Overview

Distribution

Range Description

This species is found in the Andes of northern and western Colombia, Ecuador, and western Venezuela. In Colombia it is found from 2,000 to 3,800 m (Alberico et al. 2000). In Ecuador it is found from 1,600 to 4,000 m (D. Tirira pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Silky shrew opossums, Caenolestes fuliginosus, live in the Andes, at altitudes ranging from 1,500 to 4,000 m. Their range is distributed throughout western Venezuela, north and west Columbia, and Ecuador.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Caenolestes fuliginosus is sexually dimorphic. The mass of females ranges from 16.5 to 22.4 g, and the mass of males ranges from 25 to 40.8 g. The head and body length is between 90 and 135 mm; including the tail, their length ranges from 93 to 139 mm. Pelage contains hairs with different textures, which creates an uneven appearance. The fur is soft and thick, with dark brown to almost black dorsally, and noticeably lighter fur on the ventrum. The non-prehensile tail is the same color as the dorsal pelage and is almost naked. The head is elongated (similar to that of a rat), with small eyes, and ears extending above the fur line. Upper and lower lip flaps are present. Feet each have five digits. On the forefeet, the two outer digits have blunt claws, and the inner three digits have sharp curved nails. Digits on the hind feet display curved claws except for the inner digit. The inner digit on both hind feet is small with a small nail.

Range mass: 16.5 to 40.8 g.

Range length: 93 to 139 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Patterson, B., M. Gallardo. 1987. Rhyncholestes raphanurus. Mammalian Species, 286: 1-5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in paramo and upper montane forest. In Ecuador, this species may be absent or rare at high altitudes due to natural competition with Cryptotis montivaga (Barnett, 1991).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species lives in the alpine forests and meadows of the Andes. These are cool, wet, heavy vegetation areas, where they can build tunnels in surface vegetation for travel.

Range elevation: 1,500 to 4,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Silky shrew opossums are mainly insectivorous, and can use their incisors to probe in search of insects. However, they are also known to hunt and kill other small vertebrates and earthworms for food. Even small seeds have been found in the digestive tracts. They hunt in the early evening and at night; they are mostly nocturnal. They use their long vibrissae (whiskers) and well-developed sense of hearing to locate their prey.

Animal Foods: mammals; insects; terrestrial worms

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The full effects these animals have on their ecosystems are still mostly unknown. However, they do impact the animals they prey on (insects and worms), as well as the animals that prey on them, but the extent of this impact is still not fully understood.

Commensal/Parasitic Species:

  • Ticks/mites

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Any larger animal living in the Andes that has access to C. fuliginosus terrain could be a possible predator. To protect themselves, silky shrew opossums are cryptically colored, and their keen sense of hearing and smell allow them a chance to quickly run for safety.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

These animals have poor sight, but well-developed senses of smell and hearing, as well as sensitive and long vibrissae. They most likely use their well-developed senses to locate their prey in the evening and at night. However, because of their sensitive hearing, they most likely communicate with each other through sound, and identify each other through their unique sense of smell.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; infrared/heat ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Information does not exist on the lifespan of C. fuliginosus, partly because of the inaccessible and rugged habitat in which they live. Given their small size, it is not likely that they live many years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Not much is known about the mating system of silky shrew opossums other than the fact that these animals reproduce sexually. Females are predicted to be reproductively active only in the summer, because all female Rhyncholestes (another genus of shrew opossum in the family Caenolestidae) captured in the spring had unperforated vaginae and showed no signs of pregnancy or lactation. The extreme sexual dimorphism suggests that these animals may be polygynous.

Females are reproductively active only in the summer. August has been the only time of year when suckling young have been captured. However, male shrew opossums are capable of breeding all year long, based on the position of their testes. Because silky shrew opossums have two pairs of mammae, it is predicted that they could have between 1 and 6 offspring in a litter, based on the pattern of lactating female teat development. However, no actual observations of litters have been reported.

Breeding interval: Breeding is predicted to occur once yearly.

Breeding season: Breeding is likely to take place in early July, although males may be capable of breeding year round.

Average gestation period: 1 to 1.5 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Observations of maternal behavior have not been made directly. It is predicted that females utilize a form of nesting during the reproductive season based on the fact that few or no females have been trapped anytime soon after giving birth, and no attached offspring have been found. The marsupium in this species is confined to juveniles. Offspring in marsupials are always altricial, because the lack of placentation does not allow complete development of the young prior to birth.

In the genus Rhynolestes, also in the family Caenolestidae, there have been suspected "family groups" captured. In four consecutive nights one adult male, one adult female, and two juveniles were captured in the same trap in the same location that had not been washed between captures. If this in fact was a family group, it could suggest both male and female parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caenolestes fuliginosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTCTTTTCTACAAACCATAAAGACATCGGCACCCTTTATCTACTATTCGGTGCATGAGCAGGAATAGTTGGAACCGCACTAAGCTTACTAATCCGAGCAGAACTTGGTCAACCCGGGACTTTAATCGGTGAT---GATCAAATTTACAACGTTATTGTTACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGTTTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCACCAGACATAGCATTCCCACGAATAAACAATATAAGTTTCTGATTACTCCCACCATCTTTTTTACTTCTACTCGCATCATCGACAGTAGAAGCAGGAGCAGGAACGGGTTGAACCGTTTATCCTCCACTAGCCGGTAACTTAGCACATGCCGGAGCTTCAGTTGACCTAGCCATTTTCTCACTACATTTAGCTGGTATCTCATCAATTCTAGGAGCTATTAATTTTATTACCACAATTATTAATATAAAACCTCCTGCAATATCCCAATACCAAACTCCTCTGTTCGTATGATCTGTGATAATCACAGCTGTTCTTCTCCTCCTATCTCTCCCAGTTTTAGCAGCAGGAATCACTATACTATTAACAGATCGAAACCTAAACACTACTTTTTTTGACCCAGCAGGAGGAGGTGACCCCATTCTATACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTATACATTCTAATTTTACCTGGTTTCGGAATTATTTCCCACATTGTTACATATTACTCAGGAAAAAAAGAACCATTTGGTTACATGGGTATAGTATGAGCTATAATATCAATCGGATTCCTAGGATTCATTGTATGAGCTCACCATATATTCACAGTTGGTTTAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caenolestes fuliginosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Patterson, B., Gomez-Laverde, M. & Delgado, C.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its broad distribution, presumed large global population, and current absence of major threats.

History
  • 1996
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The conservation status of this species is unknown, mainly because of the inaccessible and rugged habitat it lives in, the fact that not many specimens have been captured, and that little is known about its life span and environmental interactions. It was once considered rare, but more recent studies have started suggesting otherwise.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is the most common and most widely distributed of the genus.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats; however, the habitat is locally heavily used for cattle grazing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

No substantially negative impacts to humans have been discovered from this animal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These animals have little effect on humans, and live in a completely different habitat. However, in human’s search for cures, some research has started to take place in this family, Caenolestidae. The breast cancer BRCA1 protein is being studied in many marsupials, including C. fuliginosus.

Positive Impacts: research and education

  • Ramirez, C., M. Fleming, J. Potter, G. Ostrander, E. Ostrander. 2004. Marsupial BRCA1: Conserved regions in mammals and the potential effect of missense changes. Oncogene, 23 (9): 1780-1788.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dusky caenolestid

The dusky caenolestid (Caenolestes fuliginosus), also known as the dusky shrew opossum, the silky shrew opossum, or the Ecuadorean shrew-opossum, is a small marsupial that lives in the alpine forests and meadows of the Andes. Its range stretches across Colombia, Ecuador, and northwestern Venezuela. It is the best known of the six surviving species of the order Paucituberculata (shrew opossums).

References

  1. ^ Gardner, A. L. (2005). "Order Paucituberculata". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 19. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10500009.
  2. ^ Patterson, B., Gomez-Laverde, M. & Delgado, C. (2008). Caenolestes fuliginosus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!