general, delphinids are vulnerable to bacterial, fungal, and viral infections and have been found to suffer from heart and respiratory disease, stomach ulcers, and even cancer. Dolphins are also vulnerable to a number of different parasites including flukes, tapeworms, and roundworm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is no information available regarding the mating system of Heaviside's dolphins. However, bottlenose dolphins, spinner dolphins, and common dolphins are promiscuous.

Heaviside's dolphins breed once every 2 to 4 years from spring to late summer. Gestation lasts for 10 to 11 months. Females usually give birth to only one offspring at a time, as there is limited space for in utero development. To account for the limited space in the uterus, during development, the tail flukes and dorsal fins of fetuses are cartilaginous and fold over. Newborns average 85 cm in length. Birth mass has not been recorded for this species. However, newborn bottlenose dolphins range from 11.3 to 18.1 kg, and Irrawaddy dolphins, which average 96 cm in length at birth, has an average birth mass of 12.3 kg. There is no information available regarding weaning and time to independence for this species. Bottlenose dolphins begin weaning as early as 32 months and are fully weaned by 48 months, while time to independence ranges between 3 and 6 years. Female Heaviside's dolphins reach sexual maturity between 5 and 9 years of age, and males reach sexual maturity between 6 and 9 years of age.

Breeding interval: Haviside's dolphins breed every 2 to 4 years.

Breeding season: Haviside's dolphins breed from spring to late summer.

Range gestation period: 10 to 11 months.

Range age at sexual or reproductive maturity (female): 5 to 9 years.

Range age at sexual or reproductive maturity (male): 6 to 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Cephalorhynchus heavisidii calves swim in echelon position, that is, in close proximity to the mid-lateral flank near the dorsal fin of the mother. This allows the calf extra speed at a lower tailbeat frequency, because it is able to ride along the pressure wave that its mother’s body creates. However, it has been shown that this causes extra strain on the mother, who is able to swim at only 76% of her mean maximum speed when swimming by her self. Most dolphin calves develop strong social bonds with their mother, which remains even at 3 years of age. This extended mother-young association is thought to be due largely to the still-improving physical performance and social skills of calves. There is no information available regarding paternal investment in calf development.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalorhynchus heavisidii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTATACTTACTATTTGGCGCCTGAGCAGGAATAGTAGGTACCGGTCTAAGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGACGACCAACTTTATAATGTTCTAGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATGGTTATACCTATCATAATTGGGGGTTTCGGGAACTGATTAGTTCCCTTAATAATTGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTACTGATAGCATCTTCGATAATTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTTACTATTTTCTCCCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATTACAACTATTATTAATATAAAACCACCCGCTATAACCCAATATCAAACGCCTTTGTTCGTCTGATCAGTCTTGGTCACAGCAGTCTTACTTTTACTATCATTACCTGTCTTAGCAGCCGGAATTACCATACTATTAACCGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATACCAACACTTGTTCTGATTTTTTGGCCACCCTGAAGTATATATTCTAATTCTACCTGGCTTTGGAATAATTTCACATATCGTTACTTACTATTCGGGGAAAAAAGAACCTTTCGGGTATATGGGAATAGTATGAGCTATAGTTTCTATTGGTTTCTTGGGTTTCATTGTATGAGCTCACCATATATTTACAGTTGGAATAGACGTAGATACACGAGCATATTTTACATCAGCTACTATAATTATCGCAATTCCTACAGGAGTAAAAGTCTTCAGTTGACTAGCAACACTTCACGGAGGAAATATTAAATGATCTCCAGCCCTAATATGAGCTCTAGGCTTTATTTTCTTATTCACAGTAGGGGGTTTAACCGGTATTATCCTAGCTAACTCATCCCTAGACATCATTCTCCATGACACTTATTATGTGGTTGCTCACTTTCACTATGTACTTTCAATAGGAGCTGTCTTTGCCATCATAGGAGGCTTCGTCCACTGATTCCCACTATTTTCAGGATACACACTCAACCCAACATGAGCAAAAATCCAATTCATAATTATATTCGTAGGTGTAAATATGACATTCTTCCCACAACACTTCCTAGGCCTATCTGGAATACCTCGCCGATATTCCGACTATCCAGATGCTTACACAACATGAAACACCATCTCATCAATAGGCTCATTTATCTCACTAACAGCAGTCATACTAATAATCTTCATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCTTGGCAGTAGACCTCACTTCCACAAACCTTGAATGACTAAACGGGTGTCCTCCACCATACCACACATTCGAAGAACCAGTATACGTTAACCTAAAATATTCAAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalorhynchus heavisidii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Cephalorhynchus heavisidii is listed as “data deficient” on the IUCN Red List of Threatened Species. CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora) lists Cephalorhynchus heavisidii under Appendix II, meaning that though this species is not necessarily threatened with extinction, its trade must be regulated so that its survival is not jeopardized. Cephalorhynchus heavisidii is vulnerable to harpoons and guns used by humans hunting close to shore, where about 100 are killed annually. Also, entanglement in fishing gear poses a significant threat. In 1983, 67 were caught in nets off Namibia, and 57 off of South Africa. Although overfishing of their primary prey may pose a threat to their survival, little evidence exists to support this claim. As an inshore species, C. heavisidii is susceptible to pollution and boat traffic, and low levels of DDT have been found in some individuals. This species is currently protected from commercial hunting and fishing throughout its geographic range. It is also protected by a 322 km Exclusive Fishery Zone (EFZ) off the coast of South Africa and a 20 km EFZ off the coast of Namibia.

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

  • Reeves, R., E. Crespo, S. Dans, T. Jefferson, L. Karczmarski, K. Laidre, G. O'Corry-Crowe, S. Pedraza, L. Rojas-Braho, E. Secchi, E. Slooten, B. Smith, J. Wang, K. Zhou. 2008. "Cephalorhynchus heavisidii" (On-line). IUCN Red List. Accessed March 14, 2011 at http://www.iucnredlist.org/apps/redlist/details/4161/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Reeves, R.R., Crespo, E.A., Dans, S., Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Pedraza, S., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J.

Contributor/s

Justification
There is inadequate information to assess this species against the criteria and therefore it must remain listed as Data Deficient pending a credible estimate of population size and/or better information on population trend. Heaviside’s Dolphins have a limited range and are not particularly common anywhere. Several threats have been identified, including entanglement in a variety of inshore fishing gear (e.g., beach seines, purse seines, trawls, and gillnets).

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007 (1). Listed on Appendix II of CITES (3) and on Appendix II of CMS (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No range-wide survey has been conducted for this species. A published estimate of 800 -1,000 (Carwardine 2002) is not based on a survey and is only a guess. Surveys off the coast of southern Africa yielded approximate densities of 4.69 sightings per 100 nautical miles within 5nm of the coast, with relatively fewer sightings further offshore (Best 1984). Griffin and Loutit (1988) stated that Heaviside’s dolphins were the cetaceans most frequently seen from the Namibian coast.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In general, Heaviside’s dolphins appear to face fewer threats than other members of its genus. Although fully protected legally, some killing with hand-thrown harpoons or guns has been reported (Rice and Saayman 1984; Best and Abernethy 1994). Heaviside’s dolphins are susceptible to entanglement in inshore gear such as beach seines, purse seines, trawls, and gillnets (Best and Abernethy 1994; Peddemors 1999).

Concern has been expressed about the potential effects of pollution and boat traffic (Culik 2004). However, organochlorine levels in a small sample of Heaviside’s dolphins failed to indicate significant exposure to DDT in the coastal waters of South Africa’s west coast, where the scarcity of arable land and low rainfall may help minimize pesticide residue inputs to the marine environment (De Kock et al. 1994). Also, low human population densities and the scarcity of large ports along most of the species’ range probably help reduce the possibility of adverse effects from boat traffic (Best pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lack of information on Heaviside's dolphin makes it difficult to assess how threatened this species may be (1). By-catch, whereby dolphins get entangled in fishing gear, represents one of the greatest threats this dolphin may face, but there is little information available on the numbers of individuals that may be killed in this manner (5). A number are also illegally hunted, apparently for their meat (7). The small distribution of Heaviside's dolphin makes it particularly vulnerable to any threats it may face (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

More information is needed on the distribution of the species in Angolan waters in particular, as well as on the nature and extent of directed and incidental catches. More research emphasis should in future also be placed on possible detrimental interactions due to the overfishing of prey stocks, especially hake. Increased inshore fishing pressure will inevitably increase interactions between the fisheries and Heaviside’s dolphins (Peddemors 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Heaviside's dolphin is protected within 200 miles of the coast of South Africa, and 12 miles of Namibia, in Exclusive Fishery Zones in which all dolphins are protected (8). In addition, this species may benefit from its listing on Appendix II of the Convention on Migratory Species (CMS), which encourages range states (in this case Namibia and South Africa), to develop agreements for the conservation and management of the species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Cephalorhynchus heavisidii on humans. Although local fisherman may contend that this species decreases local fish abundance, there is no documented evidence to support this.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cephalorhynchus heavisidii provides no known economic benefits to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Haviside's dolphin

Haviside's dolphin (Cephalorhynchus heavisidii), or alternatively Heaviside's dolphin, is a small dolphin found off the coast of Namibia and the west coast of South Africa. It is one of four dolphins in the genus Cephalorhynchus — the others being the Chilean dolphin, Hector's dolphin, and Commerson's dolphin.

Name[edit]

Haviside's dolphin, whose binomial name references heavisidii, is actually named after a Captain "Haviside", who brought a specimen from Namibia to the United Kingdom early in the 19th century. However, its name was once misspelled Heaviside, after a prominent surgeon, Captain Heaviside who collected cetacean and other animal species. The latter name stuck and is the most common in the literature. Some authorities, including the Encyclopedia of Marine Mammals and Mammal Species of the World use the originally intended name of Haviside's dolphin.

Population and distribution[edit]

Although sightings of the species are not uncommon off the Skeleton Coast of Namibia, Haviside's dolphins have not been systematically studied by scientists. They have been recorded off the coast of northern Namibia at 17°S and as far south as the southern tip of South Africa. Sightings are often recorded from major population centres such as Cape Town and towns such as Walvis Bay. Sightings are likely from Lambert's Bay either from the shore or from boat trips run from the harbour. No estimates of abundance exist.

Physical description[edit]

Haviside's dolphins off Walvis Bay, Namibia

Haviside's dolphin is a fairly small dolphin, growing to about 1.8 m (5 ft 11 in) in length and weighing up to 75 kg. Their size and the bluntness of their heads lead these dolphins to often be mistaken for porpoises. The head is coloured a dark grey. The front half of the upper side and the flanks are a much lighter grey.[2] The dorsal fin, fluke and back half of the back are again a darker grey colour. The underbelly is white, with flashes of white on the flanks below the dorsal fin.

Males reach sexual maturity at about seven to 9 years. Females reach breeding age at the same time. The gestation period is probably 10 months. Mating occurs in spring and summer. Females are believed to calve on average once every three years. The maximum known age of a Haviside's dolphin is 20 years. This relatively short lifespan, coupled with the long calving period, causes a naturally low population growth rate. Therefore, the species is particularly sensitive to being hunted.

Haviside's dolphins are active and social animals. They typically congregate in groups of about five to 10 in number, but sometimes in larger groups. They are able to swim fast. Part of their play and social activity is to jump vertically clear of the water, turn in the air, and fall back into the sea with virtually no splashing or noise.

Conservation[edit]

Heaviside's dolphin is listed on Appendix II[3] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II[3] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.[4]

Heaviside's dolphin is covered by the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia.[5]

See also[edit]

References[edit]

  1. ^ Reeves, R.R., Crespo, E.A., Dans, Jefferson, T.A., Karczmarski, L., Laidre, K., O'Corry-Crowe, G., Pedraza, S., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, JY. & Zhou, K. (2008). "Cephalorhynchus heavisidii". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 18 January 2013. 
  2. ^ Encyclopedia of Earth. 2011. Cephalorhynchus heavisidii. Eds. C.Michael Hogan and C.J.Cleveland. Encyclopedia of Life (contributor) Washington DC
  3. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5 March 2009.
  4. ^ Convention on Migratory Species page on the Heaviside's dolphin
  5. ^ Western African Aquatic Mammals MoU, Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia

Further reading[edit]

  • National Audubon Society: Guide to Marine Mammals of the World Reeves, Stewart, Clapham and Powell (2002)
  • Cephalorhynchus dolphins, Encyclopedia of Marine Mammals, pp. 200–202, Stephen M. Dawson (1998) ISBN 0-12-551340-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!