Overview

Brief Summary

Biology

In the past, the attractive Soemmerring's gazelles used to gather in their hundreds as they undertook seasonal migrations (2). Today, this magnificent sight is rare, as the gazelle is seldom seen in herds composed of more than 15 individuals. These are often herds of females and their young, accompanied by a single adult male on his territory. The territorial male marks his range with dung, and should another male venture onto his land, aggressive confrontations may ensue (2). Such encounters involve scraping their horns on the ground (3), head-flicking, and yanking their opponent's horns sideways in an attempt to destabilise their rival (2). Mating in Soemmerring's gazelle peaks between September and November (2). After a gestation of around 198 days, the female gives birth to a single calf that lies well hidden in grass until it is strong enough to keep up with its mother (3). This usually takes about a month (2), during which time the mother returns to her calf only to nurse it (3). By the age of six months the calves are weaned, and by just 18 months the gazelle is sexually mature and capable of reproducing. Soemmerring's gazelles live for up to 14 years (2). Soemmerring's gazelles feed primarily on grasses (5); their narrow muzzle and mobile lips enable them to carefully select the best quality grass (3). The main predators of Soemmerring's gazelle include cheetahs, lions, leopards, Cape hunting dogs, hyenas and even pythons (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

These large, pale gazelles once gathered in their hundreds on the open plains of the Horn of Africa (2). Soemmerring's gazelles bear short, heavy, lyre-shaped horns that sweep backwards and point inwards at the tip. The large head is also distinctive due to the prominent facial markings (2); dark stripes run down the nose and from the corners of the eyes to the nose, separated with white stripes (3). Soemmerring's gazelle has a tawny-red coat on its back, with an extensive white patch on the rump. Its undersides are bright white, as are its long legs, ending in large hooves (2) (3). The short, tapered tail is mainly white but ends in a black tuft (2) (3). Three subspecies of Sommerring's gazelles are recognised, each distinguishable by aspects of their appearance. Gazella soemmerringii soemmerringii has a brown face and shorter horns; the face of G. s. berberana is blacker and it bears longer horns, and G. s. butteri has darker flanks and stripes on its thighs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Soemmerring's Gazelle has a tawny-red coat, an extensive white patch on the rump and prominent facial markings - dark stripes run down the nose and from the corners of the eyes to the nose. Both sexes have lyre-shaped horns that point inwards at the tip but those of males are larger.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Formerly widely distributed throughout most of Djibouti, northern Somalia and the central coastal plain; north-east and central Sudan; lowland areas of Eritrea, the Ogaden and other lowland areas of eastern Ethiopia (Schloeder and Jacobs in press). At one time, this gazelle may have occasionally ventured as far south as extreme north-east Kenya (East 1999) but there is no recent information on its occurrence in this area. The population on Dahlak Kebir Island was probably introduced over 100 years ago (Yalden et al. 1996).

Uncontrolled hunting and habitat destruction have most probably eliminated this species from its historic range in Sudan (East 1999). It still occupies substantial parts of its historical range in Djibouti, Somalia, Eritrea, and Ethiopia, but at lower densities and as isolated populations; numbers in the Ogaden are greatly reduced due to uncontrolled hunting (Wilhelmi et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the Horn of Africa (2), Soemmerring's gazelle occurs in Djibouti, Eritrea, Ethiopia, Kenya, Somalia and Sudan (1). G. s. soemmerringii occurs primarily in Sudan, G. s. berberana is found in Somalia and G. s. butteri primarily inhabits southern Ethiopia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occupies arid coastal plains and mudflats, arid and semi-arid Acacia savannas, and semi-arid grassland plains. Tends to prefer rough hilly country, but also found in open bush savannas, and thinly-wooded grasslands (Schloeder and Jacobs, in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Endemic to the Horn of Africa Soemmerring's Gazelle occurs in Djibouti, Eritrea, Ethiopia, Kenya, Somalia and Sudan. This species favors rough, hilly country and semi-arid grasslands, often with scattered Acacia trees and bushes.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soemmerring's gazelle inhabits rough, hilly country and semi-arid grasslands, often with scattered Acacia trees and bushes (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Prey: predators include cheetahs, lions, leopards, hunting dogs, hyenas and pythons

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Life History and Behavior

Behavior

Soemmerring's Gazelles feed primarily on grasses; their narrow muzzle and mobile lips enable them to be selective in their choice of high-quality grasses. Predators of Soemmerring's Gazelle include cheetahs, lions, leopards, hunting dogs, hyenas and even pythons.

Historically, Soemmerring's Gazelles gathered in herds of many hundreds during seasonal migrations. Today, this gazelle is seldom seen in groups composed of more than 15 individuals. Territorial adult males establish territories, and associate with visiting groups of females and young.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 15.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nanger soemmerringii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAAGATATTGGCACCCTATATCTCTTATTCGGTGCCTGAGCTGGTATAGTAGGAACCGCCTTAAGCCTGCTCATCCGTGCCGAACTAGGTCAACCCGGAACTTTACTCGGAGATGATCAAATTTACAATGTAGTGGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGATTTGGTAACTGACTAGTCCCTCTAATAATTGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTTTACTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTGTACCCTCCCCTAGCAGGCAACCTAGCCCACGCAGGCGCCTCAGTAGATTTAACCATTTTCTCTCTTCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCCATCAACTTTATTACAACAATCATTAATATAAAACCCCCCGCAATATCACAATACCAAACCCCTTTATTCGTATGATCTGTTCTAATTACTGCCGTACTTCTACTCCTTTCACTTCCTGTACTGGCTGCCGGTATTACAATACTTCTAACAGACCGAAACCTAAATACAACTTTCTTTGATCCAGCAGGAGGGGGAGATCCAATTTTATATCAACATCTATTCTGATTCTTCGGTCACCCTGAAGTGTATATTCTTATTCTACCCGGATTTGGAATAATTTCCCACATTGTCACCTATTACTCAGGAAAAAAGGAGCCATTTGGATATATGGGAATAGTATGAGCCATGATGTCCATCGGGTTTTTAGGATTTATTGTATGAGCTCACCACATATTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTCACATCAGCTACCATAATTATTGCTATTCCAACTGGAGTAAAAGTCTTCAGCTGACTGGCCACGCTTCACGGAGGCAACATTAAATGGTCACCCGCTATAATATGAGCACTAGGCTTTATTTTCCTTTTTACAGTCGGAGGCTTAACTGGAATCGTCCTAGCTAACTCCTCTCTTGATATTGTTCTCCACGATACATATTATGTAGTTGCACATTTCCACTATGTCTTATCAATAGGAGCTGTATTTGCCATTATGGGAGGATTCGTGCACTGATTCCCACTATTTTCAGGCTACACCCTTAACGATACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAATATAACTTTCTTCCCACAACATTTCCTAGGGCTATCTGGAATGCCACGACGATATTCTGATTATCCTGACGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCGGTCATGTTAATAATTTTCATCATTTGAGAAGCATTTGCATCCAAACGAGAAGTCCTAACCGTAGATCTTACCACAACAAACTTAGAGTGACTAAATGGATGTCCTCCTCCATACCACACATTTGAAGAACCCACATACGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nanger soemmerringii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd; C1

Version
3.1

Year Assessed
2008

Assessor/s
Heckel, J.-O., Wilhelmi, F., Kaariye, X.Y., Rayaleh, H.A., Amir, O.G. & Künzel, T.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Soemmerring’s Gazelle has suffered a major decline, as a result of uncontrolled hunting and degradation of rangeland by livestock overgrazing. This decline is estimated to have exceeded 30% over three generations (21 years, 1985 to 2006). The total population is also estimated to number <10,000 mature individuals and to have declined at a rate exceeding 10% over three generations, as above, and is still declining. It is estimated that rangeland degradation and hunting will continue in the future, at or above the thresholds required, and if current trends continue the species may soon meet one of the criteria for EN.

History
  • 2007
    Vulnerable
  • 1996
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Status: VULNERABLE

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total population at about 14,000. Numbers have declined in most areas since then, though security concerns have hindered detailed census work.

Current estimates are: Somalia <1,000?; Djibouti 1,000 to 1,500; Ethiopia <3,000; Eritrea <1,000?; Sudan probably extirpated; Kenya no longer occurs. These figures suggest a total current population of <6,000 to 6,500 individuals.

The population in Djibouti can probably be considered stable over recent years or may even be slightly increasing. However, for Ethiopia (Ogaden), Somalia and Sudan the decline must have been drastic over the past 50 years. Detailed estimates of numbers in Eritrea and other parts of Ethiopia are lacking, but there is no indication that they are common anywhere in Ethiopia, especially considering the turmoil in the past 20 years in this region.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Uncontrolled hunting, political instability, civil and military conflicts, and degradation of rangeland by large numbers of livestock.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soemmerring’s Gazelle is threatened by destruction of habitat by livestock overgrazing and agricultural development, but hunting may have also played a significant role. This species has been exterminated from much of its historical range, and remaining populations are fragmented.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Assessed as Vulnerable to extinction by the World Conservation Union (IUCN) (1), the Soemmerring's gazelle has experienced a serious decline in numbers (6). It has now been exterminated from many parts of its historical range, and remaining populations exist in small pockets (2). While overgrazing by domestic livestock and agricultural development, which reduces the Soemmerring's gazelle's food supply, is believed to be the main cause of this decline, hunting may have also played a significant role (2) (6), as for a long time gazelles have been hunted by people for food (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The only effectively protected population is one of about 200 in Awash National Park. There are well-managed captive populations. Overall distribution and numbers of this gazelle will continue to decline unless effective protection and management can be implemented in larger areas of its range than at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The largest population of Soemmerring's gazelle occurs in Awash National Park in Ethiopia (7). However, even within this protected area, seasonal cattle grazing occurs which may impact the gazelle's food supply (8). There are no specific conservation measures known to be in place for this vulnerable gazelle at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Soemmerring's gazelle

Soemmerring's gazelle (Nanger soemmerringii, formerly Gazella soemmerringii) is a gazelle found in eastern Africa (Djibouti, Eritrea, Ethiopia, and Somalia). It is no longer present in Sudan.[1]

Subspecies[edit]

Traditionally, three subspecies are recognized:[2]

  • Somali Soemmerring's gazelle N. s. berberana
  • Sudan Soemmerring's gazelle N. s. soemmeringii
  • Borani Soemmerring's gazelle N. s. butteri

The dwarf population on Dahlak Kebir island might also qualify as a subspecies.[2]

Description[edit]

GazellaSoemmerringiWolf.jpg

Soemmerring's gazelle is a tall gazelle with tan flanks, gradually turning to white on the belly, and long black horns. They are about 75-90 cm (2.5–3.0 ft) at the shoulder, and they weigh 35–45 kg (77-99 lb). The diet of the gazelle consists of acacia and bush leaves, grasses, and herbs. They inhabit open steppes with brush and acacia, as well as steppes with few trees, and scientists suggest the males are temporarily territorial. The lifespan for this animal is up to 14 years.[citation needed]

In many parts of North Africa and the Middle East, large stone corrals were constructed to drive herds of gazelle into, making for an easy ambush. This method of hunting started in prehistoric time, and continued into the early part of the 20th century.[citation needed] At some point in history, a Soemmerring's gazelle population became isolated on Dahlak Kebir island in the Dahlak Archipelag, where the gazelle actually developed a dwarf form of the larger mainland races.[2]

Most species of gazelles have been hunted for food over the course of history. Soemmerring's gazelles are very understudied due to their small numbers. In parts of their former range they are extinct due to hunting and habitat destruction.[1] Soemmerring's and Grant's gazelles' outward appearance are so similar, they are often mistaken for each other where their ranges overlap.[citation needed]

References[edit]

  1. ^ a b c Heckel, J.-O., Wilhelmi, F., Kaariye, X.Y., Rayaleh, H.A., Amir, O.G. & Künzel, T. (2008). "Nanger soemmerringii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 28 February 2014. 
  2. ^ a b c Chiozzi, G.; Bardelli, G.; Ricci, M.; De Marchi, G.; Cardini, A. (2014). "Just another island dwarf? Phenotypic distinctiveness in the poorly known Soemmerring's Gazelle, Nanger soemmerringii (Cetartiodactyla: Bovidae), of Dahlak Kebir Island". Biological Journal of the Linnean Society 111 (3): 603–620. doi:10.1111/bij.12239.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!