Overview

Brief Summary

Biology

Grant's gazelles are often found in small herds of up to 30, with an adult ram controlling a territory, and a group of ewes and their offspring roaming over larger areas than the male (3). Younger and non-territorial rams may form bachelor groups that move around the edges of territorial ram ranges (3). However, these groupings are not fixed, and Grant's gazelles deal with changing food supplies by having an exceptionally fluid social system. When there is an adequate supply of food all year round, rams maintain territories continually (4). In other areas they tend to be nomadic, moving from high, well-drained areas during the rains, to flat, grassy valleys in the dry season, with larger temporary herds forming at certain times of the year (2) (3). The Grant's gazelle prefers to eat herbs and shrub foliage, but will also graze on grass during the early rains when it is young and green. It is often found feeding with other herbivores, benefiting from other animals feeding on the grass, as this encourages the growth of herbs on which the gazelles primarily feed (2) (4). Adult territorial rams mark their area with dung and urine deposits and perform elaborate displays when confronting each other (3) (4), particularly during the biannual mating peaks (2). The displays involve a characteristic flicking of the raised head; slow, stiff head-circling; and lowering the head with the horns pointing at the opponent (2) (3). Births follow a six month gestation and the fawn (2), weighing five to seven kilograms (3), remains hidden for the first few weeks of life (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The most distinguishing feature of this pale fawn gazelle is the distinct vertical black stripe that runs down either side of the white buttocks. The underparts and inner legs are also white, and the tail is white at the base but has longer black hair towards the tip (3). Its magnificent horns are long, ringed and slope slightly backwards and outwards, with the tips pointing inwards. The lighter females have considerably shorter and more slender horns, and several subspecies of Grant's gazelle are recognised based on the shape of the horns (3). The eyes are set in leaf-shaped, jet-black patches of skin, incorporating the preorbital glands that (2), unlike other gazelle species, the Grant's gazelle does not use to mark territories (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Grant's Gazelle inhabits the Somali-Masai Arid Zone, from southern Sudan and Ethiopia to central Tanzania; and from the Kenya/Somali coast to Lake Victoria (East 1999; Siegismund et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Nanger granti is found only in eastern Africa, where they range up to 2,000 meters in altitude.

Grant’s gazelles migrate seasonally over a large part of their range preferring higher, well-drained areas during the rainy season, and moving to lower, grassy valleys during the dry season. They are not dependent on water and, consequently, they migrate in the opposite direction of water-dependent species such as Thomson’s gazelles, wildebeest, zebras, and topi. In doing so, Grant’s gazelles avoid competition and are able to survive on vegetation found in this semi-desert environment. However, N. granti remain throughout the year in areas where there is a plentiful supply of food.

Biogeographic Regions: ethiopian (Native )

  • Kingdon, J. 1982. East African Mammals. United States fo America: University of Chicago Press edition 1989.
  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley and Los Angeles, California: University of California Press.
  • Skirka, P., W. Swank, A. Dyer. 1971. African Antelope. New York: Winchester Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in East Africa; in Ethiopia, Kenya, Somalia, Sudan, Tanzania and Uganda (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Grant's gazelles are large, pale gazelles with long horns and legs. They have a distinct rectangular, white shape on the hindquarters and a contrasting black stripe running down the thigh. Thomson’s gazelles (Eudorcas thomsonii), a closely related species, have some similar physical characteristics. They both possess white coloring on the hindquarters, but Grant’s gazelles have more white than Thompson’s gazelles. Nanger granti is paler and has bigger horns than Thompson's gazelles.

Males and females are dimorphic. Males are larger than females, and they have longer, thicker horns, ranging from 50 to 80 cm. The horns are ringed. In contrast to males, females have smaller horns (30 to 40 cm) that are thin and symmetrical.

The young are more darkly colored than adults.

Range mass: 45 to 65 kg.

Range length: 140 to 166 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits subdesert, lowland thorn bush, savanna woodland, open plains, and montane grassland up to 2500 m. Capitalizing on its water-independence, Grant's Gazelle makes a living in areas beyond reach of herbivores that need to drink. Some even migrate to short-grass plains in the dry season and the savanna woodland during rains - opposite to the main migration. But large herds also share wet-season range and mix with the more numerous Thomson's Gazelle (Estes 1991).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grant’s gazelle habitat consists of semi-desert, open savannas, and treeless plains. They avoid acacia forests unless they are traversed by well-traveled paths.

Range elevation: 2500 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grant's gazelles occur in many habitats, including semi-desert scrub, treeless plains and open savanna woodland (3) (4). They can be found up to altitudes of 2,000 metres, preferring the higher, well-drained areas during the rains, and the flat, grassy valleys in the dry season (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Nanger granti are primarily browsers, rather than grazers. A large part of their diet consists of leaves and stems.

Since N. granti live in an arid environment, water conservation and consumption is important for survival. While Thomson’s gazelles uses evaporative cooling as a method of decreasing body temperature, Grant's gazelles allow their body temperature to rise with air temperature, dissipating body heat to the surrounding air when temperatures fall. At night they may also eat leaves, which contain more water during the cooler, nighttime hours.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

  • Spinage, C., C. Ryan, M. Shedd. 1980. Food selection by the Grant's Gazelle. African Journal of Ecology, 18: 19-25.
  • Vaughan, T., J. Ryan, N. Czaplewski. 2000. Mammalogy. United States fo America: Brooks/Cole Thomson's Learning.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Grant’s gazelles are prey for cheetahs (Acinonyx jubatus), wild dogs (Lycaon pictus), and golden jackals (Canis aureus). They are also important herbivores in the habitats in which they live.

Nanger granti inadvertently affects the population density of pouched mice (Saccostomus mearnsi) in eastern Africa by depleting the supply of food for these rodents. In areas where Grant’s gazelles are less common, S. mearnsi populations flourish.

Ecosystem Impact: disperses seeds; creates habitat

  • Keesing, F. 1998. Impacts of ungulates on the demography and diversity of small mammals in central Kenya. Oecologia, 116: 381-389.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

While many predators are threats to N. granti, cheetahs (Acinonyx jubatus), wild dogs (Lycaon pictus), and golden jackals (Canis aureus) are particularly fond of N. granti fawns. During the rainy season, when the ground is soft, cheetahs (Acinonyx jubatus) take advantage of the greatly reduced speed of these gazelles.

Nanger granti uses anti-predatory signals including alert posture and alert snorts. They avoid areas with a high density of predators and employ cooperative defense to protect vulnerable fawns.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Grant's gazelles communicate through territorial markings made with urine and feces, sex pheromones, and visual displays. They communicate the presence of a predator by alert posture, alarm snorts, and stamping.

The dark coloration around the female’s anus serves as source of visual attraction between a fawn and its mother.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Grant's gazelles have an average lifespan of around 12 years.

Average lifespan

Status: wild:
12 years.

Average lifespan

Status: wild:
12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.7 years (captivity) Observations: One captive specimen lived 19.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

When a female gazelle is in estrus, her urine contains sex pheromones indicating her reproductive status to males. In order to detect these, males perform flehmen behavior. Males curl their lips and suck air into their vomeronasal organs to detect whether sex pheromones are present. This behavior is done by N. granti as well as G. thomsonii.

If pheromones are detected, the male actively pursues the female. Courting takes place, in which the male prances with his head held high and his tail held horizontally. This eventually leads to copulation. However, if no sex pheromones are detected, the male does not further pursue the female.

Mating System: polygynous

Grant's gazelles reach sexual maturity at three years of age for males and about one and half years for females. Timing of the mating season depends on location. For example, in southern Kenya and Tanzania, mating takes place throughout the year. In the Serengeti, mating takes place in all months except June, July, October, and November. The gestation period is about 27 weeks.

Breeding interval: Females typically give birth once per year.

Breeding season: Gran't gazelles can breed throughout the year but local climate affects the timing of reproduction.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 6 to 6.63 months.

Average gestation period: 6.3 months.

Average weaning age: 6 months.

Average time to independence: 1.5 years.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; viviparous

After birth, the fawn is completely cleaned of any fluids by the mother. The fawn then drinks its first meal of milk and seeks protection near its mother. If the mother is going out to graze, the fawn remains in a secure hiding place which is observable to the mother from where she is grazing. The mother-fawn relationship is the only persistent relationship in N. granti.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents

  • Kingdon, J. 1982. East African Mammals. United States fo America: University of Chicago Press edition 1989.
  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley and Los Angeles, California: University of California Press.
  • Hart, B., L. Hart, J. Maina. 1989. Chemosensory investigation, flehmen behaviour and vomeronasal organ function in antelope. The Zoological Society of London, 61: 197-215.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nanger granti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAGGATATTGGCACCCTATATCTCTTATTCGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCTTACTTATCCGTGCCGAATTAGGTCAACCCGGAACTTTACTCGGAGATGATCAAATTTACAATGTAGTCGTGACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATTATAATCGGAGGATTTGGTAATTGACTAGTCCCTCTAATAATTGGTGCTCCTGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTACTGCTCTTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTGTACCCTCCCCTAGCAGGCAACCTAGCCCACGCAGGCGCCTCAGTAGATCTAACCATTTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCCATCAACTTTATTACAACAATCATTAATATAAAACCCCCTGCAATATCACAATACCAAACCCCTTTATTCGTATGATCTGTTCTAATTACTGCCGTACTTCTACTTCTTTCACTTCCTGTACTAGCTGCCGGTATTACAATACTTCTAACAGACCGAAACCTAAATACAACTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACATCTATTCTGATTCTTCGGTCACCCTGAAGTGTATATTCTTATTTTACCCGGATTTGGAATAATTTCCCACATTGTTACCTACTATTCAGGAAAAAAGGAACCATTTGGGTACATGGGAATAGTATGAGCCATGATGTCCATCGGGTTTTTAGGATTTATTGTATGAGCTCACCACATATTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTCACATCAGCTACCATAATTATTGCTATTCCAACTGGAGTGAAAGTCTTCAGCTGACTGGCCACGCTTCACGGAGGTAATATTAAATGATCACCCGCTATAATATGAGCACTAGGCTTTATTTTCCTTTTTACAGTCGGAGGCTTAACTGGAATTGTTCTAGCTAATTCCTCTCTTGATATTGTTCTCCACGATACGTATTATGTAGTTGCACATTTCCACTATGTCTTATCAATAGGAGCTGTATTTGCCATTATGGGAGGATTCGTACACTGATTTCCACTATTTTCAGGCTATACCCTTAATGATACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAATATAACTTTCTTTCCACAACATTTCCTAGGACTGTCTGGAATGCCACGACGATATTCTGATTATCCTGATGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTCATGTTGATAATTTTCATCATTTGAGAAGCATTCGCATCCAAACGAGAAGTCCTAACCGTAGATCTCACCACAACAAACCTAGAGTGACTAAATGGATGTCCTCCCCCATACCACACATTTGAGGAACCCACATACGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nanger granti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
Remains widespread within its range in East Africa. East (1999) estimated total numbers at 350,000, with about 30% occurring in protected areas. Only about 25% of the population is considered stable or increasing and the rest declining. If this downward trend continues, then it is only a matter of time before the threshold for Near Threatened is reached.

History
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

According to the IUCN, a threat to N. granti is human habitat destruction. Habitat loss is leading to population decreases of Grant's gazelles.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Recent population estimates are available for most of this species’ current range, mainly from aerial surveys. Summation of these estimates gives a total of about 140,000, but this is probably an underestimate of the species’ total numbers because of undercounting in aerial surveys and the lack of population estimates for some areas. Citing various East (1999) indicates that population densities estimated from aerial surveys range from <0.04/km² in areas such as Borana and South Karamoja to 0.5-0.6/km² in Sibiloi and Tarangire, 1.0/km² in Serengeti-Mara and 3.8/km² in Amboseli. Estimates obtained by ground counts in areas where the species is common range from 1.0 - 3.7/km² in Nairobi and Lake Nakuru National Parks and Ngorongoro Crater. Assuming an average correction factor of 2.5 for undercounting bias in aerial surveys (which may be conservative), and that areas for which population estimates are unavailable support an average density of 0.1/km², East (1999) produced a total population estimate of about 350,000. Kenya continues to support the largest numbers, although estimated total numbers have decreased by >50% since the 1970s (East 1999). Population trend is downward, with some exceptions such as Sibiloi and Marsabit National Parks, some of Kenya’s northern rangeland districts, Laikipia, Masai Mara National Reserve, Amboseli, Serengeti, Tarangire and Mkomazi.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Grant's Gazelle remains widespread within and outside protected areas, despite the loss of parts of its range to the expansion of agriculture and the decline of some populations because of poaching and competition with increasing numbers of livestock. It is nevertheless of concern that its numbers appear to be in decline over large parts of its range (e.g., Tsavo) and that populations which are known to be stable or increasing comprise only about 25% of the species’ total numbers (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat loss and degradation due to agriculture and hunting has eliminated Grant's gazelles from some areas (2). Despite these threats, these gazelles are still widespread and common in many areas, including a number of national parks and reserves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About 30% of the population occurs in protected areas. The largest surviving populations occur in Omo-Mago-Munrle-Chew Bahir and Borana (Ethiopia), the northern rangelands, Kajiado, Mara, Tsavo and Laikipia (Kenya) and, in particular, Serengeti and Tarangire (Tanzania); the bulk of the Serengeti Grant’s Gazelle population occurs well away from the western boundary of the protected area where most poaching activity occurs. Most of these protected populations are in gradual decline (East 1999). The status of the population in Boma N.P. (where numbers were estimated at about 3,000 in the southern section of the park in the 1970s and 1980s) in southern Sudan is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The IUCN Red List classifies Grant's gazelle as Lower Risk / Conservation Dependent (1), indicating that its continued, unthreatened status, is somewhat dependent on the continued existence and protection of the parks and reserves in which it occurs. These areas include Serengeti National Park and Ngorongoro Conservation Area, Tanzania, and Lake Turkana National Park, Kenya (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There seems to be no negative impacts caused by N. granti.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The inadvertent control of the pouched mice (Saccostomus campestris) populations by N. granti is advantageous to humans. In addition to being agricultural pests, pouched mice may spread disease. Grant's gazelles are sometimes hunted for meat and trophies and they are sought by ecotourists.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grant's gazelle

The Grant's gazelle (Nanger granti) is a species of gazelle distributed from northern Tanzania to southern Sudan and Ethiopia, and from the Kenyan coast to Lake Victoria.[3] Its Swahili name is Swala Granti.[4]

Contents

Taxonomy and genetics

Grant's gazelle is more genetically related to Soemmerring's gazelle (N. soemmerringii) and Thomson's gazelle (Eudorcas thomsonii) with Soemmering’s gazelle being the closest relative of the two species.[3] Grant's gazelle shows high genetic variation among its populations, though there is no geographic isolation. The differentiation of the species may have evolved during repeated expansion and contraction of arid habitats during the late Pleistocene era in which populations were possibly isolated.[3] Grant's gazelle was formerly considered a member of the genus Gazella within the subgenus Nanger before Nanger was elevated to genus status.

Grant's gazelle

Subspecies

Listed alphabtically.[2]

  • N. g. brighti (Thomas, 1901) – Bright's gazelle
  • N. g. granti (Brooke, 1872) – southern Grant's gazelle
  • N. g. lacuum (Neumann, 1906) – northern Grant's gazelle
  • N. g. petersi (Günther, 1884) – Peter's gazelle
  • N. g. robertsi (Thomas, 1903) – Robert's gazelle

Appearance

The Grant's gazelle stands 75–95 cm (30–37 in) at the shoulder. The females weigh from 35 to 50 kg (77 to 110 lb) and males from 50 to 80 kg (110 to 180 lb).[5][4] Its coat is a beige orange on the back with a white belly. The Grant's gazelle looks similar to a Thomson's gazelle, except it has lyre-shaped horns which are stout at the base, clearly ringed, and measuring 45–81 cm (18–32 in) long. The subspecies are segregated by different morphological characters, such as horn shape and slight differences in coat colour.[3] These differences are not indicative of ecological separation as with some species.[3] Grant's gazelles are extremely fast; they can run 80 km/h (50 mph), but larger males do not exceed 72 km/h (45 mph).[citation needed]

Ecology

Grant's gazelles at green grassland

The Grant's gazelle is found in East Africa and lives in open grass plains and is frequently found in shrublands; it avoids areas with high grass where the visibility of predators is compromised. They also occur in semiarid areas and are relatively well adapted to dry areas,[3] relying on more browse or leafy material during dry seasons to supplement their intake of water.[6] They are migratory animals, but travel in the opposite direction of most of the other ungulates, such as Thompson's gazelles, zebras, and wildebeest, which are more water dependent. They can subsist on vegetation in waterless, semiarid areas, where they face little competition.

Grant's gazelles at dry brushland

Grant’s gazelles are generally mixed feeders that both browse and graze. Their average diet consists of 65.8% browse and 34.3% graze.[7] Rainfall in their habitats seems to be the determinant of their diets.[7] The Grant's gazelle's diet may also be responsible for the slow growth rates in the browsed plots.[8] They get most of their moisture from the plants they eat, so they do not often have to drink water. Thus they can stay on the plains long after the rains end. From July to September, gazelles move deep into dense brush and wait for the next rains.[9] They will eat red oats and small, tough plants,[10] which are avoided by the other ungulates. This allows the gazelles to survive in the brush during the dry season. Grant’s gazelles eat mainly dicotyledons during the dry season and grass in the wet season.[11]

The most common predators of the Grant's gazelle are cheetahs[12] and wild dogs. Humans also tend to hunt gazelles. In the Serengeti, Grant's gazelle is a prey item for cheetahs, but the Thomson's gazelle is more preferred. However, in Nairobi National Park, Grant's gazelle is preferred over Thomson's gazelle, making it an important resource to the cheetah.[12] Jackals are major predators of fawns.

Lifecycle

Herd of Grant's gazelles

The Grant's gazelle is a gregarious, territorial, and migratory species.[3] The home ranges of does overlap with those of the bucks. Only male gazelles are territorial. Male gazelles will herd all females that cross their territories. When the females are in estrus, they are strongly guarded by the dominant male, which prevents other males from mating with them. Any doe that tries to leave is aggressively herded back.[13] Most of the time, the buck’s simple stance in relation to her is enough to keep the female from leaving.

Bachelor groups are made up of adolescent and bucks not holding territory. Any new members must perform intimidation displays to enter the group.[9] However, bachelor groups tend to be very loose and members can leave whenever they want. The larger, older males with thick horns have the best chance of establishing a territory.[14] Conflicts between adult males are usually solved with intimidation displays. The bucks circle each other and swing their necks from side to side, displaying their neck power.[15] Neck strength is important in an actual fight and the male that cannot keep up yields. Gazelles of nearly equal neck strength are more likely to engage in actual combat. Fighting occurs in young bucks more often than older ones. Dominant bucks can simply run off subordinates rather than having to display to them.

Female and young Grant's gazelles

Reproduction

Grant’s gazelles sexually mature at 18 months. Territory-holding bucks mate more than ones in bachelor groups. The courting ritual begins with a buck following a doe, waiting for her to urinate. When she does, the male does the Flehmen response to determine if she is in estrus. If she is, he will continue to follow her. The female will lift her tail, signaling she is ready to mate, and the male will mount her.[15] The gestation period for the gazelle lasts for 198 days.[16] Births peak in January and February. A doe will leave her herd and find a well-hidden place to give birth. Afterwards, the female eats the afterbirth and other fluids to keep the fawn clean and scentless. Females that have recently given birth will stay together for protection.[15] The does nurse their fawns four times a day. Fawns are immobile for the first few days, so the mother stays close by.[17] When the fawn can walk, it leaves with its mother to find a herd.[18] Around this time, fawns will associate with one another in peer groups. A gazelle is weaned at six months, but will continue to associate with its mother until adolescence.[15]

Status

The Grant’s gazelle is still a common species, despite having been eradicated in certain areas. Major threats have been habitat destruction and hunting. The gazelle’s status as an unthreatened species is dependent on protection of the national parks and reserves where it lives, including Serengeti National Park and Ngorongoro Conservation Area in Tanzania, and Lake Turkana National Parks in Kenya. Estimates of the population range from 140,000 to 350,000. While certain areas have stable populations, overall the population trend is going downward.[1]

References

  1. ^ a b IUCN SSC Antelope Specialist Group 2008. Nanger granti. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.1
  2. ^ a b Nanger granti, MSW3
  3. ^ a b c d e f g Peter Arctander et al. (1996). Extreme genetic differences among populations of Gazella granti, Grant’s gazelle, in Kenya 76 (5). Heredity. Retrieved 2008-06-19. 
  4. ^ a b Grant's Gazelle, Out of Africa
  5. ^ <http://www.antelopetag.com/assets/docs/Antelope/DesertAntelope/Grants_gazelle08.pdf
  6. ^ Western, D., 1975. Water availability and its influence on the structure and dynamics of a savannah large mammal community. East African Wildlife Journal, vol.13, pp.265-286.
  7. ^ a b C. A. Spinage et al. (1980). "Food selection by the Grant's gazelle". African Journal of Ecology 18 (1): 19. doi:10.1111/j.1365-2028.1980.tb00267.x. Retrieved 2008-06-19. 
  8. ^ A. J. Belsky (1984). "Role of small browsing mammals in preventing woodland regeneration in the Serengeti National Park, Tanzania.". African Journal of Ecology. Retrieved 2008-06-19. 
  9. ^ a b Walther, F. R. (1972). "Social grouping in Grant's gazelle in the Serengeti National park". Zeitschrift Fur Tierpsychologie 31 (4): 348–403. PMID 4650796. 
  10. ^ Cloudsley-Thompson, J. L. (1969). The zoology of tropical Africa. New York, W. W. Norton.
  11. ^ Spinage, A. A.; Ryan, C.; Shedd, M. (1980). "Food selection by the Grant's gazelle". African Journal of Ecology 18: 19–25. doi:10.1111/j.1365-2028.1980.tb00267.x. 
  12. ^ a b M. W. Hayward et al. (2006). "Prey preferences of the cheetah (Acinonyx jubatus) (Felidae: Carnivora): morphological limitations or the need to capture rapidly consumable prey before kleptoparasites arrive?". Journal of Zoology 270 (4): 615–627. doi:10.1111/j.1469-7998.2006.00184.x. Retrieved 2008-06-19. 
  13. ^ Walther, F. R. (1991). "On herding behavior". Applied Animal Behaviour Science 29: 5–13. doi:10.1016/0168-1591(91)90235-P. 
  14. ^ Stelfox, J. B.; Hudson, R. J.; Groer, N. (1984). "Relationships among physical traits, age and social status in Thomson's and Grant's gazelles". Applied Animal Behaviour Science 13 (4): 347–357. 
  15. ^ a b c d Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles, The University of California Press. pgs. 75-80
  16. ^ Stuart, C. (1998). Field guide to the larger mammals of Africa. Sanibel Island, FL, Ralph Curtis Books.
  17. ^ Estes, R. D. (1967). "The Comparative Behavior of Grant's and Thomson's Gazelles". Journal of Mammalogy 48 (2): 189–209. doi:10.2307/1378022. 
  18. ^ Walther, F. R. (1964). "Verhaltensstudien an der grantgazelle im Ngorongoro Crater". Zeitschrift Fur Tierpsychologie 22 (2): 167–208. PMID 5890863. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!