Overview

Brief Summary

Biology

Incredibly, the gerenuk is believed to be independent of free water (5). This is a great advantage in its semi-arid habitat, as the gerenuk therefore does not have to undertake long journeys in search of water. Instead, the sedentary gerenuk is thought to obtain all the moisture it requires through its diet. It browses almost exclusively on tree-foliage (5), and is unique among antelopes in being able to stand on its hindlegs to reach over two meters high, attaining leaves that only giraffes can also reach (2). The gerenuk also feeds on shrubs, creepers and vines (5), where its tiny pointed muzzle can reach leaves amongst dense thorny tangles (2). Young gerenuks can be born at any time of the year, after a gestation period of 6.5 to 7 months (5). Mothers do not need long before they can fall pregnant again, and are capable of producing at least four young within three years (5). The newborn calf is well hidden in vegetation, and joins its mother only after several weeks (2). Male gerenuks are strictly territorial, and defend their land by driving away any intruding males (4). Fights can erupt between males, in which they may clash their heavy horns together by nodding or jerking their heads. Solid bone at the base of the horns, an extension braincase, provides the immediate force for these violent blows (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Gerenuk means 'giraffe-necked' in the Somali language, a name arising from its distinctive long, slender neck (3), which it stretches as it stands on its hindlegs to feed on the tender leaves of high branches. This tall, long-eared antelope has a chestnut coloured back, distinct from the light fawn sides and white underparts (2). Its muzzle and mouth are small for its size (2), and are narrow and pointed to enable it to pluck leaves from amongst tangles of thorns. Male gerenuks have short, robust, heavily ringed horns that curve elegantly backwards in an S-shape (4). Scent glands beneath the eyes enable male gerenuks to mark their territory and also mark females during the courtship ritual (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The generuk according to MammalMAP

Also known as the Waller's gazelle, the gerenuk (Litocranius walleri), call the dry shrubland of East Africa home. The Somalian word ’Gerenuk’ means ‘Giraffe-necked’ – and it’s easy to see how these antelopes earned this name! Their long necks allow them to reach branches 6-8 ft. off the ground. They extend this reach even further by standing upright on their hind legs while feeding. The Gerenuk once had a wide distribution in Africa, but are currently thought to occur only in southern Djibouti, Somalia, Ethiopia, Kenya and North-eastern Tanzania. For more info visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Gerenuk formerly occurred widely in the semi-arid bushland of North-east Africa, reaching the northern limit of its continental distribution in the arid thornbush of southern Djibouti. It apparently still occurs in this area in stable numbers. It still occupies large parts of its historical range in Ethiopia, Kenya and Tanzania, but little information is available on its current distribution in Somalia (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Litocranius walleri inhabits the dry brushy region of east Africa from the Serengeti plain of Tanzania north along the coast through Kenya, Ethiopia, Eritrea, and into southern Somalia. The species was once found in eastern Egypt and northeastern Sudan as well.

Biogeographic Regions: ethiopian (Native )

  • Parker, S. 1990. Grizimek's Encyclopidia of Mammals vol 5. New York NY: McGraw-Hill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs throughout the Horn of Africa, from southern Djibouti, Somalia and Ethiopia, southward through Kenya to northeastern Tanzania. It is known to have had a wider distribution in the past (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The long neck and long, thin legs of gerenuks are their defining features; these make them one of the world's most easily recognized antelopes. The coat is of a short, fine, glossy hair that is evenly distributed over the whole body. The pelage is a pale tawny brown with white along the breast, underbelly, and inner legs. There are small, dark patches of fur on the knees of the forelegs and at the end of the tail. The head is long and narrow with medium-sized ears, and the cheek teeth and masseter muscle are reduced. On the head there is a dark patch around the eyes that pales as it goes outward until it forms a white rim. Only males of this species have head ornamentation in the form of scimitar shaped horns ranging from 25 to 44 centimeters in length. Both sexes of L. walleri are of similar size but the males are more muscular than females causing them to outweigh them. Mass ranges from 29 to 58 kg, total body length from 140 to 160 cm, and tail length from 220 to 350 mm.

Range mass: 29 to 58 kg.

Range length: 140 to 160 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

  • Fiorenza, P. 1983. Encyclopedia of Big Game Animals of Africa. New York City, New York, USA: Larousse and Co. Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits bushland, thickets, semi-arid and arid thornbush (below 1,600 m), avoiding dense woodlands and very open grass-dominated habitats. One of the most exclusive browsers, Gerenuk are largely independent of water (Leuthold in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The habitat that Litocranius walleri occupies varies from the treeless plains of Tanzania in the southern reaches of its range to the dry high deserts of Kenya. They are adaptable and do well in a variety of habitats, provided there is a good supply of succulent plants.

Range elevation: 0 to 3,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York NY: Facts on File Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gerenuk inhabits semi-arid bushland below 1,200 meters (2). It avoids grassy areas, preferring instead woody cover, particularly shrubs (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Litocranius walleri is well adapted for obtaining forage from their arid habitats. Their long necks, long legs, and the ability to stand on their hind legs allows L. walleri to obtain tree leaves that are out of reach for most other antelope species. This permits gerenuks to be selective in the foods they eat and to be efficient browsers of herbaceous plants. Over 80 different species of plants have been found in a single individuals stomach. L. walleri does not drink free standing water, they instead rely on water taken in when they eat succulent plants.

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Although rare, gerenuk contribute to nutrient cycling in the ecosystems in which they live through their foraging activity. They also act as prey species for large predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Several anti-predator adaptations have evolved in Litocranius walleri for their survival both while they are juveniles and as adults. Young L. walleri remain motionless while hiding in the bushes and tall grasses not far from their mothers during the day when the mother is feeding. As adults they show an adaptation that is more common to forest dwelling antelopes than to desert-adapted ones, they freeze at the aproach of danger. They are preyed on by a diverse set of large predators found throughout their range.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average life span of female Litocranius walleri is slightly longer than males. Their lifespan in the wild averages 10 - 12 years.

Typical lifespan

Status: wild:
10 to 12 years.

Average lifespan

Status: captivity:
13.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.3 years (captivity) Observations: In the wild, these animals have been estimated to live up to 12 years (Bernhard Grzimek 1990). One captive specimen lived for 17.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating ritual of Litocranius walleri is complex. When a male encounters a potential mate the female will raise her nose into the air and pull her ears close to the head as a sign of defensiveness, meanwhile the male displays his horns and neck in a sideways pose. If the female is receptive then the male will mark the female on the thigh with the contents of his preorbital gland and contiue to follow her around, a form of mate guarding. As the male follows the female he continually uses his forelegs to kick the female in her thigh region. When the female atempts to urinate the male performs the flehmen test or lip curl test in which he samples her urine. Once the female comes into estrous the male will notice the difference in the females urine and mating will begin. Males will attempt to mate with as many females as they can. (Macdonald, 1984)

Mating System: polygynous

Gerenuk females breed every one to two years, depending on the sex of their previous year's offspring. Males are dependent on their mothers for longer than are females. Reproduction and births occur throughout the year and may depend on the quality of available nutrition. Females give birth to usually one young after a gestation period of about 165 days.

Breeding season: Breeding occurs throughout the year.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 6.77 to 7 months.

Range weaning age: 12 to 18 months.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average number of offspring: 1.

Female Litocranius walleri usually give birth to one young, rarely two. The young are precocial and begin to walk within minutes of birth. The female continues to look after her young until she weans them. Young females get weaned when they reach one year of age but male offspring are not weaned until they reach at least one and a half years old and stay with their mothers until after they are two.

Parental Investment: altricial ; female parental care ; post-independence association with parents

  • Parker, S. 1990. Grizimek's Encyclopidia of Mammals vol 5. New York NY: McGraw-Hill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Litocranius walleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTTTCAACTAACCATAAGGATATCGGTACTCTGTATCTCCTATTTGGTGCTTGAGCTGGTATAGTAGGAACTGCCCTAAGTTTACTAATTCGTGCCGAACTAGGTCAACCCGGAACCTTACTTGGAGATGACCAGATCTACAATGTAGTCGTAACCGCACATGCATTCGTGATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGCTTTGGTAACTGGTTAGTCCCTCTAATAATTGGCGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTTCCCCCTTCTTTTCTACTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACGGGCTGAACTGTATACCCTCCTTTAGCAGGCAATCTAGCCCATGCAGGAGCCTCAGTAGACCTGACTATTTTCTCCCTTCACCTAGCAGGCGTTTCTTCAATCTTAGGAGCCATCAATTTTATCACAACAATTATCAACATAAAACCTCCCGCAATATCACAATACCAAACCCCTCTGTTCGTATGATCCGTTATAATTACCGCTGTGCTCCTACTTCTCTCACTTCCTGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTATACCAACACCTATTCTGATTCTTTGGACATCCCGAAGTATATATTCTTATCTTACCAGGATTTGGAATAATTTCCCATATTGTTACCTATTATTCAGGGAAAAAAGAACCATTCGGGTATATAGGGATAGTATGAGCTATAATATCTATTGGGTTCTTAGGATTTATTGTATGAGCCCATCATATATTCACAGTCGGAATAGACGTTGACACACGAGCTTACTTTACATCAGCCACCATAATTATTGCTATCCCAACCGGAGTAAAAGTTTTCAGCTGACTAGCCACACTTCACGGAGGTAATATCAAATGATCCCCCGCTATAATATGAGCCCTAGGCTTTATTTTCCTTTTCACGGTTGGAGGCTTAACCGGAATTGTCTTAGCTAACTCTTCTCTTGACATTGTCCTTCATGATACATATTATGTAGTTGCACACTTTCACTATGTATTATCAATAGGGGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTTCCTCTATTCTCAGGCTATACCCTAAATGACACATGAGCTAAAATCCACTTTGCAATTATATTTGTAGGCGTAAATATAACCTTCTTCCCACAACATTTCCTAGGATTATCTGGCATACCACGACGATATTCTGACTATCCAGACGCATACACGACATGAAATACTATTTCATCTATAGGTTCATTTATCTCATTAACAGCAGTTATACTTATAATTTTCATTATTTGAGAAGCATTTGCATCCAAACGAGAAGTCTTAACTGTAGACCTTACTACAACAAATCTAGAGTGACTAAATGGGTGCCCTCCTCCATATCACACATTTGAAGAACCTACATACGTTAATCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Litocranius walleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Still widespread throughout its range, except in parts of Somalia where it has been severely reduced. The total population has been estimated at 95,000, only 10% of which occurred in protected areas. Populations were considered stable in protected areas, but declining elsewhere. East (1999) noted a 50% decline in Kenya since 1970. The ongoing decline is predicted to continue due to hunting and livestock grazing. The level of decline is estimated to have reached at least 25% over 3 generations (21 years) calculated from 1990, thereby almost qualifying for listing as Vulnerable under criterion A2cd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Litocranius walleri is a game animal, even though its not very common, and as a game animal it is protected in most of its range in the form of tags or permits. There are many parks offering sanctuary for them within their range and many biologists and game managers studying them so they are not considered to be at significant risk currently.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Recent population estimates are available for substantial parts of the Gerenuk’s range, mainly from aerial surveys. Summation of the available estimates gives a total of 24,000. Citing various authors, East (1999) indicates that this is probably a substantial underestimate of actual numbers, because of undercounting from the air and the lack of population estimates for regions such as the Ogaden in eastern Ethiopia. Estimates of population density obtained by aerial surveys are generally low, e.g., 0.01-0.06/km² in areas such as the Awash Valley, Borana and Chew Bahir, Tsavo, and Mkomazi; and 0.2-0.3/km² in Sibiloi, Samburu and Murule. Ground surveys in areas where the species is common have produced density estimates of 0.3-l.4/km².

Assuming an average correction factor of 3.5 for undercounting bias in aerial surveys, and that areas for which population estimates are unavailable support an average density of 0.5/km² where the species is known to be common and 0.05/km² elsewhere, East (1999) produced an estimated total population of 95,000. The largest surviving populations occur in south-western Ethiopia and the northern and eastern rangelands of Kenya. Population trend is generally stable in protected areas, with a few notable exceptions such as the declining population of Tsavo National Park, and gradually decreasing elsewhere.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Gerenuk’s shyness and preference for cover enable it to withstand hunting pressures to some degree, and it can be favoured by the spread of thickets which occurs when grasslands are overgrazed by livestock. These attributes have enabled it to survive widely in regions such as the Ogaden in the complete absence of protection. Nevertheless, it cannot persist indefinitely as human and livestock populations increase and subsistence hunting pressure escalates. If current trends continue, it may eventually disappear from large parts of its present distribution until it is largely restricted to effectively protected and managed areas of suitable habitat. Such areas currently comprise only a small part of its remaining range. The largest protected population, in Tsavo National Park, has been reduced by rinderpest and drought (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gerenuk has been eliminated from parts of its historical range in East Africa, but it remains a widespread and relatively common antelope (2). However, outside of protected areas, the gerenuk is threatened by habitat loss and degradation, due to the expansion of agriculture, and is also impacted by hunting (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About 10% of the population is in protected areas. Important protected-area populations occur in areas such as Mago National Park (Ethiopia), Sibiloi, Tsavo and Meru National Parks and Samburu Game Reserve (Kenya) and Mkomazi Game Reserve and Tarangire N.P. (Tanzania). However, the northern subspecies remains poorly represented in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The IUCN currently classifies this species as Lower Risk / Conservation Dependent (1). In the long-term, survival of the gerenuk is likely to be increasingly dependent on the presence of viable populations in national parks and reserves which are effectively protected. Such areas currently comprise only a small part of the range (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse effects of L. walleri on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Litocranius walleri has been a game animal in Africa for over 200 years. Although they are limited in supply for hunters and have a limited range, they continue to be hunted for trophies and for bush meat. In the expanding world of photosafaries and parks in Africa L. walleri will become a regular subject for this endeavor. Unfortunately L. walleri doesn't do well in captivity and has rarely been bred in zoos.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gerenuk

The gerenuk /ˈɡɛrɛnk/, Litocranius walleri, also known as the Waller's gazelle, is a long-necked species of antelope found in dry thorn shrubland and desert in the Horn of Africa and the African Great Lakes region. The word gerenuk comes from the Somali language, meaning "giraffe-necked". Gerenuk are sometimes also called the giraffe-necked antelope. It is the sole member of the genus Litocranius.

Physical description[edit]

Gerenuks have a relatively small head for their body, but their eyes and ears are proportionately large. Only the males have horns and they also have a more muscular neck than females. Both sexes have ruddy brown coats with a paler underbelly . They have short, black tipped tails. The gerenuk is easily recognizable from its distinctive long and skinny neck which can be elongated further if need be for activities like feeding off the taller brambles and undergrowth of the desert. It also has remarkably long slender legs which are another great advantage as they can gallop away into the distance at very high speeds from any form of predator trying to attack. However, because of the extreme length of their legs, they can be more liable to fracture of the leg bone. There have been numerous occasions[citation needed] in which gerenuks actually snapped their long legs due to tripping and stumbling along the ground. From head to tail, the gerenuk is around 150 centimetres (59 in) long. Males are a little taller than females, at 89–105 cm (35–41 in) tall, with the females typically 80–100 cm (31–39 in) tall. The male is also heavier than the female, weighing 45 kilograms (99 lb), while females weigh around 30 kg (66 lb). Many breeders of gerenuks and zoologists have described gerenuks as being extremely humble animals, always helping fellow gerenuks. In ancient African tribal tales, the gerenuk has often been crowned 'Queen of Humbleness.'

Feeding[edit]

Gerenuks feeding

Gerenuks seldom graze but browse on prickly bushes and trees, such as acacias. They can reach higher branches and twigs than other gazelles and antelope by standing erect on their rear legs and elongating their necks. They appear to favour the more tender leaves and shoots, but will also eat buds, flowers, fruit, and herbaceous plants.[2] Gerenuks do not appear to drink water; they get enough water from the plants they eat. Because of this, they can survive in very dry habitats. Gerenuks are often prey for lions, cheetahs, jackals and leopards.

Reproduction[edit]

Gerenuk reproduce throughout the year. Females reach sexual maturity at around one year, and males reach sexual maturity at 1.5 years, although in the wild they may only be successful after acquiring a territory (perhaps 3.5 years).[2] The gestation period is about seven months. They are born one at a time, weighing about 3 kg (6.6 lb) at birth. Offspring were produced through artificial insemination for the first time in 2010 at White Oak Conservation in Yulee, Florida. Four female calves were born, and one of the four was later inseminated successfully by White Oak and SEZARC (South-East Zoo Alliance for Reproduction & Conservation), creating a second generation of calves born from artificial insemination.[3] Gerenuk can live 13 years or more in captivity, and at least eight years in the wild.[2]

Subspecies[edit]

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). "Litocranius walleri". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 21 June 2012. 
  2. ^ a b c Leuthold, Walter (1978). "Ecology of the gerenuk Litocranius walleri". Journal of Animal Ecology 47 (2): 561–580. JSTOR 3801. 
  3. ^ "One of our member institutions working with assisted reproductive techniques". Conservation Centers for Species Survival. Retrieved 3 June 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!