Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Comprehensive Description

Description

 Nephrops norvegicus is a small lobster, pale orange in colour. It grows to a maximum total length of 25 cm (including the tail and clawed legs), although individuals are normally between 18-20 cm. The head and thorax have a non-segmented cover (the carapace) while the long abdomen is clearly segmented with a broad fan-like tail. The first 3 pairs of legs bear claws. The first pair of legs are very elongated with longitudinal, spiny ridges. There are 2 pairs of antennae, the second pair much longer and thinner than the first. The eyes are large, black, and moveable.Also known as the Dublin Bay prawn, scampi and langoustine.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This is a widely distributed species ranging from Iceland, the Faroes and Norway in the north of its range, to the Atlantic coast of Morocco in the south including the west and central region of the Mediterranean. It is however absent from the eastern Mediterranean, the Baltic Sea, the Bosphorus and the Black Sea (Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species spends much of its time inside burrows constructed in muddy substrates. Emergence behaviour varies with depth and is related to light levels and other external factors. Adults are opportunistic predators and scavengers feeding on a range of benthic invertebrates. Reproductive frequency depends on latitude, varying from annual cycles in the southern part of the range to biennial cycles in the northern part. Spawning occurs in late summer or early autumn and ovigerous females remain in their burrows until the eggs hatch in late winter or early spring. Larvae are planktonic and settle in muddy substrates after 3-7 weeks (M. Bell pers. comm. 2010). Although specimens can reach up to 24 cm in length, this species is normally found between 10-20 cm in size (Holthuis 1991). Age at first maturity is thought to be around 2-3 years (Froglia and Gramitto 1981, Orsi Relini et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14653 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8306 samples.

Environmental ranges
  Depth range (m): -9 - 600
  Temperature range (°C): 6.589 - 17.280
  Nitrate (umol/L): 0.972 - 16.868
  Salinity (PPS): 31.839 - 38.793
  Oxygen (ml/l): 4.163 - 6.609
  Phosphate (umol/l): 0.113 - 0.890
  Silicate (umol/l): 1.843 - 11.419

Graphical representation

Depth range (m): -9 - 600

Temperature range (°C): 6.589 - 17.280

Nitrate (umol/L): 0.972 - 16.868

Salinity (PPS): 31.839 - 38.793

Oxygen (ml/l): 4.163 - 6.609

Phosphate (umol/l): 0.113 - 0.890

Silicate (umol/l): 1.843 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found sublittorally in soft sediment, commonly at depths of between 200-800 m, although considerable populations exist at depths <200 m, for example the Clyde Sea. There are many records of Nephrops norvegicus populations <20 m in Scottish Sea Lochs. They live in shallow burrows and are common on grounds with fine cohesive mud which is stable enough to support their unlined burrows.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Nephrops norvegicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nephrops norvegicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTATATTTTATCTTCGGGGCTTGAGCAGGCATAGTAGGGACTTCATTAAGATTGGTAATTCGTGCTGAGTTAGGTCAACCAGGAAGCCTTATTGGCGATGACCAAATTTACAATGTAGTAGTGACAGCTCATGCTTTTGTTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGGTTAGTTCCATTAATATTAGGTGCTCCTGATATAGCGTTTCCTCGAATAAATAATATAAGGTTTTGGCTCCTTCCTTTCTCATTAACATTATTATTGACAAGTGGAATAGTAGAAAGTGGAGTAGGAACAGGGTGAACTGTTTACCCACCTCTTTCTGCTGCTATTGCTCACGCCGGTGCTTCTGTTGACTTAGGAATTTTTTCGCTTCATTTAGCTGGTGTTTCATCTATTTTAGGTGCAGTAAATTTTATAACAACTGCTATTAATATACGAAGAAAAGGAATAACAATAGACCGTATACCATTATTTGTATGATCAGTGTTTATTACAGCAGTACTTTTATTACTTTCGCTTCCCGTTTTAGCAGGAGCAATTACTATACTATTAACAGATCGAAATTTAAATACTTCGTTTTTTGACCCAGCAGGAGGAGGAGACCCAGTACTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Bell, C

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification
Nephrops norvegicus has been assessed as Least Concern. This is a widespread species that is found in commercial quantities throughout its range. It is commercially harvested as a food source throughout its range and while stocks are in decline in some parts of its range, stocks appear to be stable in the northern fisheries which constitute the greater proportion of the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is found in commercial quantities throughout much of its range. Landings of this species have steadily increased since the 1950s from around 10,000 tonnes, to around 50-70,000 tonnes in the 2000s (FAO 2010).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The greatest threat to this species is the commercial scale harvest for human food across its range. The largest fishing grounds for this species occur in the North Sea, the West of Scotland and the Irish Sea. It is also taken in the Bay of Biscay, the Iberian coast, Moroccan coast, Western and Eastern Mediterranean, and the Adriatic but in much smaller quantities (Bell, Redant and Tuck 2006).

Levels of fishery exploitation vary widely between individual stocks (Bell, Redant and Tuck 2006). ICES assessments indicate that many of the stocks with a long history of exploitation in the North Sea, to the west of Scotland and in the Irish and Celtic Seas, are fully exploited in terms of yield per recruit, but stock levels are relatively stable and with no evidence of recruitment declines (ICES 2003, 2004). New fisheries have developed over recent years on some large offshore stocks in the North Sea (notably the Fladen Ground and Norwegian Deeps) and there appears to be scope for further increases in fishing pressure on these grounds. In contrast. there have been declines in stock abundance in some southern areas, including the Bay of Biscay and, particularly, Atlantic shelf edge grounds around the Iberian peninsula, but it is not clear that recruitment declines have resulted from overexploitation (M. Bell pers. comm. 2010).

Trawling is the primary method of fishing. Vulnerability to trawling is strongly related to burrow emergence behaviour, and in areas where much of the fishing occurs in winter (e.g. the Farn Deeps grounds) there is a lower fishing mortality of females owing to the non-emergence of ovigerous individuals. Small creel fisheries also occur, notably in sea lochs in the west of Scotland. This is considered a more sustainable method of fishing than trawling, although there are concerns that larger numbers of ovigerous females are taken in creels (M. Bell pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are a number of species-specific conservation measures in place to regulate the fishery of this species. Management strategies include: minimum legal sizes for harvest; restrictions on fishing gear type type and mesh size; total allowable catch limits (TAC) (Bell, Redant and Tuck 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nephrops norvegicus

Nephrops norvegicus, known variously as the Norway lobster, Dublin Bay prawn, langoustine (compare langostino) or scampi, is a slim, orange-pink lobster which grows up to 25 cm (10 in) long, and is "the most important commercial crustacean in Europe".[3] It is now the only extant species in the genus Nephrops, after several other species were moved to the closely related genus Metanephrops. It lives in the north-eastern Atlantic Ocean, and parts of the Mediterranean Sea, but is absent from the Baltic Sea and Black Sea. Adults emerge from their burrows at night to feed on worms and fish.

Description[edit]

Nephrops norvegicus has the typical body shape of a lobster, albeit narrower than the large Homarus species.[3] It is pale orange in colour, and grows to a typical length of 18–20 centimetres (7–8 in), or exceptionally 25 cm (10 in) long, including the tail and claws.[4] A carapace covers the animal's cephalothorax, while the abdomen is long and segmented, ending in a broad tail fan.[4] The first three pairs of legs bear claws, of which the first are greatly elongated and bear ridges of spines.[4] Of the two pairs of antennae, the second is the longer and thinner.[4] There is a long, spinous rostrum, and the compound eyes are kidney-shaped, providing the name of the genus, from the Greek roots νεφρός (nephros, "kidney") and ops ("eye").[3]

Distribution[edit]

Nephrops norvegicus is found in the north-eastern Atlantic Ocean and North Sea as far north as Iceland and northern Norway, and south to Portugal. It is not common in the Mediterranean Sea except in the Adriatic Sea,[5] notably the north Adriatic.[6] It is absent from both the Black Sea and the Baltic Sea.[3] Due to its ecological demands for particular sediments, N. norvegicus has a very patchy distribution, and is divided into over 30 populations. These populations are separated by inhospitable terrain, and adults rarely travel distances greater than a few hundred metres.[3]

Ecology[edit]

A Norway lobster in its burrow, at the Oceanographic Museum in Monaco

Nephrops norvegicus adults prefer to inhabit muddy seabed sediments, with more than 40 percent silt and clay.[3] Their burrows are semi-permanent,[7] and vary in structure and size. Typical burrows are 20 to 30 centimetres (8 to 12 in) deep, with a distance of 50 to 80 centimetres (20 to 31 in) between the front and back entrances.[3] Norway lobsters spend most of their time either lying in their burrows or by the entrance, only leaving their shelters to forage or mate.[3]

Diet[edit]

Nephrops norvegicus is a scavenger and predator[8] that makes short foraging excursions,[9][10] mainly during periods of subdued light. They feed on active prey, including worms and fish,[11] which they capture with their chelipeds and walking legs, and food is conveyed to the mouth using the anterior walking legs, assisted by the maxillipeds.[3]

Parasites and symbionts[edit]

Nephrops norvegicus is the host to a number of parasites and symbionts. A number of sessile organisms attach to the exoskeleton of N. norvegicus, including the barnacle Balanus crenatus and the foraminiferan Cyclogyra, but overall Nephrops suffers fewer infestations of such epibionts than other decapod crustaceans do.[12] In December 1995, the commensal Symbion pandora was discovered attached to the mouthparts of Nephrops norvegicus, and was found to be the first member of a new phylum, Cycliophora,[13] a finding described by Simon Conway Morris as "the zoological highlight of the decade".[14] S. pandora has been found in many populations of N. norvegicus, both in the north Atlantic and in the Mediterranean Sea.[15] Individuals may be found on most segments of the lobster's mouthparts, but are generally concentrated on the central parts of the larger mouthparts, from the mandible to the third maxilliped.[16]

The most significant parasite of N. norvegicus is a dinoflagellate of the genus Hematodinium, which has caused epidemic infection in fished populations of N. norvegicus since the 1980s.[12] Hematodinium is a genus that contains major pathogens of a wide variety of decapod crustaceans, although its internal taxonomy is poorly resolved.[12] The species which attacks N. norvegicus causes a syndrome originally described as "post-moult syndrome", in which the carapace turns opaque and becomes highly pigmented, the haemolymph becomes milky white, and the animal appears moribund.[12] Other parasites of N. norvegicus include the gregarine protozoan Porospora nephropis, the trematode Stichocotyle nephropis and the polychaete Histriobdella homari.[12]

Life cycle[edit]

Adult female N. norvegicus with eggs

The typical life span of N. norvegicus is 5–10 years,[17] reaching 15 years in exceptional cases.[18] Its reproductive cycle varies depending on geographical position: "the periods of hatching and spawning, and the length of the incubation period, vary with latitude and the breeding cycle changes from annual to biennial as one moves from south to north".[3] Incubation of eggs is temperature-dependent, and in colder climates, the duration of the incubation period increases. This means that, by the time hatching occurs, it may be too late for the females to take part in that year's breeding cycle. In warmer climates, the combined effects of recovery from moulting and ovary maturation mean that spawning can become delayed. This, in turn, has the effect of the female missing out a year of egg carrying.[19]

Adult male Nephrops norvegicus moult once or twice a year (usually in late winter or spring) and adult females moult up to once a year (in late winter or spring, after hatching of the eggs).[3] In annual breeding cycles, mating takes place in the spring or winter, when the females are in the soft, post-moult state.[20] The ovaries mature throughout the spring and summer months, and egg-laying takes place in late summer or early autumn. After spawning, the berried (egg-carrying) females return to their burrows and remain there until the end of the incubation period. Hatching takes place in late winter or early spring. Soon after hatching, the females moult and mate again.[3]

Fisheries[edit]

Freshly caught Nephrops norvegicus in Scotland

The muscular tail of Nephrops norvegicus is frequently eaten, and its meat is known as scampi. N. norvegicus is eaten only on special occasions in Spain and Portugal, where it is less expensive than the common lobster, Homarus gammarus.[21] N. norvegicus is an important species for fisheries, being caught mostly by trawling. Around 60,000 tonnes are caught annually, half of it in the United Kingdom's waters.[22]

Discards from Nephrops fishery may account for up to 37% of the energy requirements of certain marine scavengers, such as the hagfish Myxine glutinosa.[23] Boats involved in Nephrops fishery also catch a number of fish species such as plaice and sole, and it is thought that without that revenue, Nephrops fishery would be economically unviable.[24]

Taxonomic history[edit]

Nephrops norvegicus was one of the species included by Carl Linnaeus in his 1758 10th edition of Systema Naturae, the starting point for zoological nomenclature. In that work, it was listed as Cancer Norvegicus, with a type locality of in Mari Norvegico ("in the Norwegian sea").[25] In choosing a lectotype, Lipke Holthuis restricted the type locality to the Kattegat at the Kullen Peninsula in southern Sweden (56°18′N 12°28′E / 56.300°N 12.467°E / 56.300; 12.467).[2] Two synonyms of the species have been published[2] – "Astacus rugosus", described by the eccentric zoologist Constantine Samuel Rafinesque in 1814 from material collected in the Mediterranean Sea,[26] and "Nephropsis cornubiensis", described by Charles Spence Bate and Joshua Brooking Rowe in 1880.[27]

As new genera were erected, the species was moved, reaching its current position in 1814, when William Elford Leach erected the genus Nephrops to hold this species alone.[2][28] Seven fossil species have since been described in the genus.[29]

Populations in the Mediterranean Sea are sometimes separated as "Nephrops norvegicus var. meridionalis Zariquiey, 1935", although this taxon is not universally considered valid.[3]

References[edit]

  1. ^ C. Bell (2011). "Nephrops norvegicus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved January 1, 2012. 
  2. ^ a b c d Lipke B. Holthuis (1991). "Nephrops norvegicus". FAO Species Catalogue, Volume 13. Marine Lobsters of the World. FAO Fisheries Synopsis No. 125. Food and Agriculture Organization. ISBN 92-5-103027-8. 
  3. ^ a b c d e f g h i j k l m Mike C. Bell, Frank Redant & Ian Tuck (2006). "Nephrops Species". In Bruce F. Phillips. Lobsters: Biology, Management, Aquaculture and Fisheries. Wiley-Blackwell. pp. 412–461. doi:10.1002/9780470995969.ch13. ISBN 978-1-4051-2657-1. 
  4. ^ a b c d "Norway lobster - Nephrops norvegicus". Biodiversity and Conservation. Marine Life Information Network. Retrieved December 1, 2010. 
  5. ^ Alan Davidson (2002). Mediterranean Seafood. Ten Speed Press. ISBN 978-1-58008-451-2. 
  6. ^ "Nephrops norvegicus (Linnaeus, 1758)". AdriaMed. Food and Agriculture Organization. 
  7. ^ B. I. Dybern & T. Hoisaeter (1965). "The burrows of Nephrops norvegicus". Sarsia 21: 49–55. 
  8. ^ H. J. Thomas & C. Davidson (1962). "The food of the Norway lobster Nephrops norvegicus". Marine Research 3: 1–15. 
  9. ^ C. J. Chapman & A. L. Rice (1971). "Some direct observations on the ecology and behaviour of the Norway Lobster Nephrops norvegicus using different methods". Marine Biology 10 (4): 321–329. doi:10.1007/BF00368092. 
  10. ^ C. J. Chapman, A. D. F. Johnstone & A. L. Rice (1975). H. Barnes, ed. "The behaviour and ecology of the Norway lobster, Nephrops norvegicus". Proceedings of the 9th European Marine Biological Symposium. Aberdeen University Press. pp. 59–74. 
  11. ^ J. C. Early. "Processing Norway lobsters". Food and Agriculture Organization. Retrieved March 18, 2007. 
  12. ^ a b c d e Grant D. Stentiford & Douglas M. Neil (2011). Diseases of Nephrops and Metanephrops: a review. In Grant Stentiford. "Diseases of Edible Crustaceans". Journal of Invertebrate Pathology 106 (1): 92–109. doi:10.1016/j.jip.2010.09.017. PMID 21215358. 
  13. ^ Peter Funch & Reinhardt Kristensen (1995). "Cycliophora is a new phylum with affinities to Entoprocta and Ectoprocta". Nature 378 (6558): 711–714. Bibcode:1995Natur.378..711F. doi:10.1038/378711a0. 
  14. ^ Robert Bradley Jackson (2002). "The richness of life". The Earth Remains Forever: Generations at a Crossroads. University of Texas Press. pp. 15–62. ISBN 978-0-292-74055-6. 
  15. ^ Matteo Dal Zotto & M. Antonio Todaro (2008). Cycliophora (PDF). In G. Relini. "La checklist della flora e della fauna dei mari italiani". Biologia Marina Mediterranea 15 (Suppl. 1): 178–181. 
  16. ^ Matthias Obst & Peter Funch (2006). "The microhabitat of Symbion pandora (Cycliophora) on the mouthparts of its host Nephrops norvegicus (Decapoda: Nephropidae)". Marine Biology 148 (5): 945–951. doi:10.1007/s00227-005-0131-1. 
  17. ^ Marisa Sabatini & Jacqueline Hill (2008). "Norway lobster - Nephrops norvegicus". Marine Life Information Network. Marine Biological Association of the United Kingdom. Retrieved February 14, 2011. 
  18. ^ "Lobster research at IMR". Norwegian Institute of Marine Research. Retrieved February 14, 2011. 
  19. ^ N. Bailey (1984). Some Aspects of Reproduction in Nephrops. Shellfish Committee Document CM 1984/K:33. International Council for the Exploration of the Sea. p. 16. 
  20. ^ A. S. D. Farmer (1975). Synopsis of data on the Norway lobster Nephrops norvegicus. FAO Fisheries Synopsis No. 112. Food and Agriculture Organization. pp. 1–97. 
  21. ^ Diego Pazos (September 15, 1995). "Spain Annual Seafood Report". American Embassy, Madrid. 
  22. ^ "Nephrops norvegicus". FAO: Fisheries Global Information System (FIGIS). February 26, 2004. 
  23. ^ T. L. Catchpole, C. L. J. Frid & T. S. Gray (2006). "Importance of discards from the English Nephrops norvegicus fishery in the North Sea to marine scavengers". Marine Ecology Progress Series 313: 215–226. doi:10.3354/meps313215. 
  24. ^ Ivor Clucas (1997). "A study of the options for utilization of bycatch and discards from marine capture fisheries: 9.1.2 Nephrops". FAO Fisheries Circular. No. 928: FIIU/C928. 
  25. ^ Carl Linnaeus (1758). "Cancer". Systema Naturae (10th ed.). Stockholm: Laurentius Salvius. pp. 625–634. 
  26. ^ L. B. Holthuis (1954). "С. S. Rafinesque as a carcinologist: an annotated compilation of the information on Crustacea contained in the works of that author". Zoologische Mededelingen 25 (1): 1–43. 
  27. ^ Charles Spence Bate & Joshua Brooking Rowe (1880). "Second Report of the Committee, consisting of Mr. C. Spence Bate and Mr. J. Brooking Kowe, appointed for the purpose of exploring the Marine Zoology of South Devon". Report of the Fiftieth Meeting of the British Association for the Advancement of Science. London: John Murray. pp. 160–161. 
  28. ^ William Elford Leach (1830). "Crustaceology". In David Brewster. The Edinburgh Encyclopaedia 7. pp. 383–437. 
  29. ^ Sammy De Grave, N. Dean Pentcheff, Shane T. Ahyong et al. (2009). "A classification of living and fossil genera of decapod crustaceans". Raffles Bulletin of Zoology. Suppl. 21: 1–109. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!