Overview

Brief Summary

Biology

Indian rhinos are solitary except when calves accompany their mothers (5). A calf remains with its mother until the birth of the next calf (6), when it is chased away (5). Females reach sexual maturity between five and seven years of age and give birth to a single calf about once every three years (4). Males tolerate intruders in their range except during the breeding season when fights over females can be fierce, and may even end in death where population densities are high (5). These rhinos are grazers, feeding preferentially on tall grasses, although they also eat other vegetation including leaves, fruit and aquatic plants. They feed in the cool of the evening or early morning. The prehensile lip is used to pluck at grass stems (5). The Indian rhino is more aquatic than most other rhinoceros species, readily swimming and wading (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Indian rhinoceros is the largest of the Asian rhinos (4). It has a single horn, which can be as long as 53 centimetres (5) and, like all rhino horns, is composed of keratin rather than bone (6). The skin is grey-brown and has many loose folds and tubercles, giving an armour-plated appearance. Indian rhinoceroses are often accompanied by 'tick birds' (several species, including myna birds) and egrets that ride on their backs, which are thought to feed on parasites between the folds of skin. Egrets also forage on the insects exposed by the moving feet of the rhino. Males have large, sharp incisors that may be used in fights over females in the breeding season (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Historically, the Indian rhinoceros once existed across the entire northern part of the Indian subcontinent, along the Indus, Ganges and Brahmaputra River basins, from Pakistan to the Indian-Burmese border, including parts of Nepal, Bangladesh and Bhutan (Foose and van Strien 1997). It may also have existed in Myanmar, southern China, and Indochina, though this is uncertain. The species was common in northwestern India and Pakistan until around 1600, but disappeared from this region shortly after this time (Rookmaker, 1984). The species declined sharply in the rest of its range from 1600-1900, until the species was on the brink of extinction at the beginning of the twentieth century.

Currently, the Indian rhinoceros exists in a few small subpopulations in the Nepal and India (West Bengal, Uttar Pradesh, Assam) (Foose and van Strien 1997; Grubb, 2005), with an unsuccessful reintroduction of a pair in 1983 into Pakistan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found in northern Pakistan, India, Nepal, Bangladesh, and Assam.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
India, Nepal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Previously found throughout the northern Indian sub-continent. Scattered populations now occur only in northeast India, Bhutan and Nepal (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Both male and female R. unicornis have a single dark horn on the nose measuring up to 529 mm, which is made from agglutinated hairs. Their skin has many loose folds, especially distinct around the neck region in males, which give the appearance of a suit of armor. The skin is covered with large tubercules.

Range mass: 1500 to 2000 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species inhabits the riverine grasslands of the Terai and Brahmaputra Basins (Foose and van Strein 1997). The species prefers these alluvial plain grasslands, but was known to occur in adjacent swamps and forests. The populations are currently restricted to habitats surrounded by human-dominated landscapes, so that the species often occurs in adjacent cultivated areas, pastures, and secondary forests. The diet includes mainly grasses, but also some fruit, leaves, shrub and tree branches, and cultivated crops (Nowak, 1999). The species also utilizes mineral licks regularly. Males are solitary, with unstructured, overlapping territories. The females solitary unless occurring with young.

Its life history characteristics are not well known, with longevity estimated at about 30-45 years, gestation length of approximately 16 months (as with other rhino species), and age at sexual maturity estimated at 5-7 years for females and 10 years for males (Nowak, 1999; IRF website, 2006).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alluvial plain is the primary and preferred habitat. Adjacent swamp and forest areas are also used.

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These rhinos preferentially inhabit floodplain grasslands and adjacent swamps and forests but recent habitat loss has forced them into more cultivated land (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet consists of grass, fruit, leaves, branches, aquatic plants, and cultivated crops. Tall reedy grasses are preferred to short species. The prehensile upper lip is used to curl around grass stems to bring them into the mouth. When eating aquatic plants, rhinos submerge their entire heads and tear the plant up by the roots. Foraging occurs at night, in early morning, or late afternoon to avoid the heat of the day. Rhinoceros unicornis drinks daily and is fond of mineral licks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Status: captivity:
47.0 years.

Average lifespan

Status: wild:
49.0 years.

Average lifespan

Status: wild:
45.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43.5 years (captivity) Observations: In the wild, these animals are estimated to live up to 40 years (Bernhard Grzimek 1990). There is one report of one animal living for 47 years in captivity (Ronald Nowak 1999), but this is doubtful. One wild born male was about 43-44 years old when he died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding occurs throughout the year. Only dominant bulls mate, and it is believed that they can assess the reproductive status of females through scent. Courtship may seem aggressive--males chase females and fighting often ensues. After a gestation period of 480 days, one young is born weighing 70 kg. Weaning usually occurs in one year, although it may last up to 18 months. Females have young at intervals of about three years. One week before the next birth, the female will chase away her previous calf. Sexual maturity is reached at an age of 9 years for males, and 4 for females. The lifespan is about 40 years.

Average birth mass: 58000 g.

Average gestation period: 479 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2557 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1678 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinoceros unicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACTCTATACCTGTTATTTGGCGCCTGAGCTGGAATAGTAGGAACCGCCCTAAGCCTTCTAATTCGCGCCGAATTAGGTCAGCCCGGGACCTTACTAGGTGATGATCAAATCTACAATGTAGTCGTGACTGCCCATGCATTCGTAATAATTTTCTTTATGGTTATGCCCATTATAATTGGAGGATTCGGAAACTGATTGGTCCCATTAATAATTGGAGCACCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCTTACCACCATCATTTCTTCTTCTGCTTGCATCATCAATAGTTGAAGCCGGTGCCGGAACAGGCTGGACTGTCTACCCTCCCCTAGCCGGCAATCTAGCCCATGCAGGAGCTTCTGTTGACCTAACCATCTTTTCCCTACACCTAGCAGGGATCTCCTCAATTTTAGGGGCCATCAACTTTATCACTACGATTATTAATATAAAACCACCAGCCATATCCCAGTACCAGACACCTCTATTCGTATGATCCGTCCTAATTACAGCAGTGCTACTATTATTAGCACTCCCAGTCCTAGCAGCAGGAATTACTATATTACTAACAGACCGTAACCTAAACACCACCTTCTTCGACCCGGCAGGGGGAGGTGACCCTATCCTATACCAACATCTCTTCTGATTCTTTGGTCACCCCGAAGTCTACATTCTGATCCTACCAGGCTTTGGGATAATCTCACACATTGTTACATATTACTCAGGAAAAAAAGAGCCATTTGGTTATATAGGAATAGTATGAGCTATAATATCCATCGGATTCTTAGGGTTCATTGTATGAGCCCACCACATATTTACAGTTGGAATAGACGTTGACACACGAGCATACTTTACATCTGCCACTATAATTATTGCTATTCCCACAGGCGTAAAAGTATTTAGCTGATTAGCCACCCTTCACGGAGGGAATATCAAATGATCGCCAGCCATGCTATGAGCCCTAGGCTTTATCTTCCTATTCACAGTAGGAGGCTTAACTGGAATTGTCCTAGCTAACTCGTCACTAGATATTGTACTTCACGACACATACTATGTAGTAGCACACTTCCACTATGTATTATCTATGGGAGCAGTATTTGCTATCATAGGAGGATTCGTCCACTGATTCCCCTTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATTCACTTTACAATCATATTCGTGGGGGTCAATATAACCTTCTTCCCACAACATTTTCTTGGTCTATCAGGAATACCTCGCCGTTACTCAGATTACCCAGATGCATACACAACATGAAATACCATTTCATCTATGGGATCCCTCATCTCGCTCACAGCAGTAATACTCATAGTGTTCATAGTTTGAGAAGCATTTGCATCCAAACGAGAAGTCTCAACAGTAGAACTAACCTCTTTTAACCTAGAATGACTGCATGGATGCCCCCCTCCATATCATACATTCGAAGAGCCTGTGTATGTGAATTTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinoceros unicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2008

Assessor/s
Talukdar, B.K., Emslie, R., Bist, S.S., Choudhury, A., Ellis, S., Bonal, B.S., Malakar, M.C., Talukdar, B.N. & Barua, M.

Reviewer/s
Talukdar, B.K. & van Strien, N.J. (Asian Rhino Red List Authority)

Contributor/s

Justification
The Greater One-horned Rhinoceros populations are increasing overall due to strict protection, especially in India. However, some populations are decreasing, especially in Nepal and parts of northeastern India. The species is currently confined to fewer than ten sites, with a total extent of occurrence of less than 20,000 km². There is a continuing decline in the quality of habitat, projected to continue into the future, which, if not addressed, will affect the long-term survival of some of the smaller populations, and could jeopardize the further recovery of the species. Its populations are also severely fragmented, and with over 70% of the population in Kaziranga National Park, a catastrophic event there could have a devastating impact on the status of the species.

History
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Total wild populations number 1700. Rhinoceros unicornis is severely threated by hunting activities due to the huge economic value of the horn. This species is listed endangered by the IUCN and USDI and is on Appendix 1 of CITES. Current projects are underway to reintroduced populations in areas where they have been extirpated. Such projects will only be successful if the reason for the initial downfall of rhinos --overhunting by humans--can be eliminated. Efforts to control poaching and illegal wildlife trade will help in the recovery of the Indian rhino. One population in Nepal is protected with 700 armed troops and rangers, almost 2 guards per rhino. Aside from overhunting, the loss of alluvial plain habitat to agriculture has resulted in a reduction of suitable rhino habitat.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinoceros unicornis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population estimate in May 2007 was estimated to be 2,575 individuals, with estimates of a total of 378 in Nepal and 2,200 in India (Asian Rhino Specialist Group 2007). The Indian Rhino, with strict protection from Indian and Nepalese wildlife authorities, has recovered from a total population of under 200 in the early 1900s. Although some populations have declined in recent years, overall there has been a population increase for almost 100 years which still continues.

India
The species exists in several protected areas in India, with the following population estimates in May 2007 (Asian Rhino Specialist Group 2007): Dudhwa National Park (21), Manas National Park (3), Karteniaghat (2), Kaziranga National Park (1,855 in 2006; 1,551 in 1999), Orang (68 in 2006; 46 in 1999), Pabitora (81 in 2006; 74 in 1999, 79 in 2004), Jaldapara (108 in 2006; 96 in 2004; 84 in 2002), Gorumara (27 in 2006; 25 in 2004; 22 in 2002). Estimates given in Foose et al. (1997) were as follows: Dudhwa National Park (11), Manas National Park (60), Karteniaghat (4), Kaziranga (1164 +/- 134), Orang (over 90), Pabitora (80 individuals over 38.8 km²) (Choudhury, 2005), Jaldapara (over 33), Gorumara (13), and a few remaining small populations in Assam. Kaziranga National Park, which was established as a reserve for the last 10-20 Indian rhinos in Assam in 1905, is home to over 70% of the global population of this species. Poaching rendered the species extinct in Laokhowa Wildlife Sanctuary by the mid-1990s (Foose et al., 1997), and there has also been a severe decline in Manas National Park due to poaching related to civil unrest. The overall population tendency is to increase (especially in Kaziranga, Pabitora, Dudhwa, Jaldapara and Gorumura), with decreases in Manas, Orang (now increasing again) and Laokhowa. The population in Karteniaghat is best described as transient (S.S. Bist pers. comm.).

Nepal
In the late 1960s, an estimated 65 Indian rhinos survived in Nepal, but due to increased conservation efforts, the total population was up to 612 in 2000. A total of at least 91 animals were poached in 2000-2003 (Martin, 2004), and since 2000, numbers have declined. In Royal Chitwan National Park, the number of individuals has declined from 544 individuals in 2000, to 372 individuals in 2005 (Asian Rhino Specialist Group 2007), the decrease being due to increased poaching following political instability in Nepal (Rothley et al., 2004; Khan et al., 2005), and habitat changes. In Royal Bardia National Park (where rhinos were re-introduced) there were approximately 40 individuals in 1997 (Foose et al., 1997) and 35 animals in 2007 (Asian Rhino Specialist Group 2007). In Royal Suklaphanta Wildlife Reserve (where the species was also re-introduced), the population is only six individuals (Martin, 2004; Asian Rhino Specialist Group 2007).

Pakistan.
A pair of rhinos was introduced into Lal Sohanra National Park in 1983, but have not bred.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species declined to near extinction in the early 1900s, primarily due to widespread conversion of alluvial plains grasslands to agricultural development, which led to human-rhino conflicts and easier accessibility for hunters. Sport hunting became common in the late 1800s and early 1900s. A reversal of government policies shortly thereafter protected many of the remaining populations. However, poaching, mainly for the use of the horn in Traditional Chinese Medicine has remained a constant and the success is precarious without continued and increased support for conservation efforts in India and Nepal. Poaching has lead to decreases in several important populations, especially those in Chitwan, Manas , Laokhowa, and the Babai Valley area of Bardia.

However, not all recent population decreases can be linked to poaching. There have been serious declines in quality of habitat in some areas. This is due to: 1) severe invasion by alien plants into grasslands affecting some populations; 2) demonstrated reductions in the extent of grasslands and wetland habitats due to woodland encroachment and silting up of beels; and 3) grazing by domestic livestock. In Chitwan (the second largest population) there is clear evidence that poaching on its own does not account for the observed level of population decline (R.H. Emslie pers. comm.), and there are trends in a number of reproductive indicators (i.e., decline in the percentage of adult females calving and in the percentage of the population that is calves) that are strongly indicative of negative changes in habitat quality. In Chitwan there has been severe infestation of some riverine and grassland areas by the climbing Mikania micrantha (which covers over indigenous vegetation), and invasion of Eupatorium in other areas. There is also heavy livestock grazing pressure and disturbance in buffer zone areas as well as some invasion of grasslands by Acacia catechu and Dalbergia sissou. It has been reported that grassland area in Chitwan has been reduced from 20% to 4.7% of the national park (R.H. Emslie pers. comm.).

In India, there is not yet any evidence that invasion by alien plants has caused any population decreases. However, in Orang National Park, there have been marked habitat changes due to grazing, human encroachment and silting up. In particular, short grass areas have declined by 75% due to silting up and draining of beels (B.N. Talukdar pers. comm.). Mimosa is also an alien invader in this area. In the Karnali floodplain area of Bardia there is also some invasion of habitat by the alien Lantana camara.

In Pabitora there has been an invasion of Ipomoea "weeds" into grassland areas (S. Dutta pers. comm.). There also has been an invasion of woodland into grassland and siltation and drying up of some water bodies. There also has been some human encroachment and very heavy livestock grazing. With increasing human densities this pressure is unlikely to get any less (S. Dutta pers. comm.). Analysis of satellite imagery has shown that there has a substantial increase in woodland (34.51%) in Pabitora since 1977 accompanied by decline in alluvial grassland (68%). This change of habitat is mostly because of natural succession process, livestock grazing from the nearby villages as well as improper management of the grassland habitat (Sarma et al., in press).

The West Bengal populations (Jaldapara and Gorumara) are affected by high levels of grazing from fringe villages, and there have been weed and climber infestations by Mikania cordata, M. scandens, Lantana camara and Leea spp.

The species is inherently at risk because over 70% of its population occurs at a single site, Kaziranga National Park. This area, is subject to poaching and tensions with the surrounding high human population due to human-wildlife conflicts (including conflicts with rhinos). The level of poaching in Kaziranga has generally not been at a level to prevent the ongoing increase in the population, but constant vigilance is required. Clearly, any catastrophic event in Kaziranga (such as disease, civil disorder, poaching, habitat loss, etc) would have a devastating impact on the status of this species.

Sex-ratio among the adult rhinos in Gorumara National Park is almost 1:1. As a result, intra-specific fights among the bulls are very common and these animals have a tendency to stray out of the National Park very often, leading to human-wildlife conflicts (S.S. Bist pers. comm.).

There are suggestions that the small population of rhinos in Jaldapara and Gorumara may be prone to in-breeding depression (S.S. Bist pers. comm.).

There have been proposals to dam the Bramaphutra River in Arunachal Pradesh, and should this happen in future this could very negatively affect the habitat quality and rhino carrying capacity of major parks like Kaziranga in future (by preventing or reducing the pulse of nutrients brought in by regular large floods). In Jaldapara Sanctuary, the River Torsa no longer overflows as a result of massive flood-control structures. As a result the water table in the sanctuary is receding and the natural water-bodies and wallow-pools used by rhinos are slowly drying up (S.S. Bist pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Indian rhinoceros was already considered a 'vanishing race' by the beginning of the 20th century, primarily due to the conversion of alluvial plain grassland to cultivated fields (6). Hunting, for sport and as pest control, was also a factor in the decimation of the population. Despite protection measures, poaching remains a serious threat today due to the demand for rhino horn in Oriental medicine; in 1994 for example, a kilogram of rhino horn was worth approximately US$60,000 (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species has been included on CITES Appendix I since 1975. The Indian and Nepalese governments have taken major steps towards Indian Rhinoceros conservation, especially with the help of the World Wide Fund for Nature (WWF) and other non-governmental organizations.

Indian Rhino populations occur almost exclusively within and around protected areas. In India, the species occurs in Kaziranga National Park (World Heritage Site), Manas National Park (World Heritage Site in danger), Dudhwa National Park (re-introduced population), Karteniaghat Wildlife Sanctuary, Orang National Park, Pabitora Wildlife Sanctuary, Jaldapara Wildlife Sanctuary, and Gorumara National Park. In Nepal, the species occurs in Royal Chitwan National Park, Royal Bardia National Park (re-introduced population), and Royal Suklaphanta Wildife Reserve (a very small re-introduced population). Strict anti-poaching measures are needed to maintain all of these populations. It is also important to reduce human-wildlife conflicts around these areas, and this might involve fencing. Many of the areas also require targeted programmes to control invasive plants, to prevent the spread of woodland, to safeguard wetlands through appropriate water management, and to limit the extent of grazing by domestic livestock. In Pabitora, specific recommendations have been made to increase the quality of feeding habitat of rhino within the sanctuary through meticulous manipulation and checking livestock grazing (Sarma et al., in press). Water holding mechanisms within the sanctuary during winter are crucial in terms of keeping moist grassland available in winter seasons, thereby reducing the number of rhinos straying out of the sanctuary and thus exposing themselves to poaching (Sarma et al., in press).

The area of Kaziranga National Park has officially been extended, although animals had access to this area previously as the original park area was not fenced. In West Bengal (Jaldapara and Gorumara), there is a programme of habitat improvement in old teak areas, weed control is being carried out in 50-60 ha annually.

With the support of the IUCN SSC Asian Rhino Specialist Group, an Indian Rhino Vision 2020 and a Nepal Rhino Action Plan have been developed. These cover a number of important and specific conservation measures, including: translocating rhinos to bolster struggling populations (e.g., Manas National Park) and to start new populations; improving security around rhino populations and reducing poaching; assessing habitat status and management needs; expanding available habitat through active management; improving protected area infrastructure; training staff in specific rhino conservation techniques; reducing human-wildlife conflicts; involving local people in rhino conservation; and implementing education and awareness programmes. Overall, there is a need for further reintroductions, thereby reducing the concentration of over 70% of the individuals in one large population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Indian rhinoceros has been brought back from the brink of extinction by a sustained conservation effort and numbers have increased from a few hundred individuals in the 1950s to over 2,000 today (6). The population is concentrated in protected reserves, and both Indian and Nepalese Wildlife Authorities have adopted schemes that involve protecting the species with armed troops; one population in Nepal is protected by 700-armed guards (5). Managed breeding is a successful tool in India and translocations have also been used to move animals from areas where they have become too numerous to other protected reserves (9). Priorities of the Asian Rhino Action Plan include the increase and maintenance of protection zones and sanctuaries and the halting of illegal trade (10). Of the three Asian rhinos, the survival of the Indian species may be the most promising, especially if local people can become directly involved.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Rhinos have been known to injure crops by trampling and consumption. At one point, a government bounty was established to keep rhinos from ruining tea plantations. In addition, there are recorded fatalities as a result of an attacks by rhinos, usually when a mother with calf was startled.

Negative Impacts: injures humans; crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Asian rhino horn can be sold for more than twice its weight in gold. After processing, it has been known to reach $30,000 per kg. The horn is used as a medicine and an aphrodisiac. Medicinal purposes are as a pain reliever and a fever suppressant. There are no scientific studies, however, that show that rhino horn is effective for any of these purposes. In addition to the horn, rhino hide, blood, urine, and dung also have economic value.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indian rhinoceros

The Indian rhinoceros (Rhinoceros unicornis) is also called greater one-horned rhinoceros and Asian one-horned rhinoceros and belongs to the Rhinocerotidae family. Listed as a vulnerable species, the large mammal is primarily found in north-eastern India's Assam and in protected areas in the Terai of Nepal, where populations are confined to the riverine grasslands in the foothills of the Himalayas.[2]

The Indian rhinoceros once ranged throughout the entire stretch of the Indo-Gangetic Plain but excessive hunting reduced the natural habitat drastically. Today, about 3,000 rhinos live in the wild, 2,000 of which are found in India's Assam alone.[3]

It is the fifth largest land animal.

Contents

Characteristics [edit]

The Indian rhino's single horn
Wart-like bumps on the hind legs.

Among terrestrial land mammals native to Asia, the Indian rhinoceros is second in size only to the Asian elephant. This heavily built species is also the second largest living rhinoceros, behind only the White Rhinoceros. Males have average head and body length of 368–380 cm (12.07–12.5 ft) with a shoulder height of 163–193 cm (5.35–6.33 ft) while females have an average head and body length of 310–340 cm (10.2–11.2 ft) and have a shoulder height of 147–173 cm (4.82–5.68 ft).[4][verification needed] The weights of captive individuals from the Basel Zoo were around 1,600 kg (3,500 lb) on average for the females and around 2,100 kg (4,600 lb) on average for the males. The skull is heavy with a basal length above 60 cm (24 in) and an occiput above 19 cm (7.5 in).[5]

The largest sized specimens can range up to 4,000 kg (8,800 lb).[6]

The rhino's single horn is present in both males and females, but not on newborn young. The black horn is pure keratin, like human fingernails, and starts to show after about 6 years. In most adults, the horn reaches a length of about 25 cm (9.8 in), but has been recorded up to 57.2 cm (22.5 in) in length.[7] The nasal horn is slightly back-curved with a base of about 18.5 cm (7.3 in) by 12 cm (4.7 in) that rapidly narrows until a smooth, even stem part begins about 55 mm (2.2 in) above base. In captive animals, the horn is frequently worn down to a thick knob.[5]

The Indian rhinoceros has thick, silver-brown skin, which becomes pinkish near the large skin folds that cover its body. Its upper legs and shoulders are covered in wart-like bumps. It has very little body hair, aside from eyelashes, ear-fringes and tail-brush. Males develop thick neck-folds.[5]

Distribution and habitat [edit]

Indian rhinoceros at Kaziranga National Park, India
Elephant safari after Rhinoceros unicornis in Chitwan National Park

One-horned rhinos once ranged across the entire northern part of the Indian subcontinent, along the Indus, Ganges and Brahmaputra River basins, from Pakistan to the Indian-Burmese border, including parts of Nepal, Bangladesh and Bhutan. They may have also existed in Myanmar, southern China and Indochina.They prefer the alluvial plain grasslands of the Terai and Brahmaputra basin.[8] As a result of habitat destruction and climatic changes their range has gradually been reduced so that by the 19th century, they only survived in the Terai grasslands of southern Nepal, northern Uttar Pradesh, northern Bihar, northern Bengal, and in the Brahmaputra Valley of Assam.[9]

On the former abundance of the species, Thomas C. Jerdon wrote in 1867:[10]

This huge rhinoceros is found in the Terai at the foot of the Himalayas, from Bhotan to Nepal. It is more common in the eastern portion of the Terai than the west, and is most abundant in Assam and the Bhotan Dooars. I have heard from sportsmen of its occurrence as far west as Rohilcund, but it is certainly rare there now, and indeed along the greater part of the Nepal Terai; ... Jelpigoree, a small military station near the Teesta River, was a favourite locality whence to hunt the Rhinoceros and it was from that station Captain Fortescue, of the late 73rd N.I., got his skulls, which were, strange to say, the first that Mr. Blyth had seen of this species, of which there were no specimens in the Museum of the Asiatic Society at the time when he wrote his Memoir on this group.

Today, their range has further shrunk to a few pockets in southern Nepal, northern Bengal and the Brahmaputra Valley. In the 1980s, rhinos were frequently seen in the narrow plain area of Royal Manas National Park in Bhutan. Today, they are restricted to habitats surrounded by human-dominated landscapes, so that they often occur in adjacent cultivated areas, pastures, and secondary forests.[9]

Rhinos are regionally extinct in Pakistan.[11]

Populations [edit]

Population trend since 1910

In 2007, the total population was estimated to be 2,575 individuals, of which 2,200 lived in Indian protected areas:[12]

Pobitora Wildlife Sanctuary shelters the highest density of Indian rhinos in the world — with 84 individuals in 2009 in an area of 38.80 km2 (14.98 sq mi).[3]

The population of rhinos in Nepal increased by 99 individuals from 2008 to 2011 and in 2011 totaled 503. Of these, 145 were male, 183 female 183 and 175 of unidentified gender; 332 were adults, 111 calves and 60 of intermediate age.[13]

In Pakistan's Lal Suhanra National Park, two rhinos from Nepal were introduced in 1983 but have not bred so far.[2]

Ecology and behavior [edit]

Rhinos are mostly solitary creatures, with the exception of mothers and calves and breeding pairs, although they sometimes congregate at bathing areas. They have home ranges, the home ranges of males being usually 2 to 8 km2 (0.77 to 3.1 sq mi) large and overlapping each other. Dominant males tolerate males passing through their territory except when they are in mating season, when dangerous fights break out. They are active at night and early morning. They spend the middle of the day wallowing in lakes, rivers, ponds, and puddles to cool down. They are very good swimmers. Over 10 distinct vocalizations have been recorded.

Indian rhinos have few natural enemies, except for tigers who sometimes kill unguarded calves, but adult rhinos are less vulnerable due to their size. Mynahs and egrets both eat invertebrates from the rhino's skin and around its feet. Tabanus flies, a type of horse-fly are known to bite rhinos. The rhinos are also vulnerable to diseases spread by parasites such as leeches, ticks, and nematodes. Anthrax and the blood-disease septicemia are known to occur.[5]

They can run at speeds of up to 55 km/h (34 mph) for short periods of time and are excellent swimmers. They have excellent senses of hearing and smell but relatively poor eyesight.

Diet [edit]

Indian rhinoceros are grazers. Their diet consists almost entirely of grasses, but they also eat leaves, branches of shrubs and trees, fruits, and submerged and floating aquatic plants. They feed in the mornings and evenings. They use their prehensile lip to grasp grass stems, bend the stem down, bite off the top, and then eat the grass. They tackle very tall grasses or saplings by walking over the plant, with legs on both sides and using the weight of the body to push the end of the plant down to the level of the mouth. Mothers also use this technique to make food edible for their calves. They drink for a minute or two at a time, often imbibing water filled with rhinoceros urine.[5]

Social life [edit]

Two Indian rhinoceroses in Nepal. Their horns have been removed.

The Indian rhinoceros forms a variety of social groupings. Adult males are generally solitary, except for mating and fighting. Adult females are largely solitary when they are without calves. Mothers will stay close to their calves for up to four years after their birth, sometimes allowing an older calf to continue to accompany her once a newborn calf arrives. Subadult males and females form consistent groupings as well. Groups of two or three young males will often form on the edge of the home ranges of dominant males, presumably for protection in numbers. Young females are slightly less social than the males. Indian rhinos also form short-term groupings, particularly at forest wallows during the monsoon season and in grasslands during March and April. Groups of up to 10 rhinos may gather in wallows—typically a dominant male with females and calves, but no subadult males.[7]

The Indian rhinoceros makes a wide variety of vocalizations. At least ten distinct vocalizations have been identified: snorting, honking, bleating, roaring, squeak-panting, moo-grunting, shrieking, groaning, rumbling and humphing. In addition to noises, the rhino uses olfactory communication. Adult males urinate backwards, as far as 3–4 meters behind them, often in response to being disturbed by observers. Like all rhinos, the Indian rhinoceros often defecates near other large dung piles. The Indian rhino has pedal scent glands which are used to mark their presence at these rhino latrines. Males have been observed walking with their heads to the ground as if sniffing, presumably following the scent of females.[7]

In aggregations, Indian rhinos are often friendly. They will often greet each other by waving or bobbing their heads, mounting flanks, nuzzling noses, or licking. Rhinos will playfully spar, run around, and play with twigs in their mouth. Adult males are the primary instigators in fights. Fights between dominant males are the most common cause of rhino mortality and males are also very aggressive toward females during courtship. Males will chase females over long distances and even attack them face-to-face. Unlike African rhinos, the Indian rhino fights with its incisors, rather than its horns.[7]

Reproduction [edit]

In zoos, females may breed as young as four, but in the wild females are usually six before breeding begins. The higher age in the wild may reflect that females need to be large enough to avoid being killed by the aggressive males. The Indian rhinoceros has a very lengthy gestation period of around 15.7 months. The interval between births ranges from 34–51 months. In captivity, males may breed at five years. But in the wild, dominant males do the breeding and rhinos do not attain dominance until they are older and larger. In one five-year field study, only one rhino who achieved mating success was estimated to be younger than 15.[7]

In captivity, four are known to have lived over 40 years, the oldest living to be 47.[5]

Threats [edit]

Moghul emperor Babur on a rhino hunt, 16th century

Sport hunting became common in the late 1800s and early 1900s.[2] Indian rhinos were hunted relentlessly and persistently. Reports from the middle of the 19th century claim that some military officers in Assam individually shot more than 200 rhinos. By 1908, the population in Kaziranga had decreased to around 12 individuals.[5] In the early 1900s, the species had declined to near extinction.[2]

Poaching for rhinoceros horn became the single most important reason for the decline of the Indian rhino after conservation measures were put in place from the beginning of the 20th century, when legal hunting ended. From 1980 to 1993, 692 rhinos were poached in India. In India's Laokhowa Wildlife Sanctuary 41 rhinos were killed in 1983, virtually the entire population of the sanctuary.[14] By the mid-1990s, poaching had rendered the species extinct there.[8]

In 1950, Chitwan’s forest and grasslands extended over more than 2,600 km2 (1,000 sq mi) and were home to about 800 rhinos. When poor farmers from the mid-hills moved to the Chitwan Valley in search of arable land, the area was subsequently opened for settlement, and poaching of wildlife became rampant. The Chitwan population has repeatedly been jeopardized by poaching: in 2002 alone, poachers have killed 37 animals in order to saw off and sell their valuable horns.[15]

Six methods of killing rhinos have been recorded:[14]

  • Shooting is by far the most common method used; rhino horn traders hire sharpshooters and often supply them with rifles and ammunition.
  • Trapping in a pit depends largely on the terrain and availability of grass to cover it; pits are dug out in such a way that a fallen animal has little room to manoeuvre with its head slightly above the pit, so that it is easy to saw off the horn.
  • Electrocuting is used where high voltage powerlines pass through or near a protected area, to which poachers hook a long insulated rod connected to a wire, which is suspended above a rhino path.
  • Poisoning by smearing zinc phosphide rat poison or pesticides on salt licks frequently used by rhinos.
  • Spearing has only been recorded in Chitwan National Park.
  • With a noose, which cuts through the rhino's skin and kills it by strangulation.

Poaching, mainly for the use of the horn in Traditional Chinese Medicine has remained a constant and has led to decreases in several important populations. Apart from this, there have been serious declines in quality of habitat in some areas, due to

  • severe invasion by alien plants into grasslands affecting some populations;
  • demonstrated reductions in the extent of grasslands and wetland habitats due to woodland encroachment and silting up of beels;
  • grazing by domestic livestock.[2]

The species is inherently at risk because over 70% of its population occurs at a single site, Kaziranga National Park. Any catastrophic event such as disease, civil disorder, poaching, habitat loss would have a devastating impact on the Indian rhino's status. On the other hand, small population of rhinos may be prone to in-breeding depression.[2]

Conservation [edit]

Indian rhino at Pobitora Wildlife Sanctuary in India

Rhinoceros unicornis is listed in CITES Appendix I since 1975. The Indian and Nepalese governments have taken major steps towards Indian rhinoceros conservation, especially with the help of the World Wide Fund for Nature (WWF) and other non-governmental organizations.[2] In the early 1980s, a rhino translocation scheme was initiated. The first pair of rhinos was reintroduced from Nepal's Terai to Pakistan's Lal Suhanra National Park in Punjab in 1982.[9]

In India [edit]

In 1910, all rhino hunting in India became prohibited.[5] In 1984, five rhinos were relocated to Dudhwa National Park — four from the fields outside the Pabitora Wildlife Sanctuary and one from Goalpara.[9]

In Nepal [edit]

In 1957, the country's first conservation law insured the protection of rhinos and their habitat. In 1959, Edward Pritchard Gee undertook a survey of the Chitwan Valley, recommended creation of a protected area north of the Rapti River and of a wildlife sanctuary south of the river for a trial period of ten years.[16] After his subsequent survey of Chitwan in 1963, he recommended extension of the sanctuary to the south.[17] By the end of the 1960s, only 95 rhinos remained in the Chitwan Valley. The dramatic decline of the rhino population and the extent of poaching prompted the government to institute the Gaida Gasti – a rhino reconnaissance patrol of 130 armed men and a network of guard posts all over Chitwan. To prevent the extinction of rhinos the Chitwan National Park was gazetted in December 1970, with borders delineated the following year and established in 1973, initially encompassing an area of 544 km2 (210 sq mi). Since 1973, the population has recovered well and increased to 544 animals around the turn of the century. To ensure the survival of rhinos in case of epidemics animals are translocated annually from Chitwan to the Bardia National Park and the Sukla Phanta Wildlife Reserve since 1986.[15]

In captivity [edit]

Indian rhinos enjoy bathing at Zoo Basel
Rhino at Guwahati Zoo.

The Indian rhinoceros was initially difficult to breed in captivity. The first recorded captive birth of a rhinoceros was in Kathmandu in 1826, but another successful birth did not occur for nearly 100 years. In 1925, a rhino was born in Kolkata. No rhinoceros was successfully bred in Europe until 1956. On September 14, 1956 Rudra was born in Zoo Basel, Switzerland. In the second half of the 20th century, zoos became adept at breeding Indian rhinoceros. By 1983, nearly 40 babies had been born in captivity.[5] As of 2012, 33 Indian rhinos were born at Zoo Basel,[18] which means that most animals kept in a zoo are somehow related to the population in the zoo of Basel, Switzerland. Due to the success of Zoo Basel's breeding program, the International Studbook for the species has been kept there since 1972. Since 1990, the Indian rhino European Endangered Species Programme is being coordinated there as well, which ensures that the captive global Indian rhinoceros population stays genetically as healthy as possible.[19] As of 2010, 174 rhinos are kept in zoos worldwide.

In June 2009, an Indian rhino was artificially inseminated using sperm collected four years previously and cryo-preserved at the Cincinnati Zoo’s CryoBioBank before being thawed and utilized. She gave birth to a male calf in October 2010.[20] The calf died 12 hours after birth.

Taxonomy [edit]

The modern scientific designation Rhinoceros unicornis is adopted from the Greek: ρινό- ("rhino-" — nose) and -κερος ("-keros" — horn of an animal) and Latin: "uni-" meaning single and "-cornis" meaning horn.[21]

Rhinoceros unicornis was the type species for the rhinoceros family, first described by Carolus Linnaeus in 1758.[22]

The one-horned rhinoceros is monotypic. Several specimen were described since the end of the 18th century under different scientific names, which are all considered synonyms of Rhinoceros unicornis today:[23]

Evolution [edit]

Ancestral rhinoceroses first diverged from other Perissodactyls in the Early Eocene. Mitochondrial DNA comparison suggests that the ancestors of modern rhinos split from the ancestors of Equidae around 50 million years ago.[24] The extant family, the Rhinocerotidae, first appeared in the Late Eocene in Eurasia, and the ancestors of the extant rhino species dispersed from Asia beginning in the Miocene.[25]

Fossils of Rhinoceros unicornis appear in the Middle Pleistocene. In the Pleistocene, the genus Rhinoceros ranged throughout South and Southeast Asia, with specimens located on Sri Lanka. Into the Holocene, some rhinoceros lived as far west as Gujarat and Pakistan until as recently as 3,200 years ago.[5]

The Indian and Javan rhinoceros, the only members of the genus Rhinoceros, first appear in the fossil record in Asia around 1.6 million–3.3 million years ago. Molecular estimates, however, suggest the species may have diverged much earlier, around 11.7 million years ago.[24][26] Although belonging to the type genus, the Indian and Javan rhinoceros are not believed to be closely related to other rhino species. Different studies have hypothesized that they may be closely related to the extinct Gaindetherium or Punjabitherium. A detailed cladistic analysis of the Rhinocerotidae placed Rhinoceros and the extinct Punjabitherium in a clade with Dicerorhinus, the Sumatran rhinoceros. Other studies have suggested the Sumatran rhinoceros is more closely related to the two African species.[27] The Sumatran rhino may have diverged from the other Asian rhinos as long as 15 million years ago.[7][25]

In culture [edit]

Babur and his party hunting for rhinoceros in Swati, from Illuminated manuscript Baburnama
The Rhinoceros
ArtistAlbrecht Dürer
Year1515
Typewoodcut
Dimensions24.8 cm × 31.7 cm (9.8 in × 12.5 in)

The Indian rhinoceros was the first rhino widely known outside its range. The first rhinoceros to reach Europe in modern times arrived in Lisbon on May 20, 1515. King Manuel I of Portugal planned to send the rhinoceros to Pope Leo X, but the rhino perished in a shipwreck. Before dying, the rhino had been sketched by an unknown artist. The German artist Albrecht Dürer saw the sketches and descriptions and carved a woodcut of the rhino, known ever after as Dürer's Rhinoceros. Though the drawing had some anatomical inaccuracies (notably the hornlet protruding from the rhino's shoulder), his sketch became the enduring image of a rhinoceros in western culture for centuries.[citation needed]

The British public had their first chance to view a rhinoceros (presumably this species) in 1683; it unknowingly caused a political row when the notorious Judge Jeffreys, in one of his lighter moments, spread a rumour that his chief rival, Lord Guildford, had been seen riding on it.[citation needed]

Assam state of India has one-horned rhino as the official state animal. It is also the organizational logo for Assam Oil Company Ltd.[citation needed]

See also [edit]

References [edit]

  1. ^ a b Grubb, P. (2005). "Order Perissodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 636. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d e f g h Talukdar, B. K., Emslie, R., Bist, S. S., Choudhury, A., Ellis, S., Bonal, B. S., Malakar, M. C., Talukdar, B. N. Barua, M. (2008). "Rhinoceros unicornis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  3. ^ a b Sarma, P.K., Talukdar, B.K., Sarma, K., Barua, M. (2009) Assessment of habitat change and threats to the greater one-horned rhino (Rhinoceros unicornis) in Pabitora Wildlife Sanctuary, Assam, using multi-temporal satellite data. Pachyderm No. 46 July–December 2009: 18–24.
  4. ^ Macdonald, D. (2001). The New Encyclopedia of Mammals. Oxford University Press, Oxford. ISBN 0198508239. 
  5. ^ a b c d e f g h i j Laurie, W.A.; Lang, E. M., Groves, C.P. (1983). "Rhinoceros unicornis". Mammalian Species (American Society of Mammalogists) (211): 1–6. doi:10.2307/3504002. JSTOR 3504002. 
  6. ^ Boitani, L. (1984) Simon & Schuster's Guide to Mammals. Simon & Schuster, Touchstone Books. ISBN 978-0-671-42805-1
  7. ^ a b c d e f Dinerstein, E. (2003). The Return of the Unicorns: The Natural History and Conservation of the Greater One-Horned Rhinoceros. New York: Columbia University Press. ISBN 0-231-08450-1. 
  8. ^ a b Foose, T. and van Strien, N. (1997). Asian Rhinos – Status Survey and Conservation Action Plan. IUCN, Gland, Switzerland, and Cambridge, UK. ISBN 2-8317-0336-0. 
  9. ^ a b c d Choudhury, A. U. (1985) Distribution of Indian one-horned rhinoceros. Tiger Paper 12(2): 25–30
  10. ^ Jerdon, T. C. (1867) The Mammals of India: a Natural History of all the animals known to inhabit Continental India Roorkee : Thomason College Press
  11. ^ Sheikh, K. M., Molur, S. (2004) Status and Red List of Pakistan’s Mammals. Based on the Conservation Assessment and Management Plan. 312pp. IUCN Pakistan
  12. ^ Syangden, B.; Sectionov; Ellis, S.; Williams, A.C.; Strien, N.J. van; Talukdar, B.K. (2008) Report on the regional meeting for India and Nepal IUCN/SSC Asian Rhino Species Group (AsRSG); March 5–7, 2007 Kaziranga National Park, Assam, India. Kaziranga, Asian Rhino Specialist Group
  13. ^ Department of National Parks and Wildlife Conservation (2011) Rhino count in Nepal accomplished. Kathmandu, Nepal
  14. ^ a b Menon, V. (1996) Under siege: Poaching and protection of Greater One-horned Rhinoceroses in India. TRAFFIC India
  15. ^ a b Adhikari, T. R. (2002) The curse of success. Habitat Himalaya – A Resources Himalaya Factfile, Volume IX, Number 3
  16. ^ Gee, E. P. (1959). "Report on a survey of the rhinoceros area of Nepal". Oryx 5: 67–76. 
  17. ^ Gee, E. P. (1963). "Report on a brief survey of the wildlife resources of Nepal, including rhinoceros". Oryx 7 (2–3): 67–76. doi:10.1017/S0030605300002416. 
  18. ^ (German) Es ist ein Junge!. Zoo Basel, retrieved 2013-02-25
  19. ^ Zoo Basel (2010) Panzernashorngeburt im Zoo Basel. Zoo Basel Aktuell, 27 July 2010
  20. ^ Patton, F. (2011) The Artificial Way. Swara, (April–June 2011): 58–61.
  21. ^ Partridge, E. (1983). Origins: a Short Etymological Dictionary of Modern English. New York: Greenwich House. ISBN 0-517-41425-2.
  22. ^ Linnæus, C. (1758). Caroli Linnæi Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Salvius, Holmiae. Page 56.
  23. ^ Srinivasulu, C., Srinivasulu, B. (2012). Chapter 3: Checklist of South Asian Mammals in: South Asian Mammals: Their Diversity, Distribution, and Status. Springer, New York, Heidelberg, London.
  24. ^ a b Xu, Xiufeng; A. Janke, and U. Arnason (1996). "The Complete Mitochondrial DNA Sequence of the Greater Indian Rhinoceros, Rhinoceros unicornis, and the Phylogenetic Relationship Among Carnivora, Perissodactyla, and Artiodactyla (+ Cetacea)". Molecular Biology and Evolution 13 (9): 1167–1173. doi:10.1093/oxfordjournals.molbev.a025681. PMID 8896369. Retrieved 2007-11-04. 
  25. ^ a b Lacombat, F. The evolution of the rhinoceros.  In Fulconis 2005, pp. 46–49.
  26. ^ Tougard, C.; T. Delefosse, C. Hoenni, and C. Montgelard (2001). "Phylogenetic relationships of the five extant rhinoceros species (Rhinocerotidae, Perissodactyla) based on mitochondrial cytochrome b and 12s rRNA genes". Molecular Phylogenetics and Evolution 19 (1): 34–44. doi:10.1006/mpev.2000.0903. PMID 11286489. 
  27. ^ Cerdeño, E. (1995). "Cladistic Analysis of the Family Rhinocerotidae (Perissodactyla)". Novitates (American Museum of Natural History) (3143): 1–25. ISSN 0003-0082. 

Further reading [edit]

Martin, E. B. (2010). From the jungle to Kathmandu : horn and tusk trade. Kathmandu: Wildlife Watch Group. ISBN 978-99946-820-9-6. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!