Overview

Brief Summary

Biology

Dama gazelles form mixed herds of 10 to 20 animals which roam widely to find enough vegetation and water to survive. They migrate seasonally, forming larger groups of several hundred, in which they move north into the Sahara desert at the start of the rainy season and back south into the Sahel for the dry season. They feed on acacia, bush leaves and grasses, and may stand on their hind legs to reach higher foliage. Dama gazelles are preyed upon by cheetahs, Cape hunting dogs, lions, leopards, hyenas and jackals (2) (5). Females reach sexual maturity at nine to twelve months and males between 18 and 24 months. Breeding takes place between March and June, and a single calf is born six and a half months later (2). Initially the newborn calf is hidden from the herd, but begins to follow its mother after a few days (13). The calf will be weaned at around six months old (2). Males are territorial during the breeding season, when they guard several females, and will mark their territory with faeces, urine, and secretions from the preorbital glands beneath the eyes (15).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The largest of all gazelle species, the dama gazelle has at least two subspecies, which vary greatly in colour. The eastern subspecies, known as the red-necked gazelle (Gazella dama ruficollis), is bright white with a reddish-brown neck. However, the degree of colouration increases from east to west, and the most westerly subspecies, the Mhorr gazelle (Gazella dama mhorr), is almost completely red, apart from the undersides and the rump. It has a small white patch on the throat, and a white face, with red cheek patches and thin black stripes running from the eyes to the corners of the mouth. All dama gazelles have thin legs and a long, slender neck, as well as long, S-shaped horns, which are larger and thicker in males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Formerly widespread in the Sahara and Sahel zones, but their range and numbers have been extremely reduced. In North Africa, Dama Gazelle are now probably extinct, although they may survive in the Drâa (where observations were made by nomads in 1993) (Cuzin 1996; Aulagnier et al. 2001). It is also possible, though increasingly unlikely, that they may survive in very small numbers along the border between southern Morocco and Mauritania (Cuzin et al. in press). They may also survive in the Tassili de Tin Rehror in southern Algeria (K. De Smet pers. comm.). In Tunisia, they are believed to have occurred in the south and to have disappeared before the 20th century (Smith et al. 2001).

South of the Sahara, Dama Gazelle are still present in eastern Mali, Air and Termit/Tin Toumma in Niger, and in the Chadian Manga and Ouadi Rimé Ouadi Achim Nature Reserve in Chad (Scholte in press, and references therein); however, aerial and ground surveys of Termit-Tin Toumma in 2007 failed to record any Dama Gazelles (Wacher et al. 2007). They are now thought to be extinct in Mauritania, and are probably extinct in Nigeria, Burkina Faso, and Libya (see Scholte in press for summary, and references therein). There are no recent confirmed records from the Sudan, although East (1999) mentioned it could still occur at low densities in Northern Darfur and Northern Kordofan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Nanger dama inhabits the countries of the African Sahel and Sahara Desert. At one time, the range of this mammal extended as far as Morocco and Egypt. However, excessive hunting has reduced their range to only the area between Senegal (where it was re-introduced) and Sudan.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Atkins, W. 2003. Gazella dama. Pp. 48 & 57 in M Hutchins, ed. Grzimerk's Animal Life Encyclopedia, Vol. 16, 2nd Edition. Detroit: Thomson Gale.
  • Massicot, P. 2004. "Animal Info - Dama Gazelle" (On-line). Accessed January 31, 2006 at www.animalinfo.org/species/artiperi/gazedama.htm.
  • Walther, F. 1990. Gazelles and related species. Pp. 462-463 in S Parker, ed. Grzimek's Enyclopedia, Vol. 5, 1 Edition. New York: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North Africa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once a numerous and widespread animal, the dama gazelle was found from Morocco, Senegal and Mauritania eastward to the Sudan. It suffered a serious decline in recent years and is now found only in Chad, Mali and Niger (6). Recent surveys in these three countries found very few gazelles, making the dama one of the most threatened species in Africa (7) (8) (9) (10) (11). Captive-bred groups of the Mhorr gazelle have been reintroduced into fenced areas in Senegal, Morocco and Tunisia (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Nanger dama has a body with lean legs and a long slender neck. Its glossy coat is characterized by patches of reddish-brown and white. Its face and undersides are always white, its neck is reddish-brown, and its throat always bares a white patch. However, color varies between sub-species. Nanger dama mohrr, the western sub-species, is almost completely red, excluding its undersides and posterior. It also boasts red cheek patches and black stripes which trace from its eyes to the corner of its mouth. The eastern sub-species, Nanger dama ruficollis is mostly white, with its reddish-brown color only showing on its neck and back.

These animals possess horns that are shaped like the letter S; they point back and curl upwards. The horns generally range from 25 to 35 cm in length, with males possessing slightly larger sets than females. They are also sexually dimorphic in size, with females usually weighing 35 to 40 kg, and males ranging anywhere from 40 to 75 kg in weight.

Their basal metabolic rate is relatively high given their body size, as is often the case for members of Artiodactyla.

Range mass: 35 to 75 kg.

Range length: 140 to 168 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits Sahelian grasslands, sparsely wooded savanna and sub-desert steppes with Acacia and Panicum vegetation; usually avoids really sandy areas, but will frequent low mountains and mountain plateaus, probably as refugia. In southern Morocco, it was found in areas without any Acacia, but with dense shrub cover (Cuzin 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Generally, Nanger dama is found in arid areas with sparse vegetation. However, its habitat changes slightly throughout the year, as this animal migrates seasonally. Dama gazelles resides on the pastures and plateaus of the Sahara desert during the rainy season, and move to the open bushlands in the dry season. This species avoids the mountains and dunes of the region, instead opting for the flatter, stonier plains. Unfortunately, due to overgrazing by livestock, land development by humans, and long term climate change, the habitat of N. dama has become even drier and somewhat less suitable through the years.

Range elevation: 760 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the dama gazelle normally inhabits grasslands and semi-desert, it is mainly found today in marginal areas on stony plains and plateaus, and mountain foothills (13) (14).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Nanger dama is a grazer, feeding on shrubs, herbs, coarse desert grasses, and Acacia tree leaves. These gazelles often stand on their hind legs in a bipedal fashion in order to reach the higher leaves of these trees. Members of this species are able to get most of the water they need from the plants they eat.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Nanger dama controls the spread of Acacia trees by grazing on their leaves. These gazelles are also a source of food for many of the carnivores that live and hunt on the plains.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Nanger dama has many predators, including jackals, cheetahs, spotted hyenas, and lions. Fleeing is their main defense, and they are well adapted for running.

When a Dama gazelle spots a predator, it assumes an alert posture, and often stamps its feet, walks in circles, twitches its flank skin, and snorts in order to warn other members of the tribe.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Most communication in this species is through body language. For example, erect posture in males demonstrates aggressiveness and high rank, and is also used in sexual displays. Males may also angle their heads or ram bushes so as to draw attention to their horns. Submission, on the other hand, is often represented by lowering of the head, or by jutting of the chin. Turning or moving away are also employed as ways to indicate submission. These animals utilize scent as well, as all members of a tribe urinate and defecate as a way of marking their territory against outsiders. Males have been known to snort or sputter during sexual displays.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, members of N. dama generally live up to 12 years. In captivity, they have been known to live into their late teens (18-19).

Range lifespan

Status: captivity:
19 (high) years.

Typical lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.3 years (captivity) Observations: One captive specimen lived 19.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating season can begin as early as August and end as late as October. During this time, males become territorial and engage in behaviors that indicate their aggressiveness and status. They usually urinate or defecate to mark their territory and horn the grass to advertise their strength and high status. Males also herd and chase to keep females in their vicinities and other rival males away.

The courtship behaviors of males usually include prancing, nose-lifting, upright posture, kicking of their forelegs, and touching, nibbling, or licking of the female with their muzzles. Some males may even resort to sputtering or snoring to get the attention of a mate.

A receptive female often walks in circles, makes sharp turns, and holds out her tail to indicate that she is ready to mate. The male mounts by standing behind her on his hind legs, with his forelegs curled in toward his own body. It is common for the female to continue moving during copulation.

Mating System: polygynous ; cooperative breeder

Mating generally occurs between the months of August and October, although it has been known to occur year-round in captivity. The estrous cycle of female N. dama usually lasts about 19 days, although it can be as short as 16 days or as long as 22 days.

Generally, this species gives birth to one offspring at a time, although in rare circumstances, twins are born.

Immediately after birth, mothers keep newborns sequestered from the rest of the herd. After a few days, however, the young are usually strong enough to follow their mothers around the grasslands and be seen by other members of the herd.

Breeding interval: Dama gazelles breed once a year.

Breeding season: In the wild, mating usually occurs between the months of August and October.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 5.5 to 6 months.

Range weaning age: 3 to 4 months.

Range age at sexual or reproductive maturity (female): 1.5 to 2 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

The mothers of this species invest lots of energy in protecting their young. It is quite common for two females to team up in defending their offspring, as pairs of females can often be observed chasing and attacking jackals that are hunting young gazelles.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

  • Estes, R. 1993. The Safari Companion. Post Mills, Vermont: Chelsea Green Publishing Company.
  • Ybanez, M., M. Goyena, T. Abaigar, M. Garijo, C. Martinez-Carrasco. 2004. Periparturient increase in faecal egg counts in a captive population of mohor gazelle (Gazella dama mhorr). The Veterinary Record, 154: 49-52.
  • Pickard, A., T. Abaigar, D. Green, W. Holt, M. Cano. 2001. Hormonal characterization of the reproductive cycle and pregnancy in the female Mohor gazelle (Gazella dama mhorr). Reproduction, 122: 571-580.
  • Massicot, P. 2004. "Animal Info - Dama Gazelle" (On-line). Accessed January 31, 2006 at www.animalinfo.org/species/artiperi/gazedama.htm.
  • Walther, F. 1990. Gazelles and related species. Pp. 462-463 in S Parker, ed. Grzimek's Enyclopedia, Vol. 5, 1 Edition. New York: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nanger dama

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAGGATATTGGCACCCTATATCTCTTATTCGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCCTACTTATCCGTGCCGAACTAGGTCAACCCGGAACTTTACTCGGAGATGATCAAATTTACAATGTAGTCGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATACCCATTATAATTGGAGGATTTGGCAACTGACTAGTCCCTCTAATAATTGGTGCTCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTTTACTACTTTTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTGTACCCTCCCCTAGCAGGCAACCTAGCCCACGCAGGCGCCTCAGTAGATTTAACCATTTTCTCTCTTCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCCATCAACTTTATTACAACAATCATTAATATAAAACCCCCTGCAATATCACAATACCAAACCCCTTTATTCGTATGATCTGTTCTAATTACTGCCGTACTTCTACTCCTTTCACTTCCTGTACTAGCTGCCGGTATTACAATACTTCTAACAGACCGAAACCTAAATACAACTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAGCATCTATTCTGATTCTTCGGTCACCCTGAAGTGTATATTCTTATTTTACCCGGATTTGGAATAATTTCCCACATTGTTACCTATTATTCAGGAAAAAAGGAACCATTTGGATACATGGGAATGGTATGAGCCATGATGTCCATCGGGTTCTTAGGATTTATTGTATGAGCTCACCACATATTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTCACATCAGCTACCATAATCATTGCTATTCCGACTGGAGTAAAAGTCTTCAGCTGACTGGCCACACTTCACGGAGGCAACATTAAATGGTCACCTGCTATAATATGAGCACTAGGCTTTATTTTTCTTTTTACAGTCGGAGGCTTAACTGGAATCGTCCTAGCTAACTCCTCTCTTGATATTGTTCTCCACGATACATATTATGTAGTTGCACATTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATTATGGGAGGATTCGTGCACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAATATAACTTTCTTCCCACAACACTTCCTAGGACTATCTGGAATGCCACGACGATATTCTGATTATCCCGATGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTCATGTTAATAATTTTCATCATTTGAGAAGCATTTGCATCCAAACGAGAAGTCCTAACCGTAGATCTCACCACAACAAACTTAGAGTGACTAAATGGATGTCCTCCCCCATACCACACATTTGAAGAACCCACATACGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nanger dama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella dama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd; C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Newby, J., Wacher, T., Lamarque, F., Cuzin, F. & de Smet, K.

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
The sustained decline due to uncontrolled hunting and habitat loss has continued and is now estimated to have exceeded 80% over 10 years. Extensive field surveys have been made since 2001, but all subpopulations encountered are very small, with all at risk from unmanaged large-scale hunting, and the total population certainly numbers well less than 500 individuals. Decline is expected to continue based on ongoing hunting and unpredictable arrival of large hunting parties with high destructive potential from the Gulf states. The Dama Gazelle is following the same trail into extinction in the wild as the Scimitar-horned Oryx.

History
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 2006
    Critically Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/02/2005
Lead Region: Foreign (Region 10) 
Where Listed: North Africa


Population detail:

Population location: North Africa
Listing status: E

For most current information and documents related to the conservation status and management of Gazella dama , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species was declared vulnerable by the IUCN in 1986, and was later shifted to endangered status in 1990. The continuous decline of N. dama numbers has been attributed to hunting and habitat degradation caused by humans.

Currently, there are efforts in Senegal to increase the Dama gazelle population through semi-captive breedings programs.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The dama gazelle is classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and is listed on Appendix I of CITES (3) and the Convention on the Conservation of Migratory Species (4). Note: recent scientific thought is that this species should in fact be classified as belonging to the genus Nangur, as Nangur dama (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Numbers of Dama Gazelle have declined drastically since the 1950s and 1960s. The early 1970s population in the Ouadi Rime - Ouadi Achim Faunal Reserve in Chad, one of the former strongholds of the species, was estimated at 10,000-12,000 individuals, but today the species is very rare in this reserve (J. Newby, in Scholte in press). Known remnant populations are all very small and extremely fragmented; the only known populations of any size are in Manga (Chad), eastern Air (Niger), and the Mali/Niger border area. In all areas surveyed, numbers have been very low and the size of observed gazelle groups very small (range=1-5 individuals) (Lamarque et al. 2007). Subpopulations probably number around 20 individuals in all cases, are separated by hundreds of kilometers, and the total current wild population is certainly less than 500 individuals (J. Newby pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threats to this species include uncontrolled hunting (by nomads, military and by Arab hunting parties), and habitat loss and degradation due to overgrazing by domestic livestock (and the impact of expanded livestock rearing due to well construction in preferred habitats). Prolonged drought is also having an impact on pasture quality (Lafontaine et al. 2005; Scholte in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the recent past hunting of this species was common, until numbers fell dramatically (13). Now, additional threat comes from habitat loss due to desertification as well as overgrazing by livestock and the loss of tree cover following clearance by man (5) (13). The livestock not only cause drier land, but also drive the gazelle away. Civil unrest in several of the countries home to this once numerous gazelle has also contributed to its decline (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CMS Appendix I, and included in the CMS Sahelo-Saharan Antelopes Action Plan (Lafontaine et al. 2005). It is listed on CITES Appendix I.

The Réserve partielle de faune du Bahr-el-Ghazal (Chad), west of the present Ouadi Rimé Ouadi Achim N.R., and the Aïr-Ténéré N.P., harbour the remaining viable Dama Gazelle populations. Both reserves have suffered from military unrest resulting in the collapse of conservation infrastructure (Scholte in press; K. de Smet pers. comm. 2007).

Dama Gazelle are present in captivity, but the number of founders is limited (Sausman 1998; Thuesen 1998). Animals from Almeria breeding facility in Spain were introduced to an enclosure (R?mila Royal Reserve) in Morocco (130 present in 2007; Cuzin et al. in press) and gazelles from München Zoo (originally bred at Almeria) were released into an enclosure in Souss-Massa N.P. (12 animals in 2006); these semi-captives are intended to form part of a reintroduction programme in Morocco. All of the animals from Almeria stock originate from Western Sahara. Elsewhere, Dama Gazelle were released into the 2,000-ha Bou-Hedma N.P. in Tunisia in the early 1990s (Abaigar et al. 1997) where around 17 were present in 2006 (T. Wacher pers. comm.); gazelles have also been reintroduced to Guembeul Faunal Reserve in Senegal (Cano et al. 1993) and a reintroduction programme in Ferlo North Reserve is underway (7 animals).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The range of the dama gazelle falls on some of the poorest countries in Africa, and consequently little action is being taken to conserve this species. It is managed in captivity and exists in a few reserves in its range, but they are not well guarded, and offer little more protection than any other area (15).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Grazing by N. dama can take food away from livestock, negatively impacting humans involved in the business of raising animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans hunt gazelles for their meat and horns.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dama gazelle

This article is about the gazelle. For other uses, see Dama (disambiguation).

The dama gazelle, addra gazelle, or mhorr gazelle (Nanger dama, formerly Gazella dama) is a species of gazelle. It lives in Africa in the Sahara desert and the Sahel. This critically endangered species has disappeared from most of its former range due to overhunting and habitat loss, and natural populations only remain in Chad, Mali, and Niger.[1] Its habitat includes grassland, shrubland, semi-deserts, open savanna and mountain plateaus.[1] Their diets includes grasses, leaves (especially Acacia leaves), shoots, and fruit.

In Niger, the dama has become a national symbol. Under the Hausa name meyna or ménas[3] the dama appears on the badge of the Niger national football team, who are popularly called the Ménas.[4][5]

Description[edit]

The dama gazelle is white with a tannish-brown head and neck. Both sexes usually have medium-length ringed horns curved like an "S". Males' horns are about 35 cm (14 in) long, while females' horns are much shorter. The gazelles' heads are small with narrow muzzles, their eyes are relatively large, and they have longer necks and legs than most gazelles. These animals are between 90 and 120 cm (35 and 47 in) tall at the shoulder,[6] weigh between 35 and 75 kg (77 and 165 lb), and have lifespans up to 12 years in the wild or 18 in captivity.[7] A few days following birth, dama young are strong enough to follow the herd, and after a week, they are able to run as fast as the adults.

Damas are considered the largest type of gazelle, with incredibly long legs, which provide extra surface area on their bodies to dissipate heat, one of the many ways they stay cool in their hot desert environment. They also tend to need more water than some of their desert relatives, but they can withstand fairly long periods of drought. Unlike many other desert mammals, damas are a diurnal species, meaning they are active during the day.

Always on the alert, damas use a behavior called pronking to warn herd members of danger. Pronking involves the animal hopping up and down with all four of their legs stiff, so their limbs all leave and touch the ground at the same time. Males also establish territories, and during breeding season, they actively exclude other mature males. They mark their territories with urine and dung piles and secretions from glands near their eyes.

Subspecies status and conservation[edit]

The subspecies N. d. mhorr, the mhorr gazelle, is extinct in the wild, but present in breeding programs in Europe and America,[8] and several efforts have reintroduced animals into former and similar habitat areas.

The nominate subspecies, N. d. dama, is not represented in captivity and very rare in the wild.[8]

The addra gazelle, N. d. ruficollis, is present in captivity and very rare in the wild.

The numbers of this species have fallen by 80% over the last decade, and it is now listed as critically endangered with a population of less than 500.[1] They occur in poor countries and little action is taken to protect the species; the national parks are not well guarded and poaching still occurs.[1] It has been extirpated from Libya, Mauritania, Morocco and Nigeria. Populations remain in Chad, Mali and Niger, and it has been reintroduced in Senegal and Tunisia.[1]

Threats to survival[edit]

Biological threats[edit]

Dama gazelles do not need a lot of water, but they need more than other desert animals. They are not as resistant and perish from a lack of water during the drought season. The environment has become ill-suited for them. Habitat pressure from pastoral activity is another reason for decline, as are introduced diseases from livestock.[9]

Human threats[edit]

Another reason for the decline of this gazelle is habitat destruction. Humans cut down the branches of the trees on which these gazelles feed. As a result, the trees die and the gazelle cannot eat.[10]

Human threats are the most dangerous of threats to the dama gazelle. The main reason this species of gazelle is endangered is because of mechanized hunting; hunters using vehicles increase their decline.[10] Civil unrest, for instance in Sudan, also negatively affects the life of the dama gazelle.[10] Since the gazelle is already having a hard time surviving, these conditions have made its habitat unsuitable.[11]

A new threat the gazelle faces is tourism. Tourists want to take pictures of this endangered species, and in doing so, may be perceived as a threat, especially during the hot season.[10] Gazelles will run away from perceived danger, and in the hot season may overheat and die of stress.

Conservation efforts[edit]

As of today, very few actions have been taken in the conservation of the dama gazelle.[9] The few measures that have been taken are reserves so the animal can live in peaceful environment and captive breeding to help rebuild the populations.

A reserve for mhorr gazelles was set up in 1971 to help avoid extinction. This reserve, Parque de Rescate de la Fauna Sahariana (Rescue Park for Saharan Fauna) of the Estación Experimental de Zonas Áridas (Experimental Station of Arid Zones), is in Spain. The reserve has been a success and is still around today.[12]

Another reserve for the mhorr subspecies was set up in Chad, the Ouadi Rime-Ouadi Achime Faunal Reserve.[10] This reserve was effective from 1978–1987, but due to civil war, it was abandoned.[9]

Captive breeding is a very popular way to help an endangered species repopulate. The species reproduce in captivity and then are freed back into the wild. Though usually helpful, it may be bad because small population sizes are used, so genetic variance can be small due to inbreeding. This is the most effective way to avoid the species from going extinct.[12] Most addra gazelles are now managed in zoos and AZA institutions in the United States according to a Species Survival Plan.[9] One participant in the plan, White Oak Conservation in Yulee, Florida, has bred the gazelles since 1983, resulting in nearly 300 births.[13]

Addra gazelles, part of the breeding program at the National Zoo in Washington, DC

Small population size and inbreeding are a serious concern in this population due to the increased parasite load and reduced reproductive viability.[14] No reserves for this subspecies exist in the wild, and few substantial in situ conservation efforts have been mounted due to the political situation in their currently fragmented habitat. The survival of this species depends on more reserves being created in the Sahelian and Saharan zones, where the highest concentration of gazelles reside.[10] As the population deteriorates, researchers in 2008 stressed the need for healthy captive population and for help to preserve their habitats in the wild.[9]

Gallery[edit]

References[edit]

  1. ^ a b c d e f Newby, J., Wacher, T., Lamarque, F., Cuzin, F. & de Smet, K. (2008). "Gazella dama". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 11 May 2006.  Database entry includes justification for why this species is critically endangered
  2. ^ Nanger dama, MSW3
  3. ^ Dama Gazelle Nanger dama. Sahara Conservation Fund, 2007, 2011.
  4. ^ Orange 2012 Afcon qualifiers :130 Million FCFA for the Menas. 22/05/2011 StarAfrica sports.
  5. ^ Menas to test Pharaohs form. Confederation of African Football. 10-09-2010
  6. ^ Arkive Dama Gazelle
  7. ^ Gazella Dama Historical Studbook, AZA, 2008
  8. ^ a b Francois Lamarque, Amewey Ag Sid'Ahmed, Stephane Bouju,Gaoussou Coulibaly, Li, Daouda Maiga. (2007). "Confirmation of the survival of the Critically Endangered dama gazelle Gazella dama in south Tamesna, Mali". Oryx 41: 109–112. doi:10.1017/S0030605307001561. 
  9. ^ a b c d e "Addra gazelle, Gazella dama ruficollis". Retrieved 21 June 2013. 
  10. ^ a b c d e f J.F. Grettenberger, J.E. Newby. (1986). "The Status and Ecology of the Dama Gazelle in the Air and Tenere National Nature Reserve, Niger". Biological Conservation 38 (3): 207–216. doi:10.1016/0006-3207(86)90121-7. 
  11. ^ Thompson A, Sudan’s migrating wildlife wows scientists. MSNBC, 2007.
  12. ^ a b F. Berlinguer, R. Gonzalez, S. Succu, A. del Olmo, J.J. Garde, G. Espeso, M. Gomendio, S. Ledda, and E.R.S. Roldan. (2008). "In vitro ooctye maturation, fertilization and culture after ovum pick-up in an endangered gazelle (Gazella dama mhorr)". Theriogenology 69 (3): 349–359. doi:10.1016/j.theriogenology.2007.10.001. PMID 18022681. 
  13. ^ "Addra Gazelle". Retrieved 21 June 2013. 
  14. ^ Jorge Cassinello, Montserrat Gomendio, Eduardo R.S. Roldan. (2001). "Relationship between coefficient of inbreeding and parasite burden in endangered gazelles". Conservation Biology 15 (4): 1171–1174. doi:10.1046/j.1523-1739.2001.0150041171.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!