Overview

Brief Summary

Description

The Dorcas gazelle is generally similar in appearance to the closely related Gazella gazella, but they are smaller, have longer ears and more strongly curved horns, which bow outwards then turn inwards and forwards at the tips (4). Individuals belonging to the Saharan subspecies (G. d. osiris) have a very pale fawn coloured coat, and the white underside is bordered with a brown stripe, above which there is a sandy stripe. The forehead and face are darker than the body (4). Subspecies from north of the Sahara tend to be more ochre in colour, and have dark flanks and face-stripes, while populations in Israel and around the Red Sea are darker and more reddish (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The dorcas gazelle is one of the most desert-adapted of all gazelles; they can go for their entire lives without drinking, as they can get all the moisture they need from the plants that form their diet (2). However, they will drink if water is available (4). They are able to withstand high temperatures, but when it is very hot they are active mainly at dawn, dusk and during the night (2). In areas where they face persecution, they tend to be active at night in order to minimise the risk of hunting (4). These gazelles feed on leaves, flowers and pods of many species of Acacia trees as well as the leaves, twigs and fruits of various bushes. They occasionally stand on their hind legs to browse on trees, and after rain they have been observed digging out bulbs from the ground (4). When conditions are harsh, dorcas gazelles live in pairs, but when conditions are more favourable they occur in family herds with one adult male, several females and young (4). During the breeding season, adult males tend to be territorial, and mark their range with dung middens (2). In most parts of the range, mating takes place from September to November. Gestation takes six months; a single fawn is the norm, although twins have been reported in Algeria. The newborn is well developed at birth, with fur and open eyes. Within the first hour, the fawn attempts to stand, and it will suckle on this first day of life (4). In the first two weeks, the young gazelle lies curled up in a scrape on the ground or beneath bushes while the mother grazes close by. The young then starts to follow its mother around and begins to take solid food. After around three months, the fawn stops suckling and is fully weaned, at which time the pair rejoins the herd (4). The natural predators of dorcas gazelles include cheetahs, which have largely been eliminated throughout the gazelle's range. Other predators include serval, caracal, wolf, and hyaena. Fawns are taken by smaller cats, jackals, foxes, and eagles (4). Dorcas gazelles are able to run at speeds of up to 80 km per hour, and when threatened they tail-twitch and make bouncing leaps with the head held high (stotting) to announce that they have seen a predator (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Dorcas Gazelles are generally pale colored with a white underbelly and two brown stripes on either side. Adult males are larger, weighing about 16.5 kg (36.3 lbs) as compared with an average of 12.6 kg (27.7 lbs) in females . Males' horns are also longer, thicker and more curved than those of females.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution in Egypt

Widespread. No obvious decline in occupancy from records, but decline in group size since 1950 and thought by everyone to be declining with fragmented populations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Formerly occurred over the entire Sahelo-Saharan region, from the Mediterranean to the southern Sahel and from the Atlantic to the Red Sea, and extending into southern Israel, Syria and Jordan (marginal occurrence).

Dorcas Gazelle became extinct in Senegal (where they probably only occurred as a vagrant or seasonal visitor; East 1999), and were subsequently reintroduced to protected areas although there is no recent information on their status; they are possibly extinct in Nigeria, and their current status in Burkina Faso is unclear (Lafontaine et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gazella dorcas is found in the northern Ethiopian biogeographic region and the southwestern Palearctic region. These gazelles inhabit parts of northern Africa, and the Sahara and Negev deserts including: Morocco, Rio de Oro, Algeria, Tunisia, Libya, Chad, Somalia, Ethiopia and parts of Israel and Sinai in the Middle East.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Yom-Tov, Y., H. Mendelssohn, C. Groves. 1995. Gazella dorcas. Mammalian Species, 491: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The dorcas gazelle is found in North Africa and the Middle East (3). The 'possible' range of the various subspecies includes Algeria, Burkina Faso, Chad, Djibouti, Egypt, Eritrea, Ethiopia, Libya, Mali, Morocco, Niger, Somalia, Sudan, Tunisia and Western Sahara (5) (6). In Jordan it is considered to be one of the country's most threatened species (3). G.d.isabella is found in Israel and Sinai, and along the coast of the Red Sea on the borders of Saudi Arabia (7). The Moroccan dorcas gazelle (Gazella dorcas massaesyla) is found only in the northern plains of Morocco (3) and Pelzen's gazelle (Gazella dorcas pelzelni) is found in Somalia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Gazella dorcas varies in coloration, depending on the location. They are generally pale colored and have a white underbelly with two brown stripes on either side. In the northern Sahara they are an ochre color with darker flanking stripes. Near the Red Sea, they are reddish-brown with less conspicuous, light flanking stripes. The head is darker than the rest of the body. Their horns have the most pronounced curve of members of Gazella, and within the subspecies the amount of curve in the horn varies. Horns of males are 250-280 mm long and have 20-24 rings. Female's horns are smaller (170-190 mm) and straighter with 16-18 rings. Adult males average 16.5 kg, while the females are about 12.6 kg, although average size varies among populations. They are the second smallest gazelle species.

Range mass: 14 to 18 kg.

Average mass: 16.5 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits a wide range of arid and semi-arid habitats, but avoids extensive areas of dunes and hyperarid areas (Cuzin 2003; Lafontaine et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gazella dorcas is the best equipped member of the genus Gazella to inhabit dry areas. They are found in a variety of habitats: savannahs, semi-deserts, small sand dune fields, consolidated dune areas, and wadis, and are associated with a number of different plant species. High densities of G. dorcas are found in sand dune fields with high concentrations of Pancratium sickenbergeri, a preferred food.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

  • Ward, D., D. Saltz. 1994. Foraging at different spacial scales: dorcas gazelles foraging for lilies in the negev desert. Ecology, 75: 48-58.
  • Lawes, M., R. Nanni. 1993. The density, habitat use and social organisation of dorcas Gazelles (Gazella dorcas) in Makhtesh Ramon, Negev Desert, Israel. Journal of Arid Environments, 24: 177-196.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorcas Gazelles inhabit savannas to sand dunes throughout the northern half of Africa. This species is exceptionally well-adapted to arid conditions. Dorcas Gazelles can withstand high temperatures and survive without drinking water, because they get all the moisture they need from the plants they eat.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorcas gazelles inhabit flat grassland and steppe in Morocco, and desert, sub-desert, and steppe in Algeria, where they tend to avoid very sandy areas (3). In Libya they occur in a range of dry open habitats but show a strong preference for vegetated dry watercourses, known as wadis. In the Western Desert of Egypt it prefers oasis-type depressions and used to occur along the coast of the Mediterranean; it also inhabits wadis in this area. In Jordan they are found in flat gravel-plains, mixed gravel and dune areas and gravel plateaux, and in Israel they are typically found in wadis, where acacia trees are able to grow due to the presence of underground water sources (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gazella dorcas individuals feed on the flowers, leaves, and pods of Acacia trees in many of the areas they inhabit. They also feed on fruits and leaves of a variety of bushes. In the Negev Desert, G. dorcas feeds on Madonna lilies (Pancratium sickenbergeri). Depending on the season, methods for obtaining food change. In summer gazelles dig holes in the sand to remove the stem and bulb of Madonna lilies. After winter rains, gazelles eat freshly sprouted leaves. Foraging techniques permit maximum energy intake with minimum energy output. Large amounts of feeding are done in small areas with high concentrations of plant life followed by long moves to other feeding areas.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore , Granivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Gazella dorcas, along with some other ungulates, make up the primary mode of seed dispersal for a variety of plants in the Acacia genus between the Red Sea and Israel.

Ecosystem Impact: disperses seeds

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Gazella dorcas populations have many predators. Cheetahs, lions, servals, caracals, wolves, and hyaena prey on all sizes and ages. Young can be killed by smaller predators, such as foxes, eagles, and jackals. Many of these predators have been wiped out in areas where gazelles are currently found. Humans, wolves and caracal continue to be major predatory threats to these gazelles. Gazella dorcas relies chiefly on its keen eyesight to watch for predators. They have calls described in the communication section that help alert others in a herd to the presence of a predator. Skin shivering, tail twitching, and taking bouncing leaps with its head high, also called stotting, are all used to warn others of the presence of a predator.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Prey: predators include lions.

Competes for food with: domestic sheep and goats.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Gazelles have an alarm call which sounds like a short bark. They also use a louder call made in cases of extreme danger or pain. Females have a low grunt to call the young and all G. dorcas can produce a long growling sound that signals annoyance. When in danger from a predator, "stotting", described in the predation section, is a common way to warn other gazelles of the predators presence.

Communication Channels: visual ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These gazelles feed on fruits, twigs, leaves, flowers and pods of many bushes and trees, especially Acacia,and occasionally are observed standing on their hind legs to browse. They may also excavate stems and bulbs buried underground, especially during dry season months.

When conditions are harsh, Dorcas Gazelles live in pairs, but when conditions are more favorable they congregate in larger herds with one adult male, several females and young. During the breeding season, these adult males defend territories, scent marking the boundaries with piles of dung.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity Gazella dorcas can live up to 15 years. Average lifespan in the wild is unknown and may vary by population.

Range lifespan

Status: captivity:
15 (high) years.

Average lifespan

Status: captivity:
17.1 years.

Average lifespan

Status: wild:
12.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.7 years (captivity) Observations: One captive female lived for 23.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the September to November mating season males will guard territory marked by their droppings. Depending on local climate, a group of G. dorcas will consist of one or two males with a harem of females or just a male-female pair. In extreme climates, where resources are scarce, they primarily associate in pairs.

Mating System: polygynous

In the wild, females will usually begin reproducing around age two. In captivity pregnancy can happen as early as six months of age. About 90% of females in the wild became pregnant. They give birth to only one offspring per pregnancy in almost all cases. Pregnancy lasts around six months and the fawn is born with hair and open eyes. Young spend the majority of their first two weeks curled up in the shade. Afterwards they will follow the mother around looking for solid food. Males do not seem to participate in the care of the young, except indirectly through resource defense for the group.

Breeding interval: Breeding occurs once yearly.

Breeding season: Breeding occurs from September to November.

Average number of offspring: 1.

Average gestation period: 6 months.

Average weaning age: 3 months.

Range time to independence: 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 1650 g.

Average gestation period: 182 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
589 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Females nurse their young for one to two minutes several times a day for around 3 months. For the first two weeks of the young gazelle's life, the mother grazes and sleeps away from the young gazelle, leaving it in a safe spot. As the young gazelle grows, they join their natal group for the first year, or longer.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Ward, D., D. Saltz. 1994. Foraging at different spacial scales: dorcas gazelles foraging for lilies in the negev desert. Ecology, 75: 48-58.
  • Yom-Tov, Y., H. Mendelssohn, C. Groves. 1995. Gazella dorcas. Mammalian Species, 491: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella dorcas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCCTATATCTTCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCCTTAAGCCTACTGATCCGTGCCGAACTAGGTCAACCCGGAACTTTACTCGGAGACGATCAGATTTATAATGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGGTTTGGTAATTGACTAGTTCCTCTAATAATTGGTGCCCCCGATATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTATTACTTCTGGCGTCTTCCATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGTAACCTAGCTCACGCAGGTGCTTCAGTAGATCTAACCATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAATATGAAGCCTCCTGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCTGTTCTTATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTGTATCAACATCTGTTCTGATTCTTCGGACATCCTGAAGTATATATTCTAATTCTACCCGGATTCGGGATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTATGGGCCATAATATCTATCGGATTCTTAGGGTTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGATGTTGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGGGTAAAAGTTTTCAGCTGACTAGCTACGCTTCATGGAGGTAACATTAAATGATCACCTGCCATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATTGTCCTAGCCAATTCTTCTCTTGATATTGTTCTCCACGATACATACTATGTAGTTGCACACTTCCACTATGTATTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCCTAGGGCTATCTGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTAATATTAATAATTTTCATCATTTGAGAAGCATTTGCATCCAAACGGGAAGTTCTAACCGTAGACCTTACTACAACAAATTTAGAGTGACTAAATGGATGCCCTCCCCCATACCACACATTTGAAGAGCCTACATATGTCAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella dorcas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Numbers have been in decline for some time mainly due to hunting, and these declines have worsened with more intensive motorized hunting (East 1999; Mallon and Kingswood 2001; Lafontaine et al. 2006). Habitat degradation resulting from overgrazing by livestock and drought have also had negative impacts. Over the whole range, these declines are continuing and are estimated to have exceeded 30% over three generations (18 years, 1988 to 2006).

History
  • 2007
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Lower Risk/near threatened
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is considered threatened and in the past was classified as vulnerable by the IUCN. The ongoing threats to this species are habitat destruction and illegal hunting.

US Federal List: threatened

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Status: VULNERABLE

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Gazella dorcas is classified as Vulnerable (VU A1a) by the IUCN Red List 2003 (1) and listed on Appendix III of CITES (3). The Moroccan dorcas gazelle (Gazella dorcas massaesyla) is classified as Endangered under IUCN criteria (3). Six subspecies have been described, but the validity and distribution of most of these subspecies are uncertain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) compiled figures that suggested a sub-Saharan population of 35,000 to 40,000 and a total population somewhere in the tens of thousands. Numbers were declining generally, except where hunting pressure was low (East 1999).

Lafontaine et al. (2005) report recent declines in almost all range states and say it has disappeared from many regions and is seriously reduced in numbers where it survives. The largest current populations are in Chad (especially in the Ouadi Rimé-Ouadi Achim Faunal Reserve), Niger (Aïr-Ténéré National Nature Reserve and the Termit Massif-TinToumma), and the horn countries (Scholte and Hashim in press, and references therein). In Morocco, the wild population is estimated at 800- 2,000 individuals (Cuzin et al. in press). The population in Israel was estimated at >2,000 and stable (Clark and Frankenberg 2001).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats include overhunting, and habitat degradation due to overgrazing by livestock and drought.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorcas Gazelle populations have declined throughout its range. Threats facing this species include habitat loss due to the expansion of agriculture and overgrazing by domestic sheep and goats. Uncontrolled poaching for sport and food as well as predation by dogs are also taking a toll.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Numbers of this gazelle have declined throughout its range (1). Threats facing this species include habitat loss due to the expansion of permanent agriculture and grazing pressures caused by domestic sheep and goats. Poaching for food and predation by dogs are also problems, but the most serious threat throughout this gazelle's range is uncontrolled illegal hunting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CMS Appendix I and included in the CMS Sahelo-Saharan Antelopes Action Plan. Legally protected or partially so in several range states. Dorcas Gazelle occur in many protected areas throughout their range, including: M?Sabih Talâa Reserve and El Kheng Reserve (Morocco); Tassili and Ahaggar National Parks (Algeria); Bou-Hedma, Sidi Toui, Dghoumes, Oued Dekouk and Djebil National Parks (Tunisia); New Hisha Nature Reserve, Sabratha, Surman and El-Kouf National Park (Libya); Elba National Park and Saint Catherine Protectorate (Egypt); Banc d?Arguin National Park (Mauritania); Ouadi Rimé - Ouadi Achim Reserve (Chad); and Mille-Sardo Wildlife Reserve (Ethiopia) (Scholte and Hashim in press). In Libya, the New Hisha Nature Reserve, Sabratha, and Surman populations are enclosed, whereas the El-Kouf National Park is free-living (T. Jdeidi pers. comm.). There are several other populations in protected areas in Morocco, but the populations listed above (M?Sabih Talâa Reserve and El Kheng Reserve) are particularly valuable as they are known to be of local origin (Cuzin et al. in press).

Dorcas Gazelle do well in captivity, and are particularly common in several privately owned, captive collections in the Middle East (most originating from Egypt, the horn of Africa and Sudan) (Scholte and Hashim in press). Additionally, there is a well-managed captive population in Almeria (Spain), originating from Western Saharan stock.

Listed in CITES Appendix III (Algeria, Tunisia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

This species lives within national parks, nature reserves and other protected areas in a number of the countries in which it occurs. It is protected by law in Morocco, Algeria, Tunisia, Libya, Egypt, Jordan and Israel; however in some areas enforcement is poor (3). In many countries, it has been proposed that further reserves should be created and enforcement of existing legal protection should be improved. In Tunisia, there is a need to determine the status of the species in the wild, and to determine where conservation action, such as carrying out reintroductions of captive-bred stock, should be used to restore the species. Captive breeding and reintroductions have also been proposed in Libya (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Gazella dorcas is better adapted for the environment around Israel in the Negev desert than other grazing animals. They outcompete other grazers such as sheep and goats that are used for economic purposes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Gazella dorcas is hunted as a food source.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dorcas gazelle

The Dorcas gazelle (Gazella dorcas), also known as the Ariel gazelle, is a small and common gazelle. The Dorcas gazelle stands about 55-65 cm (1.8-2.1 ft) at the shoulder, with a head and body length of 90-110 cm (3-3.6 ft) and a weight of 15-20 kg (33-44 lb). The numerous subspecies survive on vegetation in grassland, steppe, wadis, mountain desert and in semidesert climates of Africa and Arabia. About 35,000 - 40,000 exist in the wild. The extinct Saudi gazelle from the Arabian Peninsula has been previously considered as a subspecies of the Dorcas gazelle.

Contents

Subspecies [edit]

  • Gazella dorcas beccari - Eritrean Dorcas gazelle
  • G. d. dorcas - Egyptian Dorcas gazelle
  • G. d. isabella - Isabella's gazelle[1]
  • G. d. massaesyla - Moroccan Dorcas gazelle
  • G. d. osiris - Saharan Dorcas gazelle
  • G. d. pelzelni - Pelzeln's gazelle

Description [edit]

Skull
Horns of a Dorcas gazelle (above) and rhim gazelle (below)

The Dorcas gazelle is similar in appearance to, yet smaller than, the closely related mountain gazelle (Gazella gazella). Dorcas gazelles have longer ears and more strongly curved horns, which bow outwards then turn inwards and forwards at the tips. Individuals belonging to the Saharan subspecies (G. d. osiris) have very pale, fawn-colored coats. The white underside is bordered with a brown stripe, above which is a sandy stripe. The forehead and face are darker than the body. Subspecies from north of the Sahara tend to be more ochre in color, and have dark flanks and facial stripes. Populations in Israel and around the Red Sea are darker and more reddish. In the last century, the populations of Dorcas gazelle were partially destroyed in all the countries where it was found.

Currently, large populations of Dorcas gazelles are found in the Negev and the Arava, with other large populations in Sudan, Iraq, and the southern part of the eastern desert of Egypt. In Israel, only 1000-1500 gazelles remain.

Behaviour [edit]

Dorcas gazelles

Dorcas gazelles are highly adapted to the desert; they can go their entire lives without drinking, as they can get all of the moisture they need from the plants in their diets, though they do drink when water is available. They are able to withstand high temperatures, but when it is very hot, they are active mainly from dusk to dawn. In areas where they face human predation, they tend to be active only at night to minimise the risk of falling prey to hunters. These gazelles feed on leaves, flowers, and pods of many species of acacia trees, as well as the leaves, twigs and fruits of various bushes. They occasionally stand on their hind legs to browse from trees, and after rain, they have been observed digging out bulbs from the ground. Dorcas gazelles are able to run at speeds up to 80 km/hr (50 mph)[2] to 96 km per hour (60 mph)[3] when threatened, they tail-twitch and make bouncing leaps with their heads held high (stotting), possibly to announce they have seen a predator.

Breeding [edit]

When conditions are harsh, Dorcas gazelles live in pairs, but when conditions are more favorable, they join together in family herds with one adult male, several females, and young. During the breeding season, adult males tend to be territorial, and mark their range with dung middens. In most parts of their range, mating takes place from September to November. Gestation takes six months; a single fawn is typical, although twins have been reported in Algeria. The newborn is well developed at birth, with fur and open eyes. Within the first hour, the fawn attempts to stand, and it will suckle on this first day of life. In the first two weeks, the young gazelle lies curled up in a scrape on the ground or beneath bushes while the mother grazes close by. The young then starts to follow its mother around and begins to take solid food. After around three months, the fawn stops suckling and is fully weaned. Some Dorcas gazelles are also known for their dangerous behaviors when surrounded. There have been many reports of deaths involving them.

Threats [edit]

Range of the Dorcas gazelle

The population of this gazelle has declined throughout its range. Their natural predators include humans, cheetahs, leopards, Arabian wolves, and lions. Due to human hunting, few large cats remain to prey on Dorcas gazelles. Mostly unhealthy gazelles are caught successfully by predators, since the healthy gazelles tend to escape them. To escape the cheetah, the fastest of carnivores, they run extremely fast and make zigs-zags, as does the Thomson's gazelle. The serval and caracal also prey on this species. The biggest modern threat to this gazelle is ever-expanding human civilization, which shrinks the gazelle's habitat by converting it to farmland, and by introducing new flocks of domestic sheep and goats which compete with gazelles for grassland.

See also [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!