Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius nomion

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGTACTGAATTAGGTAATCCTGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTCATGGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAACAATATAAGATTTTGATTATTACCCCCCTCATTAACTTTATTAATTTCCAGAAGTATCGTCGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCCCATGGAGGTAGCTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCAGTAGGAATTACCGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCAGGTGCTATTACAATACTTCTAACAGATCGAAATCTTAATACCTCATTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACNNNGAAGTTTATATTTTAATTTTACCTGGTTTCGGAATAATTTCTCATATTATTTCTCAAGAAAGTGGAAAAAAAGAAACTTTTGGATGTCCAGGAATCATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAGCTTATTTTACTTCTGCAACTATAATTATTGCTGTACCAACAGGTATTAAAATTTTTAGTTGATTAGCAACATTACATGGATCT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius nomion

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parnassius nomion

Parnassius nomion is a forest steppe butterfly which is found in the Urals, Altai, South Siberia, Amur and the Ussuri region, Mongolia, China and Korea.It is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family. Populations vary throughout its range and there are very many described subspecies. The adult flies from July to mid-August and the larvae feed on Sedum and Orostachys (Crassulaceae).

References

  • Sakai S., Inaoka S., Toshiaki A., Yamaguchi S., Watanabe Y., (2002) The Parnassiology. The Parnassius Butterflies, A Study in Evolution, Kodansha, Japan. ISBN 4-06-124051-X
  • Guide to the Butterflies of Russia and adjacent territories Volume 1. Pensoft, Sofia - Moscow. 1997
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!