Overview

Brief Summary

Biology

Adapted to life in hot, dry regions, Speke's gazelle feeds in the morning and evening, resting during the hotter parts of the day (4). Around May, the appearance of large numbers of biting tabanid flies force the Speke's gazelle to move towards the coastal dunes, where the flies are dispersed by coastal winds (1). Herds are relatively small, consisting of five to ten individuals (3), though occasionally larger groups will form in response to more abundant grazing (2). Herds are controlled by a territorial male (3), and territories are marked by urination, defecation and scent produced by preorbital glands (2) (6). Seasonal breeders, Speke's gazelles mate during December and January, with the female delivering a single calf around May or June, after a gestation period of five and a half months (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A small, delicate-looking gazelle with a remarkable, inflatable nasal sac (2), Speke's gazelle is now, sadly, threatened with extinction (1). The upperparts of this diminutive species are coloured brownish-fawn and separated from the white underparts by a dark stripe running along the flanks (3). The head is also brownish-fawn, with facial patterning consisting of bold dark and white markings (3). The horns of this species are broadly ringed (more prominently in the males), curving back from the head in a loose S-shape (2) (3). As with other species of gazelle, the horns of Speke's gazelle are longer in the male than the female, with the male's horns averaging at 29 centimetres (3). It is the unusual, nasal sack which really makes this species stand out. Normally, this sac takes the form of loose folds of skin behind the nostrils, but when alarmed or excited it can be inflated (3). The inflated sac forms a hollow chamber amplifying the loud sneeze-snorts that this animal makes as an alarm call (4) and, perhaps, as a means of announcing status (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Endemic to the Horn of Africa. Inhabits the 20 to 40 km wide grassland plain that extends along the Indian Ocean coastline of Somalia (hunting pressure has eliminated Speke?s Gazelle from coastal grasslands south of 2°30'N latitude). Northern limit delimited by steep hills of the Gulis Range. Scattered groups of Speke's Gazelle were still rarely encountered in the northern Ogaden in eastern Ethiopia in the mid-1980s, but extreme hunting pressure was on the verge of eliminating the species from the Ogaden at that time. Attempts to evaluate the possible occurrence in the north-eastern Ogaden (Ethiopia) are planned, but the current security situation makes efforts to get there difficult. Interviews with local people have revealed that it is infrequent or absent from this region.

Speke?s Gazelle were formerly widespread in the open barren grasslands of north-central and north-eastern Somalia and the central coastal region. It occurred widely within its historical range in the 1980s, although its numbers had been reduced greatly by hunting, drought and overgrazing of its habitat by domestic livestock. It was common on the central coastal plain in the mid-1980s (Thurow, in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the Horn of Africa (1), Speke's gazelle was once widespread and abundant throughout north-central and north-eastern Somalia (5). Today, Speke's gazelle is believed to be confined to the 20 to 40 kilometre wide grassland strip running along the coastal plains of Somalia. Its northern limits are defined by the steep hills of the Gulis Range, while its southern limits have been created by uncontrolled hunting. In the past, Speke's gazelle was also occasionally encountered in north-eastern Ethiopia, though its continued presence there, in the face of severe hunting pressure, seems unlikely (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Most common on semi-arid grasslands, but also found in dwarf shrub (e.g. Indogofera intricata) and barren rangelands, at altitudes below 2,500 m. The presence of a biting tabanid fly (Haematopota sp.) during the mid-growing season prompts movements to the coast or large inland sand dunes where the breeze disperses the flies. They also move to these areas in the late dormant season because the sparse vegetation stays green longer on these sites, possibly because the roots access soil moisture stored deeper in the dunes (Thurow, in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Speke's gazelle inhabits semi-arid, grassland and stony, semi-desert regions with sparse vegetation that includes shrubs, succulents and desert grasses (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one wild born specimen was about 14 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella spekei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCATAAGGATATTGGTACCCTATATCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCTTTAAGCTTACTAATCCGTGCCGAACTAGGCCAGCCCGGAACTTTACTCGGAGACGATCAGATTTATAATGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGGTTTGGTAATTGACTAGTCCCTCTAATAATTGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTATTACTTCTGGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGTAACCTAGCTCACGCAGGTGCTTCAGTAGACCTAACCATTTTTTCCCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAACATGAAGCCTCCTGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCCGTTCTGATTACCGCTGTACTGCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGACCCAATCCTGTATCAACATCTGTTCTGATTCTTCGGACACCCTGAAGTGTATATTCTTATTCTACCCGGATTCGGGATAATCTCTCACATCGTCACCTATTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATATCTATTGGGTTCTTAGGGTTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGACGTTGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGAGTAAAAGTTTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGATCACCTGCTATAATGTGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTCCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTGCTATCAATAGGAGCTGTATTTGCCATTATAGGAGGATTCGTACACTGGTTCCCACTATTTTCAGGCTACACCCTCAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACCTTCTTCCCACAACACTTCTTAGGCCTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCTTACACAATATGAAACACTATCTCATCTATGGGCTCATTCATCTCACTAACAGCAGTTATACTAATAATCTTTATCATTTGAGAAGCGTTTGCATCCAAACGGGAAGTTCTAACCGTAGACCTCACCACAACAAATTTAGAGTGACTAAATGGATGCCCTCCCCCATACCACACATTTGAAGAGCCCACATACGTCAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella spekei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Heckel, J.-O., Amir, O.G., Kaariye, X.Y. & Wilhelmi, F.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
The Ethiopian population is extinct or close to extinction. Numbers in Somalia have declined steeply and are continuing to decline due to uncontrolled hunting, drought and habitat degradation through overgrazing. The rate of decline is estimated to have reached 50% over a period of three generations (18 years, 1988 to 2006), due to a decline in range and/or habitat quality and actual or potential levels of exploitation.

History
  • 2007
    Endangered
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated that the population may number in the tens of thousands. It was traditionally not hunted by many local people who regarded it as ?the devil?s livestock? but had been eliminated along roads by soldiers in areas of conflict (Thurow in press). However, numbers have been falling steadily for over 20 years due to uncontrolled hunting. The former strongholds in the Coastal and Nogaal plains of Somalia have been under severe pressure during the past two decades of civil war and there is no evidence that it still occurs in Ethiopia. A recent survey to the southern Nogaal region in Somaliland revealed that the species still exists in this area, but sightings are rather scarce.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Extreme political instability and periodic civil and military conflicts over the past 20 years (and continuing) in Somalia, combined with a lack of any central government control, has resulted in a prevalence of weapons, over-exploitation of wildlife, and lack of protection for wildlife. There are no functioning protected areas within its range. An illegal wildlife trade, including in antelopes, has developed in Somalia during the last few years (Amir 2006).

Drought and overgrazing due to increasing numbers of domestic livestock have negatively affected habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uncontrolled hunting for its meat, competition with domestic livestock for grazing, degradation of its habitat and drought are all serious, ongoing problems for the survival of Speke's gazelle (1) (5). Unfortunately, Somalia's unstable political climate over the last 20 years has meant that there has been no centralised government to implement any protective measures for this species (1). More recently an illegal wildlife trade, which includes antelopes, has developed, yet another threat to a species whose survival is already at risk (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no functioning protected areas or active field conservation programmes within its range. Its conservation status is therefore likely to decline further unless effective protection and management or representative populations and their habitat can be developed and implemented. Populations of Speke's Gazelle are maintained in captivity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

It was predicted in 1998 that, in the absence of protective measures, Speke's gazelle would decline in conservation status from Vulnerable to Endangered (5). The fact that this change in conservation status has occurred, highlights the uncertain future of this species in the wild. The total population of Speke's gazelle declined by 50 percent in the period 1988 to 2006, and there are still no schemes in place to protect this animal or its habitat within its current range (1). There are, however, a number of populations being successfully bred in captivity, which will at least serve to protect this unique animal from total extinction and offer a hope for the reintroduction of populations to the wild (1) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Speke's gazelle

Speke's gazelle (Gazella spekei) is the smallest of the gazelle species. It is confined to the Horn of Africa, where it inhabits stony brush, grass steppes, and semideserts.[2] This species has been sometimes regarded as a subspecies of the Dorcas gazelle, though this is now widely disregarded.[3] Severe habitat fragmentation means it is now impossible to assess the natural migratory or nomadic patterns of G. spekei.[4] Its numbers are under threat, and despite an increase in population, the IUCN in 2007 announced its status had changed from vulnerable to endangered. A captive population is maintained, and the wild population exists in the lower tens of thousands. As of 2008, this gazelle is classified as endangered under the IUCN Red List.

Speke's gazelle is named after John Hanning Speke, an English explorer of Central Africa.

External link

Speke's gazelle facts

References

  1. ^ "Gazella spekei". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2007. Retrieved 12 September 2007.  Listed as Endangered (EN C1 v2.3)
  2. ^ Kingdom 1982, 1997
  3. ^ Groves 1969
  4. ^ East 1996
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!