Overview

Brief Summary

Biology

A nomadic species, the slender-horned gazelle wanders widely in search of food, grazing on grass, and browsing on succulents, herbs and shrubs (7) (8). Although it gains enough moisture from its food to survive, it will drink water when it is available. It feeds mainly during the night and early morning, retiring to rest in the shade through the hottest hours of the day. The slender-horned gazelle is specially adapted for its desert lifestyle, with the nose enlarged to allow the blood to cool in a network of blood vessels (3). Like other desert gazelles and antelopes, social organisation is likely to be flexible and adaptable to variation in conditions. But in general they are observed to form groups of three to ten individuals, made up of one dominant male, several females and their young (3) (7). If conditions are good the slender-horned gazelle may become territorial during the mating season, typically from August to September (3) (7). The male attempts to herd more females into his territory to gain extra mating opportunities, but not all females will co-operate all of the time and younger satellite males may try to intervene in the confusion (7). After a gestation period of 156 to 169 days, females give birth to one, or sometimes two calves during January and February (3). The calves are weaned at three months, but do not mature until six to nine months in females and 18 months in males (3). Young males usually form bachelor herds until they can successfully compete for females. Adult males occasionally battle brutally to assert their dominance. Slender-horned gazelles were formerly preyed upon by cheetahs throughout their range, and may have encountered Cape hunting dogs, lions, leopards and spotted hyenas in some of the more southerly parts of the distribution (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The palest of all gazelle species, the slender-horned gazelle has a creamy-buff upper body, pale brown flank stripe and pure white underside (2) (7). The dark brown tail contrasts with a pure white rump (7). Darker bands run from the eyes to the nose, and a rufous stripe runs between the eyes to the nose. The slender-horned gazelle has large and slender ears behind the upright, slightly S-shaped horns. In males the horns are long and thin, reaching 30 to 41 centimetres and clearly ridged. Females' horns, by comparison, reach just 20 to 35 centimetres and are slimmer and smoother. The hooves are broadened to ease travel across sand (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution in Egypt

Localized (Western Desert). No obvious decline in occupancy from 1950 but the decline is more recent, since it is known to have declined in abundance from hunting and currently to occupy a different distribution from its former range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Occurs across the Sahara, west of the River Nile. Distribution coincides with the larger ergs, though rare or absent on the south-east periphery and apparently absent from the western dune complexes (Devillers et al. 2005). It has disappeared from most of its former range in Egypt’s Western Desert (Saleh 2001, El Alqamy and Baha El Din 2006). A single report from Morocco (Loggers et al. 1992) is unconfirmed.

The center of its distribution is found in the Great Western Erg, the Great Eastern Erg, the sandy zone which stretches from the Hamada de Tinrhert in Algeria to the Fezzan in Libya, and the smaller ergs in the periphery of the central Saharan massifs of the Hoggar and the Tassili des Ajjers (Beudels and Devillers, in press).

It is believed that the slender-horned gazelle was very widely distributed in the Sahara until relatively recently. In the last 10 years, its presence has been confirmed only in the Great Ergs of Algeria, Tunisia, Libya and the extreme Western desert of Egypt. No reports to the south of these locations have been supported by any hard evidence (Beudels and Devillers, in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Sudan, Egypt, Algeria, Libya

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once the most common gazelle in the Sahara Desert, the slender-horned gazelle suffered serious decline in the 1970s, leaving its populations highly fragmented (3). It is found in low numbers across Algeria, Chad, Egypt, Libya, Mali, Niger, Sudan and Tunisia (1), but its presence in the more southern Saharan countries in this list has been unverified for many years (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Favours areas of dunes (ergs) and interdunal depressions. Ranges widely in search of ephemeral vegetation.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits sandy and stony deserts with acacia groves and sandy depressions with sparse vegetation (3). Most known populations are associated with the major Saharan sand seas of the western desert (Egypt to Libya), the Erg Oriental and Erg Occidental (Tunisia and Algeria) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.6 years (captivity) Observations: These animals have been estimated to live up to 14 years in the wild (Bernhard Grzimek 1990). One specimen lived 14.6 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella leptoceros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCTTTAAGCTTACTAATCCGTGCTGAATTAGGTCAACCCGGAACTTTACTCGGAGACGATCAAATTTATAATGTAGTCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGATTTGGCAATTGACTAGTTCCCCTGATAATCGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTTTGACTTCTCCCTCCCTCTTTTCTATTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGCAACCTAGCTCACGCAGGTGCTTCAGTAGACCTGACCATTTTCTCTCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAATATGAAACCTCCCGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCTGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTATATCAACATCTGTTCTGATTCTTCGGACACCCTGAAGTGTATATTCTAATCCTACCCGGATTCGGGATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATGTCCATTGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGACGTTGATACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGGGTAAAAGTTTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGGTCACCCGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTTCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTATTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTATACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACACTTCTTAGGGCTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATATTAATAATTTTCATCATTTGAGAAGCATTTGCATCCAAACGGGAAGTCCTAACCGTAGACCTTACCACAACAAATTTAGAGTGGCTAAATGGATGCCCTCCCCCATACCACACATTTGAAGAGCCCACATACGTTAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella leptoceros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P., Cuzin, F., de Smet, K. & Hoffmann, M.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Listed as Endangered as the total population is estimated at <2,500 mature individuals and is still declining. No subpopulation is estimated to number >250 mature individuals, although population data are very sparse. This assessment is based on a conservative estimate of numbers according to the precautionary principle. Current and planned field survey work may refine these figures.

History
  • 2007
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Gazella leptoceros , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The slender-horned gazelle is classified as Endangered (EN) on the IUCN Red List 2007 (1) and is listed on Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (4). It is also listed as Endangered by the United States Fish and Wildlife Service and therefore protected under the United States Endangered Species Act (5). It is listed on Appendix I of CITES (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Numbers are believed to have undergone a serious decline due to uncontrolled hunting (Mallon and Kingswood 2001, Devillers et al. 2005). East (1999) estimated that the sub-Saharan Africa population could be as low as a few hundred and was unlikely to exceed a few thousand. Numbers are still declining in some areas mainly due to unregulated hunting. The size of the current population in Egypt and Libya is unknown, but is described as small (El Alqamy and Baha El Din 2006). All populations are reportedly small or very small. There is no recent survey information for several areas of the known range, and other areas of potential habitat such as the sand seas of Libya and western Algeria that have been poorly surveyed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threat is hunting/poaching, though disturbance and degradation of natural habitats (especially erg vegetation) through desertification also has a negative impact (Devillers et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As an occupant of particularly poor countries, several of which have much civil unrest, the slender-horned gazelle has suffered through habitat loss and warfare. It is hunted for meat and its horns are sold as ornaments (3). Unmanaged recreational hunting is a major threat throughout its range and the rapid expansion of disturbance and intrusion caused by desert tourism based on 4x4 and other forms of motorised transport also affects some of the remaining populations in North Africa (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CMS Appendix I and is included in the CMS Action Plan for Sahelo-Saharan Antelopes.

Known to occur in Djebil National Park and Senghar National Park in Tunisia, Tassili des Ajjers National Park in Algeria (where reported from the Erg of T'im Merzouga; K. de Smet pers. comm. 2007), and possibly the Aïr-Ténéré National Nature Reserve (Niger). The species is present in about 20 collections in North Africa, Europe and North America (Devillers et al. 2005). The total number in captivity is <200.

Listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A small number of slender-horned gazelle are in captivity around the world. All are part of an international captive breeding programme but are derived from a very small initial founder group of original wild-caught Tunisian stock (7) (8). There are also very small captive groups held by national conservation institutions in Algeria and Tunisia. In the wild formation of the Djebil and Senghar National Parks in Tunisia, and the Siwa protected area in western Egypt (all during the 1990s) are important initiatives in the conservation of this species (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhim gazelle

The rhim gazelle (Gazella leptoceros), also known as the slender-horned gazelle or sand gazelle, is a slender-horned gazelle, mostly adapted to desert life. Fewer than 2500 are left in the wild.

Contents

Description

Skull
Horns of a rhim gazelle (below) and Dorcas gazelle (above)

The palest of the gazelles, this animal has adapted to desert life in many ways. Their pale coats reflect the sun's rays instead of absorbing them, and their hooves are slightly enlarged to help them walk on the sand, although occasionally they occupy stony regions. The horns on the male are slender and slightly S-shaped; those of the female are even thinner, lighter and less curved.

Habitat

The rhim or rheem gazelle is found in isolated pockets across the central Sahara Desert. [2] The extreme heat of this environment limits their feeding to the early morning and evening, and G. leptoceros gains most of its water requirements from dew and plant moisture, relying little on open water sources.

The rhim gazelle is a nomadic species, moving across its desert range in search of vegetation, though it does not have a set migratory pattern. [3]

Endangered by the early 1970s, this species of gazelle was in serious decline. They were hunted firstly by mounted then by motorized hunters for sport, meat, or their horns, which were sold as ornaments in North African markets.

Rhim gazelle in philately

On February 1, 1987, the Libyan General Posts and Telecommunications Company, in cooperation with World Wide Fund for Nature, issued a set of four postage stamps illustrating Gazella leptoceros.[4]

References

  1. ^ Mallon, D.P., Cuzin, F., de Smet, K. & Hoffmann, M. (2008). "Gazella leptoceros". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8972. Retrieved 22 August 2011.
  2. ^ (Kingdom 1997[full citation needed], Spinage 1986[full citation needed]).
  3. ^ (East 1997[full citation needed], Kingdom 1997).
  4. ^ Libyan Stamps online
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!