Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

In summer, the goitered gazelle lives in small family groups of no more than 10 individuals, whilst in winter, large herds of dozens, hundreds, or even thousands (in Asia) of animals congregate together (2) (9). This herding behaviour coincides with the breeding season from September to January, during which solitary adult males become territorial and use urine and dung to mark and indicate ownership of their territory within this herd (2) (16). Males also use their expanded throats at this time to emit hoarse bellows, and glandular secretions are smeared on surrounding objects (2) (16). Meanwhile, sub-adult males form bachelor groups of up to five individuals, without individual territories. By contrast, females and young gather in herds of 10 to 30 gazelles during that time. Mating is polygamous, with males chasing females only inside their territory. Territorial males chase females to keep them in their territory and banish any other males, including yearlings. While most males mate with 2 to 12 females, rarely more (to 30 females in some cases), some do not gain access to any females at all. After the rut, goitered gazelles gather in large, often mixed groups of up to 50 individuals, but by spring, males leave mixed groups, and males and females form groups independently. Pregnant females leave their (female) groups and become solitary as it gets close to the time of birth (4) (17). Gestation lasts 148 to 159 days, with calving occurring from March to July, although most females give birth during several days in May (April in Saudi Arabia, and June in Mongolia). Young and old females have a single newborn, but most adult females (75%) have twins, which is rare for other gazelle species. After birth a newborn hides alone while its mother grazes or lies within 50 to 500 m from him. Females lead their infants to new hiding places after each nursing, and twins are bedded 50 to 1000 m apart during the first four to six days. Young start following their mother regularly at the age of 2 to 2.5 months (Kingswood and Blank, 1996), and are weaned after four to five months (2). Some young females have their first oestrus at the age of six months, although most do not begin to breed until 18 months. Males may sire offspring at the age of 10 to11 months, but usually begin to breed only at 2.5 to 3 years of age. (11). Males are reproductive until 10 to 11 years old, though usually they do not live more than five to six years in the wild, and females can bear until the age of 13 to 14 years old (18), typically living 8 to 12 years in the wild (5). During the summer months, goitered gazelles graze most active in the early morning and late afternoon, feeding on grasses, leaves and shoots (2), but in areas with heavily poaching they become to be partly nocturnal (19) (12). Every gazelle eats 6 kg of forage a day, about 30% of its body weight and daily water intake is 2 to 4 litres (11). In the midday heat, these animals shelter in the shade and keep cool by excavating shallow pits to lie in, where the earth is cooler. This midday break is significantly reduced or even eliminated during the cooler winter months (2) (4) (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This gazelle receives its common name due to the goiter-like swelling on the throat, which is an enlarged cartilaginous cylinder that is larger and more distinctive in males, especially during the breeding season, and allows them to emit loud bellows in courtship (2). Unlike most gazelles, females of this species are mostly, although not always, hornless (2) (9), while males boast long, elegantly curved, lyre-like, black horns that diverge outwards and turn back in at the tip (9). Interestingly, horn development in females increases from Mongolia and China, where they are almost completely hornless, to the Arabian Peninsula, where they have well-developed horns. Goitered gazelles vary in colouration between populations, from nearly white to brown with different tones of grey, red or yellow. Generally, the very light brown colouration of the back darkens towards the flanks, where it meets the white underparts in a crisp line, and the black colouration of the first two thirds of the tail contrasts starkly against the white of the buttocks (2). In Central and Middle Asia young have distinct facial stripes and spots on a coloured background, which tend to white and fade with age, but in Saudi Arabia even young have a white face without markings. Eyes are large and black, and the ears are long. Legs and neck are relatively long and the tail is quite short. Males are larger and heavier than females (3) (4) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Goitered gazelle are common in the southern Arabian Peninsula, through southern Kazakhstan and Mongolia, to northwestern China. Elsewhere, they have significantly declined and occur mostly in remote areas or on protected reserves. Small populations exist in western and southern Afghanistan and Pakistan. In southeastern Turkey, northern Saudi Arabia, the Rub al Khali Desert, and Wahiba Sands of Oman much larger populations occur. In the central deserts of Iran, goitered gazelles are common and have begun to increase in protected regions. They have been introduced to Barsa-Kel’mes and Ogurchinsky Islands in the Aral and Caspian Sea, respectively, and to locations throughout the United Arab Emirates.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Occurs from the south of the Arabian Peninsula across the Middle East and Asia to Mongolia, China and Pakistan. Their historical range has contracted greatly, and they are now extinct in Kuwait, Georgia, and perhaps Kyrgyzstan (Mallon and Kingswood 2001).

The historical range of Arabian Sand Gazelle (the only subspecies assessed here) covered the Arabian Peninsula north to southern Iraq and Kuwait. The taxon is currently found in Bahrain (Hawar Island and southern part of Bahrain Island); Oman (Dhofar, edge of Rub al Khali to Arabian Oryx Sanctuary); United Arab Emirates (Umm al Zummur area); Saudi Arabia (four populations, all in protected areas); Jordan (north-east); Syria, Iraq and Yemen. It is now extinct in Kuwait (Mallon and Kingswood 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The goitered gazelle once ranged widely from the south of the Arabian Peninsula across Saudi Arabia, Yemen, Oman, United Arab Emirates (UAE), Turkey, Iran, Iraq, Afghanistan, Pakistan, Transcaucasia, former Soviet Central Asia (Turkmenistan, Tadjikistan, Uzbekistan, Kazakhstan), and western China to southern Mongolia. However, this range has contracted rather drastically since the beginning of the 20th century, and the species is now locally extinct in many regions, including Georgia, Iraq, Kuwait, Syria and Yemen, and near extinct in Jordan (1). Subspecies: Hillier's goitered gazelles or Mongolian gazelles (G. s. hillieriana) live in the Mongolian Gobi, Yarkand or Xingjian goitered gazelles (G. s. yarkandensis) inhabit the Western Xingjian of China, Persian gazelles (G. s. subgutturosa) inhabit the vast areas of Middle Asia (Kazakhstan, Turkmenistan, Uzbekistan, Tadjikistan), Iran, Iraq and Afghanistan, and Arabian Sand gazelles (G. s. marica) live in the Arabian Peninsula (7) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Goitered gazelle are medium-sized, lightly built ungulates; however, they have a more robust body type than most other Asian Gazella species. Goitered gazelle get their name from the goiter-like enlargement on their larynx. They are sexually dimorphic as males are larger than females and have longer horns and larger goiters than females. Adult males range in mass from 20 to 43 kg and adult females range in mass from 18 to 33 kg. Adult males have long, black horns that are 203 to 340 mm long, which are close together at their base and curve away from each toward the distal ends. Unlike most other gazelle species, females are generally hornless. Goitered gazelle have long ears with large black eyes. At the end of their long slender legs are small black hooves. The coxofemoral joint muscle is strengthened in goitered gazelles, enabling a strong thrusting motion that stabilizes running in rough terrain. Pelage color varies geographically, from white to brown with shades of grey, red, and yellow. Facial pelage is often white and tends to fade with age. They have relatively a short tail, which is covered with dark brown or black hair. In the winter their pelage becomes longer, thicker, and lighter in color when compared to summer pelage.

The skull of goitered gazelle has an inflated and less downwardly deflected posterior braincase. Their occipito-parietal suture is angular, the premaxillae is nearly straight, and the fronto-nasal and palato-maxillary sutures are V-shaped. In addition to their well developed lachrymal fossae, they have large, inflated tympanic bullae lacking ventral ridges. Finally, the supraorbital foramina are recessed in deep pits and male skulls are easily identified by their large horn cores, also known as the cornual process. Their skull is easily distinguished from other gazelle species by its larger size, broader palate and greater orbital width. Female skulls with horns are distinguished from female mountain gazelle skulls by their slightly greater orbital and palatal width and larger lachrymal pits.

Goitered gazelle have high crowned (i.e., hypsodont) selenodont teeth. Their dental formula is 0/3, 0/1, 3/3, 3/3, for a total of 32 teeth. Calves are born with 3 incisors, 1 canine, and 3 deciduous cheekteeth on both sides of the lower jaw. In their upper jaw, calves are born with only 3 premolars on each side. During their first year, two permanent molars erupt and at 14 months, their third molar erupts along with the replacement of their deciduous molars with 3 premolars.

Although 4 inguinal mammae can form, female goitered gazelle typically have 2. In general, goitered gazelle have inguinal, carpal, pedal, and preorbital glands. The inguinal and carpal glands secrete a yellow, waxy substance with a musky odor. Their preorbital glands produce a black secretion and can be much larger in males.

Range mass: 17.5 to 43 kg.

Range length: 940 to 1260 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • 2009. "Gazella subgutturosa" (On-line). Encyclopedia of Life 2. Accessed April 06, 2009 at http://www.eol.org/pages/129520.
  • Heptner, V., A. Nasimovich, A. Bannikov. 1988. Mammals of the Soviet Union. Washington, D.C.: Smithsonian Institution Libraries and the National Science Foundation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Goitered gazelle inhabit various types of desert and semiarid terrain occurring in foothills and montane valleys. They graze at the edge of cultivated land, while avoiding land used for cultivation or livestock grazing. Their habitats range from clayey and sandy soil to basalt deserts or salt flats. The can occupy areas virtually absent of vegetation to areas that support grasses, forbs, and shrubs. Goitered gazelle are limited in their northern distributions by areas where snow depths reach 10 to 15 cm during winter. During winter they inhabit windy snow-free areas and use deep valleys, low mountain canyons, or dense shrubs as shelter from the wind. Throughout their geographic range, they can occupy habitat from sea level to 3,500 m. In Iran they are found from sea level to about 2,100 m and from 1,050 m to 2,100 in Pakistan. In Afghanistan they are only found below 1,000 m. Goitered gazelle often occupy higher altitudes during summer, ranging from 3,000 m to 3,500 m in the mountains of Kazakhstan, Mongolia, and China.

Range elevation: 0 to 3500 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits a wide range of semi-desert and desert habitats. Ascends into foothills and penetrates mountain valleys in Central Asia, to altitudes of 2,700 m in Mongolia (Bannikov 1954). They migrate seasonally in search of pasture and water. Arabian Sand Gazelle prefers areas of dunes and sandy desert in the Arabian Peninsula.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A wide variety of desert and semi-arid habitats are occupied (11). They occur in flat and rolling areas, but prefer foothills with broken grounds, and mountain valley and plateaus, avoiding rocky cliffs, thick woody vegetation, and lands used for agriculture or intensive livestock grazing and areas devoid of gullies and ravines (11) (12). The northern distribution is limited by snow depth in winter, because these gazelles cannot reach food where snow cover reaches depths of 10 to 15 cm (13). Here, aggregations of several thousand may form at lower altitudes in winter to avoid the snow, but disperse to higher altitudes in summer (9). Goitered gazelles can live from sea level up to around 3,000 m in China, and can even climb to elevations of 3,500 m during the warmer months in Kazakhstan (4) (11) (12) (14) (15).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Goitered gazelles are herbivores and generally eat grasses. Often their diet includes halophytes, composites, legumes, caltrops, ephedras, gourds, leadworts, and tamarisks. In agricultural areas, the variety of food eaten by goitered gazelles expands to include fruits, barley shoots, chick peas, cotton, dates, maize, melons, onions, sugar cane, and wheat. Goitered gazelles are facultative drinkers and gain a majority of their water from ingested plant material. They appear to prefer plants with high protein content. In captivity, goitered gazelles are fed alfalfa, oats, enriched grain pellets, and sulfur-free salt blocks. Because they are obligate herbivores, goitered gazelle have four-chambered stomachs (1 true stomach, 3 false stomachs) in which cellulolytic digestion occurs and are capable of storing graze in one or more of their "false stomachs".

Plant Foods: leaves; fruit

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Goitered gazelle are host to numerous species of parasites. Eighteen species of parasitic worms have been found in goitered gazelle in Kazakhstan, although their pathogenic effect is currently unknown. The larvae of 2 species of ectoparasitic botfly, Pavlovskiata subgutturosae and Crivellia corinnae, are commonly found implanted in the skin of goitered gazelle. They are also vulnerable to parasitic arthropods such as ticks and lice during summer. In addition to being an important prey item for numerous species mammals and birds, goitered gazelle forage on various types of plants and may compete with saiga antelope for forage in some areas throughout their geographic range.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main predator of goitered gazelle is gray wolves. During winter, when snow cover increases, wolves become especially effective predators due to increased vulnerability of animals. Tigers also prey on gazelle at water holes, and in Turkmenistan, they are hunted by cheetahs. Young goitered gazelle are preyed on by foxes, feral dogs, caracals, imperial eagles, and brown-necked ravens.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Goitered gazelles communicate using a series of deep grunts, hissing, moos and wheezing. Grunts are made by adults and young and before running, they often make a nasal hiss as an alarm. Females make hoarse, low-pitched sounds to call their young and young respond by making a low-pitched “moo”. During breeding season, males make a low, basal wheezing sound, which can be heard 100 to 150 m away. They also use glandular secretions to demarcate territorial boundaries and communicate with conspecifics, especially during breeding season.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Annual mortality rates for goitered gazelle vary in relation to sex and age class. Female mortality rates range between 9 and 18%, whereas male mortality rates range between 27 and 58%. Mortality rates for calves and juveniles are highly variable, ranging between 3 and 58%. Mortality rates tend to be lowest during summer and highest during winter. The longest known lifespan of goitered gazelles in the wild is 12 years, with an average lifespan of 6 years. The longest known lifespan of captive goitered gazelles is 20 years.

Primary causes of natural mortality in goitered gazelles include deep snow and ice-covered ground, which severely limits forage availability during winter. Mortality is also caused by entrapment in drying asphalt, drowning, and car collisions. In captive animals, causes of mortality include stress or trauma, fence injuries, and intraspecific fighting. Pathogens known to cause mortality among goitered gazelles include Corynebacterium pyogenes, Mycobacterium, Cryptosporidium, and Escherichia coli.

Range lifespan

Status: wild:
12 (high) years.

Range lifespan

Status: captivity:
20 (high) years.

Average lifespan

Status: wild:
6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.3 years (captivity) Observations: In the wild these animals are expected to live up to 12 years (Bernhard Grzimek 1990) but may live up to 16.3 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During breeding season, which occurs from September to December, individual male goitered gazelle herd and chase females into their territories and only mate with females that remain in their territory for an extended period of time. Males compete for territory prior to mating season and mark their territories by defecating in small pits that they dig with their front hooves. Often, when males find a territorial pit that is already filled, he digs out the pit and refills it with his own excrement. Just prior to breeding season, inguinal and preorbital glands of male goitered gazelle swell and increase secretion volume for courtship. Male displays during courtship include neck stretching, nose-up posturing, releasing of pheromones, foreleg kicking, and assuming an erect posture. Courtship begins after females stay in a male’s territory overnight.

While goitered gazelle form large herds in winter, gestating females leave and create small groups with one or two other gestating females. Most males mate with 2 to 12 females, however, some males do not mate at all. Males mount their mates by standing on their hind legs with their forelegs spread apart and touching her with only his pelvis.

Mating System: polygynous

Goitered gazelle become sexually mature within 1 year. Although first estrus usually occurs between 6 and 18 months, females can conceive as early as 5 months old. Males can sire offspring as early as 10.5 months old, however, they do not usually mate before 1.5 to 2.5 years old and can remain reproductively active for over 10 years. Onset of spermatogenesis occurs when the testis reach 20 mm in diameter. Males experience seasonal sperm production, which peaks during fall and spring. Breeding season occurs from November through January and can vary in timing throughout their range. Estrus usually lasts for about 12 hours, signaled by a slight swelling of the vulva. Copulation last 1 to 3 seconds, and gestation lasts for 148 to 159 days. Females move to areas with high ground or vegetative cover prior to birthing. Young are usually born between March and May. Most adult females (3 to 7 years old) have twins, although young and old females generally give birth to a single calf. On average, calves weigh 1.86 kg at birth and are completely weaned by 6 months, at which point they become independent of parental care.

Breeding interval: Goitered gazelle breed once yearly.

Breeding season: September through January

Range number of offspring: 1 to 4.

Range gestation period: 5 to 6 months.

Range weaning age: 3 to 6 months.

Average time to independence: 6 months.

Range age at sexual or reproductive maturity (female): 5 (low) months.

Average age at sexual or reproductive maturity (female): 12 months.

Range age at sexual or reproductive maturity (male): 10.5 (low) months.

Average age at sexual or reproductive maturity (male): 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Goitered gazelle give birth to precocious young that can stand and nurse within 10 to 15 minutes after birth. After birth, females tend to graze 50 to 500 m from their calves and seek a new hiding place for their calves after each nursing bout. If a female has twins, she often keeps them 50 to 1,000 m apart for the first 4 to 6 days. Calves are nursed 2 to 4 times a day during their first 6 weeks and are nursed for at least 3 to 6 months. Calves are able to graze and drink water at 4 to 6 weeks old. Goitered gazelle calves have extremely high growth rates during their first month of life, with 50% of their growth occurring within the first 10 days after birth. At 18 to 19 months, most calves have reached adult size. Calves are born with whirls of hair were their horns develop. Horn growth occurs at 3 to 6 months and is complete by 1 to 1.5 years. Male horns continue to grow until age 6, whereas female's reach full size by 2 to 3 years old.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella subgutturosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCTTTAAGCTTACTAATCCGTGCTGAATTAGGTCAACCCGGAACTTTACTCGGAGATGATCAAATTTATAATGTAGTCGTAACCGCACATGCGTTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTAATAATTGGTGCCCCCGATATAGCATTTCCTCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTATTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGTAACCTAGCTCACGCAGGTGCTTCAGTAGATCTAACCATTTTCTCTCTTCACCTGGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAACATGAAACCTCCCGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCTGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTATATCAACATCTGTTCTGATTCTTCGGACACCCTGAAGTGTATATTCTAATCCTACCCGGATTCGGAATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATGTCCATTGGGTTTCTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGACGTTGATACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGGTCACCCGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTTCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTATTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTCTCAGGCTATACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACACTTCTTAGGATTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATATTAATAATTTTCATCATTTGAGAAGCATTTGCATCCAAACGGGAAGTCCTAACCGTAGACCTTACCACAACAAATTTAGAGTGACTAAATGGATGCCCTCCCCCATACCACACATTTGAAGAACCCACATACGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazella subgutturosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In 1900’s, goitered gazelles were abundant, found in almost every desert or semi-desert area throughout the Middle East and Central Asia. In the mid-1900's, nearly one million were estimated to have lived in the Soviet Union alone. In 2001, their entire population was estimated at 120,000 to 140,000. This significant decrease has occurred in the past decade, and the rate of decrease is now measured to be more than 30% over the last ten years. The IUCN Red List of Threatened Species classifies goitered gazelles as vulnerable. While population declines are occurring throughout their entire range, declines are particularly dramatic in Turkmenistan, Kazakhstan, southeast Turkey and Azerbaijan. Local extirpations have occurred in Kuwait, Georgia, and possibly Kyrgyzstan. Populations in Mongolia, where about a half the current population resides, are also in decline. Major threats include unrestrained poaching and habitat destruction. Habitat destruction is primarily due to economic and agricultural development. In central Asia, harsh winters appear to have had a significant negative effect on goitered gazelle abundance.

In the mid to late 1300's, muslim armies under the command of Timur Leng were noted hunters of goitered gazelle, killing an estimated 40,000 each year. After automobiles were introduced in the 1930's, hunting for goitered gazelles became particularly easy as people would chase animals in their cars during the day, or shoot them at night while "shining" them (i.e., using artificial lights to locate and temporarily freeze animals) with their headlights. Using automobiles to hunt goitered gazelles was outlawed in the Union of Soviet Socialist Republics in the 1940's.

Since the 1950's, legal protection has been enforced either nationally or sub-nationally throughout most of goitered gazelles' geographic range. Although numerous reintroductions have been attempted, conservation efforts have been unsuccessful. Some countries (e.g., Turkey and Uzbekistan) have developed captive breeding programs and much of the current population uses protected habitat. Many gazelle die during winter due to malnutrition. Future conservation efforts may include restricting livestock grazing areas during winter or restricting livestock from entering habitat reserves used by goitered gazelles.

US Federal List: endangered

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ad

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Mallon, D.P. & Plowman, A. (Antelope Red List Authority)

Contributor/s

Justification
Numbers were estimated at 120,000-140,000 in Mallon and Kingswood (2001) and the taxon has a very wide distribution across the Middle East and Asia. However, populations throughout the range are subject to illegal hunting and habitat loss. Declines are widely reported and continuing. The population in Turkmenistan has almost disappeared in recent years. The largest population in Kazakhstan, formerly numbering c. 20,000, has also drastically declined in the last few years. In Mongolia, a substantial proportion of the known global population remained until recently, but heavy poaching has wiped out almost all the large herds and cut the numbers by well over 50%. Overall the rate of decline is now estimated to have exceeded the figure of 30% over 10 years that qualifies for Vulnerable under criterion A2.

History
  • 2006
    Vulnerable
    (IUCN 2006)
  • 2006
    Vulnerable
  • 2003
    Near Threatened
    (IUCN 2003)
  • 2003
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1) and listed under Appendix II of the Convention on Migratory Species (CMS) (6). One subspecies is listed on the IUCN Red List: the Arabian sand gazelle (G. s. marica) is classified as Vulnerable (VU) (1). Several other subspecies have been listed based on morphological characteristics, but most have not been verified by genetic analysis, and are not listed individually on the IUCN Red List (1). Nevertheless, the following subspecies are all considered Vulnerable: Hillier's goitered gazelles or Mongolian gazelles (G. s. hillieriana), Yarkand or Xingjian goitered gazelles (G. s. yarkandensis) and the Persian gazelles (G. s. subgutturosa) (7) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Numbers were estimated at 120,000-140,000 in Mallon and Kingswood (2001), but populations throughout the range have decreased since then and are subject to continuing illegal hunting and habitat loss. The former population in Turkmenistan has virtually disappeared. A large former population (c. 15,000) in Kazakhstan has also drastically declined in recent years. Small numbers occur in south-east Turkey (Ceylan Pinar, ca. 200 individuals in an enclosure; M. Masseti pers. comm. 2007), and c. 4,000 in Azerbaijan. In Iran, numbers were estimated at a little over 4,000 in 2001, virtually all in protected areas. In some of these poaching is still a factor and numbers are still declining. Drastically reduced in Pakistan, and may be on the verge of extinction there. Mongolia is thought to contain the largest remaining population of the species (estimated at 60,000 in the early 1990s; Amgalan 1995), so holding an estimated 40-50% of the global population (Lkhagvasuren et al. 2001). However, this population has been heavily reduced by poaching in the last 2-3 years and this decline is continuing.

The total population of Arabian Sand Gazelle is estimated to be less than 10,000 and certainly less than 10,000 mature individuals, with country population estimates as follows: Saudi Arabia (2,650-3,050 in four populations); United Arab Emirates (up to 1,000); Oman (no information on population size); Bahrain (350-400 on Hawar; 450-500 on Bahrain Island); Yemen (no information); Syria (approximately 100 seen in southern Syria in 1998 (Habibi 1998)); Jordan (rare); Iraq (up to 1,000 were reported by Al-Robaae and Kingswood (2001)).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats are illegal hunting (for meat and to a lesser extent for trophies) and habitat loss (due to economic development, conversion to agriculture, increasing numbers of domestic livestock). In Central Asia the species is susceptible to the effects of severe winter weather. In Arabian Peninsula some are live-caught for private collections.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Throughout their range, goitered gazelles are the victims of illegal hunting and habitat loss, and although still widely spread, their numbers are declining and their distribution is uneven. While substantial populations are thought to remain in Mongolia and Kazakhstan, declines are widely reported elsewhere, and some populations, such as those in Turkmenistan, have almost disappeared completely. Most populations are now small and isolated from one another, leaving them vulnerable to further reduction. This species has been hunted for its meat and, to a lesser extent, for trophies, while the Arabian subspecies has also suffered from occasional live-capture for private collections. Habitat has been lost and severely degraded due to economic development, conversion to agricultural land, and overgrazing by increasing numbers of domestic livestock (1) (4). The Arabian subspecies in particular suffers from competition for food with domestic sheep and goats (16). In Central Asia, the goitered gazelle is also vulnerable to the effects of severe winter weather (1). At present, the total number of this species in the wild is no more than 120,000-140,000 individuals, whilst around 529 individuals exist in captivity (4) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Legally protected in most range states, although enforcement is not universally effective. The species occurs in many protected areas across its range. The species has been reintroduced to various parts of its former range (e.g., Al Talila, 30 km south of Palmyra in Syria; Masseti 2004), and reintroduction of the nominate form is under consideration in Georgia.

The Arabian Sand Gazelle occurs in several protected areas, including: Al-Khunfah, Harrat al-Harrah, Mahazat as-Sayd, Uruq Bani Ma?arid (Saudi Arabia); Arabian Oryx Sanctuary (Oman); and South Bahrain Island (Bahrain); although not formally designated as a PA, access to Hawar Island is restricted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The goitered gazelle is legally protected across all countries it inhabits, except Iran, where traditionally these gazelles are used for legal trophy hunting. Even elsewhere where legal protection exists, the law is not necessarily enforced effectively. Consequently, the species mostly remains only in protected areas such as nature reserves, and may increasingly grow to rely on national parks and reserves for safe refuge (1). Most countries have special areas for protection of goitered gazelle populations, but the level of real protection inside these areas depends considerably on economic level and political stability in one or other country (4) (14) (20). Reintroduction programmes are being conducted in Saudi Arabia to create new wild populations of these gazelles (19) and could provide a model for future reintroductions elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Goitered gazelles occasionally damage agricultural plants such as cotton. They also consume saxaul shoots, which is considered one of the most valuable desert plants throughout the goitered gazelles geographic range. In spring and fall, they often intrude into domestic sheep pastures.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goitered gazelles are hunted for their meat and hide, which is considered high quality and is processed into chamois and box calf. A single goitered gazelle yields between 12 and 18 kg of meat and 0.6 to 0.7 m^2 of hide. Goitered gazelle are hunted for sport, challenging hunters with their ability to run at high speeds. In addition, they are sometimes used as pets or given as gifts.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Goitered gazelle

The goitered or black-tailed (Gazella subgutturosa) is a gazelle found in northern Azerbaijan, part of Iran, parts of Iraq and southwestern Pakistan, southeastern Turkey, Afghanistan[1] and the Gobi Desert. The specific name, meaning "full below the throat", refers to the male having an enlargement of the neck and throat during the mating season.

The goitered gazelle inhabits sands and gravel plains and limestone plateau. It runs at high speed, without the leaping, bounding gait seen in other gazelle species. Throughout much of their range, goitered gazelles migrate seasonally. Herds cover 10–30 km per day in the winter, with these distances being reduced to about 1–3 km in summer.

Large herds were also present in the Near East. Some 6,000 years ago, they were captured and killed with the help of desert kites.[2][3] Rock art found in Jordan suggests ritual slaughter.[2]

Until recently, goitered gazelles were considered to represent a single, albeit polymorphic, species. However, recent genetic studies show one of the subspecies, G. s. marica, is paraphyletic in respect to the other populations of goitered gazelles,[4] although gene introgression is observed in the contact zone between the two species.[5]

Subspecies[edit]

Several subspecies have been described. Groves & Leslie (2011) distinguish four forms, which they treat as separate monotypic species.[6] Wacher et al. [4] suggest G. s. marica is a separate species, Gazella marica.

  • Persian gazelle (Gazella (subgutturosa) subgutturosa) - southeastern Turkey, Azerbaijan, Syria, northern and eastern Iraq, Iran, southern Afghanistan, western Pakistan
  • Turkmen gazelle (Gazella (subgutturosa) gracilicornis) - Kazakhstan in the east to about Lake Balkash, Turkmenistan, Tajikistan
  • Yarkand gazelle (Gazella (subgutturosa) yarkandensis) - northern and northwestern China (Xinjiang, Qinghai, Shaanxi, Gansu, Nei Monggol), Mongolia; includes subspecies hilleriana
  • Sand gazelle (Gazella (subgutturosa) marica) - Saudi Arabia, southern Syria, southwestern Iraq, United Arab Emirates, Oman, offshore Persian Gulf islands

It is listed as an endangered species in Pakistan.[citation needed]

References[edit]

Gallery[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!