Overview

Distribution

Range Description

This species formerly occurred throughout dry grasslands and sahelian bushlands from Mauritania and northern Senegal to the western side of the Nile River in Sudan, with Heuglin's Gazelle (E. r. tilonura) ten ranging east of the Nile between the southern part of the Red Sea hills in Sudan and the southern foothills of the Ethiopian massif in western Eritrea and north-western Ethiopia (East 1999; Scholte and Hashim in press; Hashim in press). It is likely to be extinct in Ghana.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Formerly widespread in the Sahel zone in the sahelian grasslands, savannas and savanna woodlands, and shrubland. They range up to 1,400 m in the savannas of north-western Ethiopia (Yalden et al. 1996). It is able to adapt to human occupation of its habitat to some extent, e.g., it is known to re-occupy fallow land if sufficient cover is available. It occurs locally in small to moderate numbers in areas of largely unexploited rangeland. They are known to make seasonal movements, although these are increasingly restricted by human settlement.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (captivity) Observations: One specimen lived 14.5 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudorcas rufifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCAACCGCTGATTATTTTCAACCAACCACAAAGATATTGGTACCCTATACCTTTTATTCGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCTTACTAATTCGTGCCGAATTAGGTCAACCTGGAACTTTACTTGGGGATGATCAAATTTATAATGTAATCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGATTTGGCAATTGACTAGTCCCTCTAATAATTGGCGCTCCCGACATGGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTATTGCTCCTAGCATCCTCTATAGTTGAAGCAGGAGCAGGAACGGGTTGAACCGTATACCCTCCCCTAGCAGGCAACCTAGCTCATGCAGGTGCCTCAGTAGACCTGACCATTTTCTCTCTTCACCTAGCAGGTGTTTCTTCAATTCTAGGCGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCAATATCACAGTATCAAACTCCTTTATTCGTGTGATCTGTTCTAATTACCGCCGTACTTCTACTCCTCTCACTTCCCGTACTAGCTGCCGGTATTACAATACTTCTAACAGACCGAAACCTAAATACGACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTATATCAGCATCTATTTTGATTCTTCGGACACCCTGAAGTGTATATTCTTATTCTACCTGGATTTGGAATAATCTCCCACATTGTTACTTATTACTCAGGAAAAAAAGAACCATTTGGGTACATGGGAATAGTATGAGCCATAATATCCATCGGGTTCTTAGGGTTTATTGTATGAGCTCACCATATATTTACAGTTGGAATAGACGTTGATACACGAGCCTATTTCACATCAGCTACCATAATTATTGCTATTCCAACTGGAGTAAAGGTTTTCAGCTGACTAGCTACGCTCCATGGAGGAAACATTAAATGATCACCCGCTATAATATGAGCACTAGGTTTTATTTTTCTTTTTACAGTTGGAGGCTTAACTGGAATCGTCCTAGCCAATTCCTCCCTTGATATTGTTCTCCACGATACATATTATGTAGTCGCACACTTCCACTATGTATTATCAATAGGAGCTGTATTTGCCATTATGGGAGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCCTAGGATTATCTGGAATGCCACGACGATATTCTGACTATCCCGATGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTTATCTCACTAACAGCAGTCATATTGATAATTTTTATCATTTGAGAAGCATTTGCATCCAAACGAGAAGTCCTAACCGTAGACCTTACCACGACAAACTTAGAGTGACTAAATGGATGCCCTCCTCCATACCATACATTTGAGGAACCCACATACGTTAACCTGAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudorcas rufifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Red-fronted Gazelle populations have been reduced to scattered remnants over most of its range by illegal hunting, competition with domestic livestock and habitat degradation, and this reduction is estimated to be greater than 30% over the last three generations (15-18 years). Some populations in protected areas have increased, but the majority of the population resides outside of protected areas. If present trends continue, the Red-fronted Gazelle’s distribution and numbers will probably decline further until its status becomes Endangered or Critically Endangered, e.g., at present less than 10% of its total numbers occur in populations which are known to be stable or increasing.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The available information on this species’ numbers is based mainly on informed guesses. East (1999) produced an estimated total population of about 25,000, which includes an estimated 3,500-4,000 Heuglin’s Gazelles. At the time of East's (1999) estimate, large numbers were known to survive in Niger (ca, 4,000) and Mali (ca. 3,000). Population trends are generally downwards.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Red-fronted Gazelle populations have been reduced to scattered remnants over most of its range by illegal hunting, competition with domestic livestock, and habitat degradation resulting from drought, overgrazing of livestock and clearance of land for agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Approximately 15% of the total population of this species occurs in protected areas (East 1999), in particular W N.P. (Niger, Burkina Faso, Benin), Waza N.P. (Cameroon) and Zakouma N.P. (Chad) (East 1999; Scholte and Hashim in press). Heuglin's Gazelle is protected in Dinder N.P. in Sudan, but East (1999) noted that it does not receive effective protection here, as the sites that it prefers are utilized intensively by camel herders who trespass into the park in the dry season and destroy the gazelle’s favourite shade trees to feed their camels and goats.

The extension of effective protection and management to additional populations besides those in areas such as Zakouma, Waza and Dinder National Parks is necessary. Development and implementation of land use plans which allow for the needs of wildlife outside protected areas in countries such as Chad and Sudan would also be of major benefit to many of the remaining populations of this species (East 1999).

A limited number of Red-fronted Gazelles are maintained in captivity, but without formal breeding programmes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-fronted gazelle

The red-fronted gazelle (Eudorcas rufifrons), a species of gazelle, is widely but unevenly distributed across the middle of Africa from Senegal to northeastern Ethiopia. It is mainly resident in the Sahel zone, a narrow cross-Africa band south of the Sahara, where it prefers arid grasslands, wooded savannas and shrubby steppes.

One authority[2] considers the Thomson's gazelle (E. thomsoni), of East Africa, a subspecies of red-fronted gazelle. The red-fronted gazelle was formerly considered a member of the genus Gazella within the subgenus Eudorcas before Eudorcas was elevated to generic status.

Physical Characteristics[edit]

The male and female red-fronted gazelles are similar in same size, both having s-curved horns. It has a light red-brown color around its whole body, except for its white undersides and rumps. It has a distinct thin (2–4 cm high) black band that runs from the elbow to the stifle (hind leg). Its face is bordered by a pair of white stripes that run from the eye to the corner of the mouth, which are more distinct than the pale white stripes that run down the face of the Red Gazelle, an animal commonly confused for it. It also has a black tufted tail[3]

The average body weight of the red-fronted gazelles ranges from 7.8 kg for the young fawns to 29.7 kg for the adults, while, the shoulder height ranges from 38.7 cm for the young to 68.7 cm for the adult.[4]

The characteristics of the Red-fronted Gazelle were determined by Waza National Park, between September 1989 and December 1993. The body length, horn length, head length, body weight, body colour, and tail length were measured from the carcases of 141 Red-fronted Gazelles.[5]

Subspecies[edit]

  • Eudorcas rufifrons centralis W. Schwarz, 1914 – eastern Chad red-fronted gazelle
  • E. r. hasleri Pocock, 1912 – north Nigeria red-fronted gazelle
  • E. r. kanuri Schwarz, 1914 – Kanuri red-fronted gazelle
  • E. r. laevipes Sundevall, 1847 – Nubian red-fronted gazelle
  • E. r. rufifrons Gray, 1846 – Senegal red-fronted gazelle

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). "Eudorcas rufifrons". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 24 August 2011. 
  2. ^ Kingdon, Jonathan (1997) The Kingdon Field Guide to African Mammals. Academic Press, San Diego and London. Pp. 411–413. (ISBN 0-12-408355-2)
  3. ^ Huffman, Brent. " Eudorcas rufifrons, Red-fronted Gazelle." Ultimateungulate. Ultimateungulate, 20 Feb 2013. Web. 22 April 2013. <http://www.ultimateungulate.com/Artiodactyla/Eudorcas_rufifrons.html>
  4. ^ Stevens, James. "Red-fronted gazelle (Eudorcas rufifrons)." Arkive. Arkive, 2 Aug 2010. Web. 22 April 2013. <http://www.arkive.org/red-fronted-gazelle/eudorcas-rufifrons/>
  5. ^ Amubode, F.O. "The physical and morphological characteristics of the red-fronted gazelle." Wiley. Online Library, 28 Feb 2006. Web. 22 April 2013. <http://onlinelibrary.wiley.com/doi/10.1017/S0952836902000559/abstract>
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!