Overview

Distribution

Brazil, France, Gulf of Mexico, Italy, Japan, Mexico, Netherlands, Portugal, Venezuela
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrobrachium carcinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAGGAGCCCCAGACATGGCCTTCCCGCGAATAAATAATATAAGATTCTGGCTCTTACCTCCCTCTCTAACTCTCCTACTATCTAGAGGAATAGTGGAAAGAGGGGTAGGGACAGGATGAACTGTATACCCCCCTCTAGCAGCAGGAACTGCTCACGCGGGAGCCTCAGTAGACCTTGGA---ATCTTTTCCCTTCACCTTGCCGGTGTCTCATCTATCCTGGGTGCCGTCAATTTCATCACCACTGTAATTAACATGCGATCACCAGGAATAACCATAGACCGGCTACCCCTATTCGTCTGAGCTGTCTTCTTAACAGCAATTCTACTTCTTCTATCCCTGCCCGTCTTAGCGGGA---GCCATCACCATATTATTAACCGACCGAAACCTAAATACCTCTTTCTTCGACCCAGCAGGAGGAGGCGACCCCATTCTGTATCAACATTTATTCTGATTCTTTGGGCACCCAGAAGTCTATATTCTCATCCTACCCGCTTTCGGTATAATCTCCCACATTGTAAGACAAGAATCAGGTAAAAAA---GAATCTTTGGGAACCCTAGGAATAGTCTATGCTATAATAGCAATCGGATTCCTAGGATTCGTCGTATGAGCCCACCACATGTTCACAGTAGGGATAGACGTAGACACACGAGCATACTTTACATCAGCCACAATAATTATTGCCGTCCCTACGGGAATCAAAATTTTCAGATGACTA---GCAACCTTACATGGCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macrobrachium carcinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Macrobrachium carcinus

Macrobrachium carcinus is a species of freshwater shrimp native to the Americas.[2] It is the largest known species of Neotropical freshwater prawn, growing up to 30 centimetres (12 in) long and weighing as much as 850 grams (30 oz), [3] although even larger specimens have been reported.[4] It is an important species for commercial fishing in the Sao Francisco area, where it is known by the local name of pitu.[5] M. carcinus is omnivorous, with a diet consisting of molluscs, small fish, algae, leaf litter and insects.[6]

M. carcinus has a tan or yellow body with dark brown stripes. Its chelae are unusually long and thin, to facilitate foraging for food in small crevices,[6] and may be blue or green in colour.[7]

References [edit]

  1. ^ a b Charles Fransen (2012). "Macrobrachium carcinus (Linnaeus, 1758)". World Register of Marine Species. Retrieved 1 June 2012. 
  2. ^ "Macrobrachium carcinus Bigclaw River Shrimp". Encyclopedia of Life. Retrieved 1 June 2012. 
  3. ^ Methil Narayanan Kutty & Wagner C. Valenti (2009). "Culture of other freshwater prawn species". In Michael Bernard New, Wagner Cotroni Valenti & James H. Tidwell, Louis R. D'Abramo & Methil Narayanan Kutty. Freshwater Prawns: Biology and Farming. John Wiley & Sons. pp. 502–523. ISBN 978-1-4051-4861-0. 
  4. ^ Field & Stream. June 1998. p. 78. ISSN 87558599. Retrieved 1 June 2012. 
  5. ^ Joachim Carolsfeld (1 November 2003). Migratory Fishes of South America: Biology, Fisheries and Conservation Status. IDRC. p. 218. ISBN 978-0-9683958-2-0. Retrieved 1 June 2012. 
  6. ^ a b Douglas P. Reagan (1 September 1996). The Food Web of a Tropical Rain Forest. University of Chicago Press. p. 452. ISBN 978-0-226-70599-6. Retrieved 1 June 2012. 
  7. ^ Jerry G. Walls (1 April 2009). Crawfishes of Louisiana. LSU Press. p. 220. ISBN 978-0-8071-3409-2. Retrieved 1 June 2012. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!