Overview

Brief Summary

Biology

The mountain gazelle lives in small groups of three to eight individuals, sometimes more. Their social structure consists of territorial solitary males, which stay and keep their territory all year round; temporary or quite permanent groups of one to several females with their young; and thirdly, small bachelor male herds (2) (3). Males vie for control of territories, but border conflicts between two neighbours are usually more ritualised than violent, consisting of “air-cushion” fights involving a series of head-on charges in which the contestants stop about 30 cm apart (3) (4). However, in battles between the present owner of a territory and a younger opponent attempting to take possession of his territory, males can inflict serious wounds to each other and even break opponents' legs (11). Males follow female groups passing or grazing in their territory. In Israel, acacia gazelles (G. g. acaciae) living in deserts can breed throughout the year, but there are two birth peaks: in spring (March - May) and in autumn (October), though most young of the autumn peak will die. However, during hot summers and cold winters females give birth very rarely (12). In Oman, these gazelles can also breed twice a year (8). In contrast, northern populations of Palestine mountain gazelles (G. g. gazella) have births later (April - June) than desert populations and mostly once a year (2). A female leaves a herd several days before birth and stays alone (together with her young) after the birth for up to two months. A single fawn is born after a gestation period of around 180 days, and can stand and walk shortly after birth (3). During the first weeks young spend most of the day lying curled up with eyes closed at their hidden location. The mother grazes nearby and guards her infant, attacking small predators (foxes) or trying to lead larger predators (jackal, wolf) away. From three to six weeks of age young gradually begin to accompany their mother and start to feed on solid food. The suckling period can last three to four months, rarely longer (2). While females may remain with their mother for life, males leave the maternal herd at around six months old to join a herd of young bachelor males (3). Females can first give birth at the age of one year, but two years is more common, and males can impregnate at 15 to 20 months, but in reality they rarely participate in breeding until they occupy their own territory at the age three years old. The life-span is 13 years in captivity and not more than 8 years in the wild (2). These gazelles are diurnal, though they may graze during moonlit nights as well, especially under pressure of intensive human activity where natural conditions are disrupted (2). Normally they feed at dawn and dusk and rest during the hottest part of the day (3) (5), but gazelles in high altitude barren plains near Ma'abar, Yemen, have only been seen by day, whereas those in the lowlands near Hodeid have only been seen at dusk and night (2). All subspecies are browsers, except for the Palestine mountain gazelle (G. g. gazella), which is a typical grazer. The diet comprises grasses, herbs and shrubs, depending on the habitat, but very few plants will be completely rejected (2) (3). This gazelle's distribution in the Arabian Peninsula and Israel is closely related to the distribution of Acacia trees, with the leaves and pods of these trees forming the bulk of the diet. Commonly they reach Acacia branches by standing on their hind legs and leaning on the trees with their front (2). Where water is scarce, gazelles improve their water balance by digging for bulbs, corms and other succulent subterranean plant organs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Of all Gazella species, the mountain gazelle is the most slender built with relatively the longest neck and legs (2) (3). The coat is fawn to dark-brown on the back, neck and head, while the belly and buttocks are pure white, with these tones being separated on the flanks by a dark narrow band (2) (3) (4) (5). G. g. gazella and G. g. muscatensis are darker than the other subspecies. The coat is short, sleek and glossy in summer, reflecting much of the sun's radiation. In winter the pelage is much longer, dense and rainproof and not glossy, enabling the gazelles to withstand the heavy winter rains (800-1000 mm) in northern Israel; although seasonal variations in the pelage are much less in desert subspecies (2). The face has two conspicuous white stripes extending from the eyes towards the nostrils with dark-brown to black lower margins, coupled usually with a black spot on the muzzle above the nose (2) (3) (5). The male's horns are quite long (22 – 29.4 cm), straight and thick basally, with a slight lyrate form and prominent rings, while those of females are generally shorter (5.8 - 11.5 cm), un-ringed, irregular in shape, and often bent, crooked or broken (2) (3). Males of northern subspecies have longer horns than southern desert subspecies, and those of the Persian Gulf region are shortest and more strongly outbowed. Northern Palestine gazelles (G. g. gazella) are generally the largest of the mountain gazelle subspecies, while the southern desert subspecies are much lighter (only 12-16 kg), but longer-legged and with a relatively longer body and ears (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution in Egypt

Localized (North Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Formerly occurred across most of the Arabian Peninsula, north to southern Syria and extending westwards into Sinai. The last confirmed records for Egypt were in 1932 though there have been some recent unconfirmed reports (Saleh 2001). There have been no records in Syria since the 1970s (Kingswood et al. 2001), although they may survive on Jabal Hermon and perhaps in upper Galilee (Masseti 2004). In Lebanon, the species was believed to have become extinct after 1945, but three were seen in 1998 in the Barouk Mountains (Kingswood and Khairallah 2001). The last record from Jordan was in 1986 (Kiwan et al. 2001), although Masseti (2004) notes that they were reintroduced into Shaumari Wildlife Reserve.

Their current range includes: Israel (widely distributed); Saudi Arabia (occurs on the Farasan islands, in three protected areas, and as scattered populations in the west); Oman (widely distributed, with the largest population in the Arabian Oryx Sanctuary); United Arab Emirates and Yemen, mainly from the west and south. There is also a small introduced population on Farur Island (Iran) in the Persian Gulf (Mallon and Kingswood 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gazella gazella, or mountain gazelle, is one of several closely related species found in the Middle East. Its distribution includes the Arabian Peninsula, Egypt, Iran, Israel, Jordan, Lebanon, Oman, Saudi Arabia, Syrian Arab Republic, Yemen, and the United Arab Emirates (Mendelsohn et al., 1995; IUCN Species Survival Commission, 2000).

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Arabian Peninsula, Palestine, Sinai

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The mountain gazelle was once distributed much more widely across the whole of Arabian Peninsula, and also in Egypt, Jordan, Lebanon and Syria (3), but many former populations have now disappeared completely (2). At present mountain gazelles remain along the Red Sea coast and in the Asir Mountains in Saudi Arabia (6) (7), on the Farasan Islands in the Red Sea off the southwest coast of Saudi Arabia (G. g. farasani) (1), along the coast and mountains of Yemen and Oman (8) and in the United Arab Emirates (9). Apparently, Iranian gazelles on the Forur Island in the Persian Gulf are also one of the mountain gazelle subspecies (2). Two populations of this gazelle occur in Israel: G. g. gazelle, which lives in the hills and mountains of the north part of country, and a small desert population of G. g. acaciae, which is left only in the south part of the Arava Rift Valley (Negev) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male mountain gazelles weigh between 17 and 29.5 kg, whereas the smaller females weigh 16-25 kg. They are sexually dimorphic with the males being larger and having larger horns. Toothrows of mountain gazelles are nearly straight.

Gazelles have a slender build with proportionally long necks and legs. The hind legs of mountain gazelles are particularly long.

Mountain gazelles are a dark brown with white underparts, flanks, and light brown limbs. The face is marked with an off-white stripe with black lower margins. There is also a narrow, dark flank-band that separates the dark dorsal tones from the white underparts. The base of the hairs from the underside are buff colored. The black tail is short and bushy. The ears are also relatively short. The white line down the thigh stops at the hock. Pelage is short and sleek, and reflects the sun’s radiation in the summer months, and is much longer, thicker and rainproof during the winter to protect the animal from the heavy winter rains.

Both sexes have horns. The relatively short horns of the males (220-294 mm) vary greatly depending on habitat. Female mountain gazelles have horns that are less then 70% the length of males’ horns in the same population (84-153 mm). Males’ horns are thick and have prominent rings whereas the females’ horns are unringed. The horns are elliptical in a cross-section and the gap at the base is about 25 mm. Male horns bow out from the base with the tips almost always pointing in. The females’ horns are curved slightly forward. Horn shape may vary greatly within populations, but in most cases the horns resemble an S-shape. Horns also have broad grooves that run up the anterior part of the core, a groove along the posterior boarder, and a less prominent groove that runs medial to the aspect of the core (Groves and Lay, 1985; Mendelsohn et al., 1995).

Range mass: 17 to 29.5 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits a range of desert and semi-desert habitats. They often occur in steep terrain, but avoid rocky areas, and can withstand severe climatic conditions, living in the hot and dry Jordan Valley, the Negev Desert, and the Nafud and Dhofar Deserts (Mendelssohn et al. 1995).

In Israel, the gazelles of the Arava Valley (Gazella gazella acaciae) are found in arid habitats dominated by acacia (Acacia raddiana and A. tortilis); Palestine Mountain Gazelle (G. g. gazella) are found in hilly regions with good vegetative cover, especially in areas near irrigated cultivation.

The gazelles on Farasan Island inhabit areas of broken coral ravines and flat gravel. They apparently emerge to feed at night mainly on Cyperus., and obtain water mainly from dew (Flamand et al. 1988).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mountain gazelles live in mountainous and hilly habitats consisting of light forests, fields, or desert plateaus. They usually spend the days in the hills bedded down and descend at night or in the early morning to forage.

Mountain gazelles live in areas with an average annual temperature of 21-23 degrees Celsius and an average winter temperature of about 14 degrees Celsius. The areas occupied by G. gazella are dry, usually with an annual precipitation of 300-400 mm (Mendelsohn et al., 1995; Massicot, 2001).

Habitat Regions: temperate

Terrestrial Biomes: scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mountain gazelles live in low altitude mountains, sometimes in very steep (up to 45°) terrain, but avoid rocky areas and walking on rocks. They prefer plateaus, hilly relief, foothills and valleys between mountains and open habitats or areas with light forest in gravel or sandy plains (2) (3), but also occur in regions of real desert and coastal dunes (1). In Arabia, they usually live on rough terrain of mountain beds, gorges, and rolling hills (10). Mountain gazelles can withstand severe climatic conditions. They live in very hot and dry Jordan Valley, the Negev Desert, and the Nafud and Dhofar Deserts, where mid-day temperature can reach 45°C, and in northern Israel where sub-zero (Celsius) temperatures are not rare on winter nights and snow can cover the ground for several days (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gazelles are browsers and grazers, feeding on grasses, herbs, and shrubs. Their food varies greatly and depends on habitat. In the Arabian Peninsula, gazelle distribution is closely related to the distribution of Acacia, however, in Arabia G. gazella lives mainly on the foliage of wadi beds and gorges. Only a few plants are rejected altogether. Even poisonous plants rejected by most herbivores are eaten by mountain gazelles.

Gazelles seem to be well adapted physiologically to live in harsh desert extremes. They can go without water for long periods of time and find succulent plants and dew drops an adequate source of water. Gazelles do not accumulate significant fat stores, even under the most favorable conditions (Mendelsohn et al., 1995; United States Fish and Wildlife Service, 2001; Wildlywise Adventures, 2001).

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because of their foraging behavior, mountain gazelles probably affect the plant communities where they are common. Also, although predators do not significantly affect gazelle populations, availabilty of this primary consumer may affect predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The horns of nountian gazelles are the most utilized form of defense against predation. They are used for butting small predators. The gazelle also has keen vision and can run at high speeds. Predation by carnivores doesn’t appear to significantly affect gazelle populations, although humans have become one of the mountain gazelle’s worst predators. (Mendelsohn et al., 1995).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Mountain gazelles rarely live more then eight years in nature, but in captivity they can live between 12 and 15 years (Mendelsohn et al., 1995; Wildlywise Adventures, 2001).

Average lifespan

Status: wild:
8 years.

Typical lifespan

Status: captivity:
12 to 15 years.

Average lifespan

Status: wild:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.3 years (captivity) Observations: One captive specimen lived 18.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males and females may both mate with multiple partners.

Mating System: polygynandrous (promiscuous)

Gazelles are found in small groups of 3-8 individuals. Males are territorial with one or more females and their young. The company females keep is determined primarily by their reproductive status. Mating occurs in early winter (October-November), but can take place year-round where food is available.

Births usually occur from April to May with the females usually only have one young per season. Estrous occurs every 18 day and lasts 12-24 hours until the female becomes pregnant. Female gazelles copulate with more then one male. The gestation period is 180 days and offspring are born weighing 11-12% of the mother’s mass. Birth takes place in isolation and the precocial young can stand and walk shortly after birth. The young spend the first weeks nursing and when they are three to six weeks old they begin to feed on solid food. Suckling may last up to three months. Around this time, the mother and young join a small maternity herd. Females may remain with their mother for life, but males leave the maternal herd at about six months of age. The males then join a herd of young males. Females reach their adult mass at about 18 months whereas males do not reach full size until three years (Mendelsohn et al., 1995; Dunham, 1999).

Breeding season: October-November

Range number of offspring: 1 to 3.

Average number of offspring: 1.

Range gestation period: 6 (low) months.

Average gestation period: 6 months.

Range weaning age: 2.5 to 3.33 months.

Range age at sexual or reproductive maturity (female): 1.5 to 3 years.

Range age at sexual or reproductive maturity (male): 1.5 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2360 g.

Average number of offspring: 1.

Females nurse their precocious young for up to three months. When they are three to six weeks old, they young begin to feed on solid food. Around the time of weaning, the mother and young join a small maternity herd.

Males are not involved in parental care.

Parental Investment: female parental care ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella gazella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACCAATCACAAGGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCTTTAAGCTTACTAATCCGTGCCGAACTAGGTCAACCCGGAACTTTACTCGGAGATGATCAGATTTATAATGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGGTTTGGTAACTGACTAGTTCCTCTAATAATTGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTCCTATTACTTCTGGCATCCTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGTAACCTAGCTCACGCAGGTGCTTCAGTGGATTTAACCATTTTCTCCCTTCACCTAGCAGGTGTCTCTTCAATTTTAGGCGCTATTAACTTTATTACAACAATTATTAATATAAAACCTCCTGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCTGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTCCCTGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGATCCAATCCTTTATCAACATCTATTCTGATTCTTCGGACATCCTGAAGTATATATTCTAATCCTTCCCGGATTCGGGATGATTTCTCACATCGTTACTTACTACTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATAGTATGAGCCATGATGTCTATTGGGTTCTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGAATGGACGTTGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCCATCCCAACTGGGGTAAAAGTCTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGATCGCCTGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTCCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTTCACTATGTTCTATCAATAGGAGCTGTATTTGCTATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGCGTAAACATAACTTTCTTCCCACAACATTTCTTAGGGTTATCCGGAATACCACGACGATACTCTGATTATCCCGATGCCTATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATATTAATAATTTTTATTATTTGAGAAGCATTTGCATCCAAACGAGAAGTTCTAACCGTAGACCTTACCACAACAAATTTAGAGTGACTAAATGGATGTCCTCCCCCATACCACACATTTGAAGAGCCTACATACGTCAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella gazella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ad

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
This taxon is widely but unevenly distributed across the Arabian Peninsula. The two largest populations have declined at different rates, but overall there has been a continuing estimated decline exceeding 30% over the past three generations (18 years) based on direct census information and evidence of illegal hunting and live capture.

History
  • 2003
    Vulnerable
    (IUCN 2003)
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mountain gazelles are listed on CITES Appendix III in Tunisia and the Asian populations are listed on CITES Appendix II. The two major threats to these gazelles include habitat loss (human induces) and direct loss. Other threats include hunting and collecting, trade, alien invasive species, and hybridizers. Stricter laws in most areas have reduced poaching of this species, but habitat loss and exploitation continue to threaten populations (Mendelsohn et al., 1995; IUCN Species Survival Commission, 2000.

US Federal List: endangered

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native?, extinct?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/27/1979
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Gazella gazella , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1). Six subspecies are currently recognised, with five of these listed on the IUCN Red List. The Arabian mountain gazelle (G. g. cora) and Farasan gazelle (G. g. farasani) are classified as Vulnerable (VU), the Palestine mountain gazelle (G. g. gazella) is classified as Endangered (EN), and the Muscat gazelle (G. g. muscatensis) and the acacia gazelle (G. g. acaciae) are classified as Critically Endangered (CR) on the IUCN Red List 2006. G. g. erlangeri has not been classified by the IUCN (1). The taxonomy of Gazella gazella has been hotly debated in the past, with some populations having been described as independent species, later being renamed as subspecies of the mountain gazelle, and then later being re-described as independent species again. To complicate matters, a number of gazelle populations in Arabian Peninsula are not considered pure, but rather the result of cross-breeding between two or more unknown species or subspecies (2). Though scientists currently describe six subspecies for mountain gazelles (1), recent genetic research has demonstrated that the taxonomy of this species has to be changed considerably (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total numbers are currently estimated at less than 15,000: Israel (approximately 3,000); Oman (approximately 13,000 were estimated in the late 1990s, with 10,000 on the Jiddat al Harasis, although this population has been declining since then; Saudi Arabia (1,500-1,700, but up to 1,000 of these are on the Farasan Islands, with over half of them on Farasan Kebir); Yemen (no estimates but generally described as rare). Numbers of gazelles in Israel and the West Bank (usually considered to be G. g. gazella) were estimated at 10,000 in the late 1990s (Clark and Frankenberg 2001). Since then they have declined sharply and there are currently estimated to be about 3,000 in total.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats are illegal hunting for meat and live capture for pets and private collections, particularly in Oman, Yemen and Saudi Arabia. Habitat loss through agricultural development, fencing pasture for cattle, construction of roads and settlement is also a major threat.

In the Arava Valley, the major threat to the Acacia Gazelle is habitat deterioration: the water table is falling due to abstraction of underground water sources for agriculture causing acacia trees, bushes and perennial plants to disappear. Predation by wolves (Canis lupus) and jackals (C. aureus) has also increased. The small size of the remnant population means that inbreeding is a threat and leaves the taxon vulnerable to stochastic factors.

The Palestine Mountain Gazelle was formerly hunted under license in Israel and was regarded in places as an agricultural pest. Shooting was legally halted in 1993 due to declining numbers.

There are no natural predators on the Farasan Islands so overgrazing is a potential future problem if the population increases. Hunting (killed for meat) and live trapping (for sale as pets on the mainland) are the main threats but the effect of these has fallen since the islands were declared a reserve.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The threats to the mountain gazelle vary across the species' range, but the primary causes of decline are habitat loss and hunting. Important habitat has been lost to agricultural developments, fencing of pasture for livestock, and the construction of human settlements and roads (1). Habitat deterioration has had a major impact on the Acacia gazelle (G. g. acaciae) in Israel, where the water table has fallen due to abstraction of underground water sources for agriculture. This has caused essential food sources such as Acacia trees and bushes to dry up and perennial plants to disappear, and the gazelle population is now less than 20 individuals (13). Since the remaining population is so small, inbreeding is a major threat, which can result in reduced genetic diversity that leaves the subspecies vulnerable to stochastic factors. Additionally, wolves (Canis lupus) and jackals (C. aureus) in Israel are increasingly preying upon this rare subspecies, as well as on the Palestine mountain gazelle (G. g. gazella) (1). The mountain gazelle has and continues to be hunted across much of its range for its skins, meat, trophy horns (3), for sport and for being a crop pest, while live capture for private collections is a major threat in Oman (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Mountain Gazelle are legally protected in Israel, Saudi Arabia, and Oman, but enforcement is not always effective. They occur in the following protected areas:

Saudi Arabia: Uruq Bani Ma’arid (5,500 km²); Al Khunfah (34,225 km²); and Ibex Reserve (2,370 km²) (all Arabian Mountain Gazelle). The Farasan Islands (600 km²) have been a nature reserve under the control of the National Commission for Wildlife Conservation and Development (NCWCD) since 1988, and aerial censuses are carried out by NCWCD on the Farasan Islands, at 2-3 yearly intervals.

Oman: Arabian Oryx Sanctuary (24,785 km²); Wadi Sareen Tahr Reserve (800 km²); Jebel Samhan NR (4,500 km²), As Saleel NP (220 km²) (all Arabian Mountain Gazelle).

Israel: En Gedi (14 km²); Ya’ar Yehudia (62 km²); Mezukai Herev (23 km²). The current habitat in the Arava Valley is protected, and supplementary feed is provided and natural vegetation irrigated. However, an evaluation of predator control in the area is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Shooting of the Palestine mountain gazelle (G. g. gazella) was legally banned in Israel in 1993 because of declining numbers (1), and stricter laws in most areas have reduced poaching of this species (3). By contrast, the acacia gazelle (G. g. acaciae) was under protection from the first day it was described in Israel in 1964 (14). However, habitat loss and exploitation continue to threaten populations, particularly those outside of protected areas (3). The Arabian mountain gazelle (G. g. cora) is found in the Arabian Oryx Sanctuary, Wadi Sareen Tahr Reserve, Jebel Samhan National Reserve, and As Saleel National Park in Oman, and reintroduced populations occur in the Ibex Reserve, Al-Khunfah Reserve and Uruq Bani Ma'arid Reserve in Saudi Arabia, but legal protection is not always effectively enforced (1). The Farasan Islands on which the Farasan gazelle (G. g. farasani) occurs have been a nature reserve under the control of the National Commission for Wildlife Conservation and Development (NCWCD) since 1988, which carries out aerial censuses every two to three years. The habitat of the tiny acacia gazelle (G. g. acaciae) population recently became protected, and this rare subspecies has been given supplementary food in the past and the natural vegetation was irrigated (1). These measures lead the population to increase from just 13 gazelles (in 1995) to 24 individuals (in 2000) (11). Nevertheless, this Critically Endangered subspecies has remained in an extremely precarious position since, with its numbers having fluctuated for several years more or less around 20 individuals, and the threat of extinction still looms dangerously close. The decision (as of 27.12.2004) of the Israel Nature Reserve and National Parks Protection Authority to stop providing supplementary food and irrigation, and also to fence the gazelles instead of protecting them against wolves and jackals and reducing carnivore numbers, has given the acacia gazelle little chance of survival. As a result, the number dropped down to just 12 individuals in 2005 (15). Thus, this sad situation should act as a powerful incentive to do more to protect the other subspecies of mountain gazelle, in order that they should never reach a similar state.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The gazelles often eat the cultivated crops of the area (IUCN Species Survival Commission, 2000; Massicot, 2001).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hunting for gazelle skins, meat, and trophy horns is common, and poorly regulated.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mountain gazelle

The mountain gazelle (Gazella gazella) is a species of gazelle widely but unevenly distributed across the Arabian Peninsula. It inhabits mountains, foothills, and coastal plains. Its range coincides closely with that of the acacia trees that grow in these areas. It is mainly a grazing species, though this varies with food availability. It is less well adapted to hot, dry conditions than the Dorcas gazelle, which appears to have replaced the mountain gazelle through some of its range during the late Holocene in a period of climatic warming.

Contents

History

In 1985, a large population of mountain gazelles built up through game conservation in two Israeli reserves, in the southern Golan Heights and Ramat Yissachar, was decimated by foot and mouth disease. To prevent such occurrences, a plan was drawn up to stabilize the female population at 1,000 in the Golan and 700 in Ramat Yissachar.[3]

Byzantine-era mosaic of gazelle in Caesarea, Israel

Distribution

Less than 15,000 mountain gazelles are left within their natural range, more than 10,000 of these being of Arabian mountain gazelle subspecies, G. g. cora, less than 3,000 of Palestine mountain gazelles, G. g. gazella, less than 1,000 of G. g. farasani, less than 250 of G. g. muscatensis, and 19 of subspecies G. g. acaiae. Mountain gazelles can reach running speeds up to 80 km/h (50 mph).[4]

Species

The Palestine mountain gazelle - G. g. gazella[5] - resides largely in three areas: the Golan Heights, Ramot Naftali and the Galilee. In the coastal plain, there is a small population of gazelles but the numbers are decreasing in the wake of accelerated urbanization. The population decreased greatly throughout its natural range in the first part of the 20th century due to poaching.[6] but increased thereafter thanks to conservation efforts.[6]

The Arava gazelle - G. g. acaiae - is in critical danger, with only 19 (counting made in 2007 of 17 plus two newborns) gazelles in a closed nature reserve near Yotvata, Israel.

The Merrill gazelle - G. g. merrilli - lives in the mountains near Jerusalem.

See also

References

  1. ^ Grubb, P. (2005). "Gazella gazella". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ IUCN SSC Antelope Specialist Group (2008). "Gazella gazella". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 22 August 2011. 
  3. ^ Mountain gazelle management in northern Israel in relation to wildlife disease control
  4. ^ Lee, K. "Gazella gazella". Animal Diversity Web. Retrieved 22 August 2011. 
  5. ^ http://www.iucnredlist.org/details/8970/0
  6. ^ a b Kaplan, D. (2002-12). "Langfristige Bestandsschwankungen der Edmigazelle (Gazella gazella gazella) in Nordisrael". Zeitschrift für Jagdwissenschaft (Springer Berlin / Heidelberg) 48 (Supplement 1): 167–171. doi:10.1007/BF02192405. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!