Overview

Distribution

Range Description

The species is widely distributed, from Florida southwards to southern Brazil, including many of the Caribbean islands (Holthuis 1980).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species lives in streams, rivers and creeks from close to the sea up to considerable altitude.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrobrachium carcinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAGGAGCCCCAGACATGGCCTTCCCGCGAATAAATAATATAAGATTCTGGCTCTTACCTCCCTCTCTAACTCTCCTACTATCTAGAGGAATAGTGGAAAGAGGGGTAGGGACAGGATGAACTGTATACCCCCCTCTAGCAGCAGGAACTGCTCACGCGGGAGCCTCAGTAGACCTTGGA---ATCTTTTCCCTTCACCTTGCCGGTGTCTCATCTATCCTGGGTGCCGTCAATTTCATCACCACTGTAATTAACATGCGATCACCAGGAATAACCATAGACCGGCTACCCCTATTCGTCTGAGCTGTCTTCTTAACAGCAATTCTACTTCTTCTATCCCTGCCCGTCTTAGCGGGA---GCCATCACCATATTATTAACCGACCGAAACCTAAATACCTCTTTCTTCGACCCAGCAGGAGGAGGCGACCCCATTCTGTATCAACATTTATTCTGATTCTTTGGGCACCCAGAAGTCTATATTCTCATCCTACCCGCTTTCGGTATAATCTCCCACATTGTAAGACAAGAATCAGGTAAAAAA---GAATCTTTGGGAACCCTAGGAATAGTCTATGCTATAATAGCAATCGGATTCCTAGGATTCGTCGTATGAGCCCACCACATGTTCACAGTAGGGATAGACGTAGACACACGAGCATACTTTACATCAGCCACAATAATTATTGCCGTCCCTACGGGAATCAAAATTTTCAGATGACTA---GCAACCTTACATGGCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Macrobrachium carcinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
De Grave, S.

Reviewer/s
Cumberlidge, N. & Smith, K.

Contributor/s

Justification
The species is widely distributed from Florida southwards to southern Brazil, including many of the Caribbean islands, often occurring in high abundances. In view of this wide distribution and in the absence of any known, widespread threats the species is considered to be of Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information is available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No widespread threats to the species could be identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation actions are in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Macrobrachium carcinus

Macrobrachium carcinus is a species of freshwater shrimp native to the Americas.[2] It is the largest known species of Neotropical freshwater prawn, growing up to 30 centimetres (12 in) long and weighing as much as 850 grams (30 oz), [3] although even larger specimens have been reported.[4] It is an important species for commercial fishing in the Sao Francisco area, where it is known by the local name of pitu.[5] M. carcinus is omnivorous, with a diet consisting of molluscs, small fish, algae, leaf litter and insects.[6]

M. carcinus has a tan or yellow body with dark brown stripes. Its chelae are unusually long and thin, to facilitate foraging for food in small crevices,[6] and may be blue or green in colour.[7]

References[edit]

  1. ^ a b Charles Fransen (2012). "Macrobrachium carcinus (Linnaeus, 1758)". World Register of Marine Species. Retrieved 1 June 2012. 
  2. ^ "Macrobrachium carcinus Bigclaw River Shrimp". Encyclopedia of Life. Retrieved 1 June 2012. 
  3. ^ Methil Narayanan Kutty & Wagner C. Valenti (2009). "Culture of other freshwater prawn species". In Michael Bernard New, Wagner Cotroni Valenti & James H. Tidwell, Louis R. D'Abramo & Methil Narayanan Kutty. Freshwater Prawns: Biology and Farming. John Wiley & Sons. pp. 502–523. ISBN 978-1-4051-4861-0. 
  4. ^ Field & Stream. June 1998. p. 78. ISSN 8755-8599. Retrieved 1 June 2012. 
  5. ^ Joachim Carolsfeld (1 November 2003). Migratory Fishes of South America: Biology, Fisheries and Conservation Status. IDRC. p. 218. ISBN 978-0-9683958-2-0. Retrieved 1 June 2012. 
  6. ^ a b Douglas P. Reagan (1 September 1996). The Food Web of a Tropical Rain Forest. University of Chicago Press. p. 452. ISBN 978-0-226-70599-6. Retrieved 1 June 2012. 
  7. ^ Jerry G. Walls (1 April 2009). Crawfishes of Louisiana. LSU Press. p. 220. ISBN 978-0-8071-3409-2. Retrieved 1 June 2012. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!