Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Biology

The shore crab feeds on invertebrates including worms, molluscs and crustaceans Small molluscs and barnacles are taken by young crabs (2). Breeding peaks in summer, and mating can only take place shortly after the female moults; the male finds a female before she is due to moult, and carries her around underneath his body for a number of days (2). After the moult, copulation occurs. The female creates a cavity by burrowing in the sand; she lays the eggs whilst positioned over this cavity, attaches them to her walking legs and carries them around for several months (2). After hatching, the larvae are planktonic for 2-3 years. They then settle as young crabs, and reach maturity after around a year (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Shore crabs, also known as green crabs, are very common along the Dutch coast. They are native to the North Sea, but have managed to spread throughout the world. Due to the invasion of European shore crabs in American waters, this species is listed as the 18th of the 100 most damaging intruders in the world. You don't have to search for long to find one if you're by the sea. Birds don't have to wait long either; during low tide, lots of crabs are eaten. The crab itself thinks it can handle its enemies and will courageously try to pinch your fingers or toes should you encounter one. Shore crabs are the 'garbage collectors of the sea'; they eat whatever is dead or sick. On the tidal flats, they eat all sorts of benthic animals, although their favorite food are mussels.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The shore crab is one of the commonest crabs on the shore, and anyone who has gone rock-pooling is likely to have encountered one (3). It is usually dark green in colour, although young individuals may have whitish blotches. The carapace is wider than it is long, and the first pair of walking limbs ('pereopods') have pincers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The shore crab has a shell (carapace) that is much broader than long (up to 8 cm across). The front of the carapace is serrated with five teeth on either side and three rounded lobes between the eyes. The first pair of legs (pereopods) have well developed pincers (chelae). Its colour is highly variable from dark green to orange and red. Variation in colour may be due to the stage of the life cycle or the habitat. Juveniles in particular display a wide range of mottled patterns.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic, Australia, Azores, Belgian Coast, Belgian Exclusive Economic Zone, Bray-Dunes, Bredene, British Isles, Canada, De Haan, De Panne, Dutch Exclusive Economic Zone, East Atlantic, East Pacific, English Channel, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, Grevelingen, Gulf of Maine, Hout Bay, Icelandic Exclusive Economic Zone, Indo-Pacific, Irish Exclusive economic Zone, Lombardsijde, Madagascar, Mauritania, Mediterranean Sea, Middelkerke, Moroccan Exclusive Economic Zone, North Coast of Norway, North East Atlantic, North Sea, North West Atlantic, Norwegian Exclusive Economic Zone, Oostduinkerke, Oostende, Oosterschelde, Red Sea, Saldanha Bay, Sas van Goes, Schelde estuary, South Africa (country), Spuikom, Swedish Exclusive Economic Zone, Table Bay, United Kingdom, United Kingdom Exclusive Economic Zone, USA, Voordelta, Wadden Sea, West Africa, West Atlantic, West Coast of Norway , West Coast of South Africa, Westerschelde, Wimereux, Zeebrugge, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The green crab is native to the Atlantic Ocean off of the coast of Europe. Around the early eighteen hundreds the green crab was first seen on the Atlantic coast of North America. The crab can now be found from ranging from as far north as Nova Scotia and to the southern state of Virginia. In the late eighties, the crab mysteriously showed up in the San Francisco Bay area, and has since been spotted as far north as Oregon. This crab has also been found in such areas as far reaching as the continent of Australia.(Deegan, et al 1999, Holden 1997)

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nova Scotia to Virginia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found around the coasts of Britain and Ireland (4). It is also common around the coasts of north-west Europe (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The name, green crab, can be deceiving. The color of this crab depends on the molting cycle the crab is undergoing. These colors can range from green to orange and even red in some cases. Green crabs are also visibly identifiable by the yellowish spots on the abdomen, which are also accompanied by five small spines also located on the front edge of the shell. The adult green crab only grows to about three inches in width and two inches in length. (Washington Dept 1997, Jaquette 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The green crab resides among tidal marshes, sandflats, and coasts with a rocky terrain. They tend to stay around these areas for protection from predators, and to be close to a readily available food supply.(Holden 1997, Deegan, et al 1999)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Primarily intertidal and shallow subtidal areas, 0-60 m depth, rarely to 200 m, common under rocks and algae, tide pools, marshes and seagrass beds, found in low to full salinity areas.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1752 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): -3 - 113
  Temperature range (°C): 8.938 - 12.348
  Nitrate (umol/L): 2.283 - 16.868
  Salinity (PPS): 22.343 - 35.363
  Oxygen (ml/l): 6.069 - 7.118
  Phosphate (umol/l): 0.312 - 0.890
  Silicate (umol/l): 2.147 - 11.419

Graphical representation

Depth range (m): -3 - 113

Temperature range (°C): 8.938 - 12.348

Nitrate (umol/L): 2.283 - 16.868

Salinity (PPS): 22.343 - 35.363

Oxygen (ml/l): 6.069 - 7.118

Phosphate (umol/l): 0.312 - 0.890

Silicate (umol/l): 2.147 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Carcinus maenas is found on all types of shore, from high water to depths of 60 m in the sublittoral, but it is predominantly a shore and shallow water species. It tolerates a wide range of salinities and is especially abundant in estuaries and salt marshes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found on the shore from the high water mark down to depths of around 60 m (4), and can inhabit estuaries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The green crab enjoys a variety of different foods. These foods include clams, oysters, mussels, and other small crabs. The green crab is very dexterous and has many ways in which to open up the shellfish on which it feeds. The green crab is known as a very vicious carnivore that will consume anything it can get its claws on.(Holden 1997, Washington Dept. 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Portunion meanadis endoparasitises visceral cavity of Carcinus maenas

Animal / parasite / endoparasite
adult of Sacculina carcini endoparasitises body of Carcinus maenas

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Carcinus maenas is prey of:
Conger conger
Trigla lucerna
Dicentrarchus labrax
Ciliata mustella

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Carcinus maenas preys on:
detritus
Mytilus galloprovincialis

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The mating process of the green crab begins with the seeking out of a recently molted female crab by a male green crab. The female lays eggs which she carries in a pouch underneath her abdomen where the male crab fertilizes them. The female green crab can lay as many as a hundred thousand eggs at one time. Following fertilization, the females then travel to deeper water to more stable water conditions where the eggs begin to develop. Once the eggs have developed into a larvae,or the zoea stage, the larvae then return to the surface waters for about two weeks. Once the larvae have entered the final stage of development or the megalopae stage, the young crabs travel to the coastal waters where they begin a molting cycle and life as a juvenile crab. In approximately three years the juvenile crab will become a fully developed crab and be able to mate and reproduce.(Bamber and Naylor 1997, Washington Dept. 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcinus maenas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 102 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACACTATATTTTATCTTTGGGGCTTGAGCTGGCATAGTAGGGACTTCTTTGAGTCTTATTATTCGAGCTGAATTAGGGCAGCCAGGAACTTTAATCGGTAACGACCAAATTTATAACGTTGTTGTAACTGCTCATGCTTTTGTAATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTTGTACCTCTAATATTAGGAGGGCCAGATATAGCTTTTCCTCGAATAAATAATATAAGGTTCTGATTACTTCCTCCGTCTTTAACCTTACTTTTAATAAGAGGGATGGTAGAAAGAGGAGTTGGAACAGGATGAACAGTCTATCCTCCTTTAGCAGGGGCTATCGCCCACGCTGGTGCTTCAGTTGATTTAGGGATTTTCTCTTTACATTTAGCCGGGGTTTCTTCTATTTTAGGAGCTGTAAATTTTATAACAACTATTATCAATATGCGTTCTTTCGGCATGACAATAGACCAGATACCTTTATTTGTGTGAGCTGTTTTTATTACTGCGATCCTTTTATTATTATCGTTGCCAGTTTTAGCAGGAGCTATTACAATACTTCTAACTGACCGAAATCTAAACACCTCATTCTTCGATCCTGCAGGAGGTGGGGACCCAGTTCTGTACCAACATTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcinus maenas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 102
Specimens with Barcodes: 131
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

No conservation of the green crab is currently under way.

US Federal List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Due to the number of shell fish the green crab eats, and the rate at which it is done, the green crab is seen as a large threat to the many of the nations commercial shellfisheries. It is estimated that millions of dollars could be spent and are spent each year to try and thwart the green crabs from destroying a very important industry, and helping to maintain biodiversity in areas poplutlated by the green crab. The green crab also carries a parasitic worm that can infect birds that prey on the crabs. This can have a potentially devastating effect by throwing off the food chain, and on the ecosystem as a whole in these areas. (Washington Sea 1998, Washington Dept.1997, Jaquette 1998, Holden 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The green crab serves no basic benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Carcinus maenas

"Shore crab" redirects here. This may also be used for crabs in the superfamily Grapsoidea.

Carcinus maenas is a common littoral crab, and an important invasive species, listed among the 100 "world's worst alien invasive species".[2] It is native to the north-east Atlantic Ocean and Baltic Sea, but has colonised similar habitats in Australia, South Africa, South America and both Atlantic and Pacific coasts of North America. It grows to a carapace width of 90 millimetres (3.5 in), and feeds on a variety of molluscs, worms and small crustaceans, potentially impacting a number of fisheries. Its successful dispersion has occurred via a variety of mechanisms, such as on ships' hulls, packing materials, bivalves moved for aquaculture, and rafting.

C. maenas is known by different names around the world. In the British Isles, it is generally referred to simply as the shore crab. In North America and South Africa, it bears the name green crab or European green crab. In Australia and New Zealand, it is referred to as either the European green crab or European shore crab.

Contents

Description [edit]

A young Carcinus maenas showing the common green colour

C. maenas has a carapace up to 60 millimetres (2.4 in) long and 90 mm (3.5 in) wide,[3] but can be larger outside its native range, reaching 101 mm (4.0 in) wide in British Columbia.[4] The carapace has five short teeth along the rim behind each eye, and three undulations between the eyes. The undulations, which protrude beyond the eyes, are the simplest means of distinguishing C. maenas from the closely related C. aestuarii, which can also be an invasive species. In C. aestuarii, the carapace lacks any bumps and extends forward beyond the eyes. Another characteristic for distinguishing the two species is the form of the first and second pleopods (collectively the gonopods), which are straight and parallel in C. aestuarii, but curve outwards in C. maenas.[3]

The colour of C. maenas varies greatly, from green to brown, grey or red. This variation has a genetic component, but is largely due to local environmental factors.[5] In particular, individuals which delay moulting become red–coloured rather than green. Red individuals are stronger and more aggressive, but are less tolerant of environmental stresses, such as low salinity or hypoxia.[6]

Native and introduced range [edit]

Rough map of the distribution of Carcinus maenas. Blue areas are the native range, red areas are the introduced or invasive range, black dots represent single sightings that did not lead to invasion, and green areas are the potential range of the species.

C. maenas is native to European and North African coasts as far as the Baltic Sea in the east, and Iceland and central Norway in the north, and is one of the most common crabs throughout much of its range. In the Mediterranean Sea, it is replaced by the closely related species Carcinus aestuarii.

C. maenas was first observed on the east coast of North America in Massachusetts in 1817, and may now be found from southern Virginia northwards; by 2007, this species had extended its range northwards to Placentia Bay, Newfoundland.[7] In 1989, the species was found in San Francisco Bay, California, on the Pacific coast of the United States. Until 1993, it was not able to extend its range, but reached Oregon in 1997, the state of Washington in 1998 and British Columbia in 1999,[8][9] thus extending its range by 750 kilometres (470 mi) in ten years.[10] By 2003, C. maenas had extended to South America with specimens discovered in Patagonia.[11]

In Australia, C. maenas was first reported "in the late 1800s",[12] in Port Phillip Bay, Victoria. It has since spread along the south-eastern and south-western seaboards, reaching New South Wales in 1971, South Australia in 1976 and Tasmania in 1993. One specimen was found in Western Australia in 1965, but there have been no further discoveries in the area since.[12]

C. maenas first reached South Africa in 1983, in the Table Docks area near Cape Town.[13] Since then, it has spread at least as far as Saldanha Bay in the north and Camps Bay in the south, over 100 kilometres (62 mi) apart.

There have been appearances of C. maenas recorded in Brazil, Panama, Hawaii, Madagascar, the Red Sea, Pakistan, Sri Lanka and Myanmar; however, these have not resulted in invasions, but remain isolated findings. Japan has been invaded by a related crab, either C. aestuarii or a hybrid of C. aestuarii and C. maenas.[14]

It is believed, based on the ecological conditions, that C. maenas could eventually extend its range to colonise the Pacific coast of North America from Baja California to Alaska.[8] Similar ecological conditions are to be found on many of the world's coasts, with the only large potential area not to have been invaded yet being New Zealand; the New Zealand government has taken action, including the release of a Marine Pest Guide[15] in an effort to prevent colonisation by C. maenas.

Ecology [edit]

A female Carcinus maenas carrying fertilised eggs

C. maenas can live in all types of protected and semi-protected marine and estuarine habitats, including habitats with mud, sand, or rock substrates, submerged aquatic vegetation, and emergent marsh, although soft bottoms are preferred. C. maenas is euryhaline, meaning that it can tolerate a wide range of salinities (from 4 to 52 ), and survive in temperatures of 0 to 30 °C (32 to 86 °F).[16] The wide salinity range allows C. maenas to survive in the lower salinities found in estuaries. A molecular biological study using the COI gene found genetic differentiation between the North Sea and the Bay of Biscay, and even more strongly between the populations in Iceland and the Faroe Islands and those elsewhere. This suggests that C. maenas is unable to cross deeper water.[17]

Females can produce up to 185,000 eggs, and larvae develop offshore in several stages before their final moult to juvenile crabs in the intertidal zone.[18] Young crabs live among seaweeds and seagrasses, such as Posidonia oceanica, until they reach adulthood.[19]

Argopecten irradians, a scallop which has been affected by the introduction of C. maenas

C. maenas has the ability to disperse by a variety of mechanisms,[18] including ballast water, ships' hulls, packing materials (seaweeds) used to ship live marine organisms, bivalves moved for aquaculture, rafting, migration of crab larvae on ocean currents, and the movement of submerged aquatic vegetation for coastal zone management initiatives. Thresher et al.[12] found C. maenas dispersed in Australia mainly by rare long-distance events, possibly caused by human actions.

C. maenas is a predator, feeding on many organisms, particularly bivalve molluscs (such as clams, oysters, and mussels), polychaetes and small crustaceans.[20] They are primarily nocturnal, although activity also depends on the tide, and crabs can be active at any time of day.[21] In California, preferential predation of C. maenas on native clams (Nutricola spp.) resulted in the decline of the native clams and an increase of a previously introduced clam (the amethyst gem clam, Gemma gemma).[22] C. maenas has been implicated in the destruction of the soft-shell clam (Mya arenaria) fisheries on the east coast of the United States and Canada, and the reduction of populations of other commercially important bivalves (such as scallops, Argopecten irradians, and northern quahogs, Mercenaria mercenaria).[18] The prey of C. maenas includes the young of bivalves[23] and fish, although the effect of its predation on winter flounder, Pseudopleuronectes americanus is minimal.[24] C. maenas can, however, have substantial negative impacts on local commercial and recreational fisheries, by preying on the young of species, such as oysters and the Dungeness crab, or competing with them for resources.[25]

Control [edit]

Cancer productus limits the spread of Carcinus maenas in parts of North America.

Due to its potentially harmful effects on ecosystems, various efforts have been made to control introduced populations of C. maenas around the world. In Edgartown, Massachusetts, a bounty was levied in 1995 for catching C. maenas, to protect local shellfish, and 10 tons were caught.[26]

There is evidence that the native blue crab in eastern North America, Callinectes sapidus, is able to control populations of C. maenas; numbers of the two species are negatively correlated, and C. maenas is not found in the Chesapeake Bay, where Callinectes sapidus is most frequent.[27] On the west coast of North America, C. maenas appears to be limited to upper estuarine habitats, in part because of predation by native rock crabs (Romaleon antennarium and Cancer productus) and competition for shelter with a native shore crab, Hemigrapsus oregonensis.[28] Host specificity testing has recently been conducted on Sacculina carcini, a parasitic barnacle, as a potential biological control agent of C. maenas.[29] In the laboratory, Sacculina settled on, infected, and killed native California crabs, including the Dungeness crab, Metacarcinus magister (formerly Cancer magister), and the shore crabs Hemigrapsus nudus, Hemigrapsus oregonensis and Pachygrapsus crassipes. Dungeness crabs were the most vulnerable of the tested native species to settlement and infection by the parasite. Although Sacculina did not mature in any of the native crabs, developing reproductive sacs were observed inside a few Metacarcinus magister and Hemigrapsus oregonensis. Any potential benefits of using Sacculina to control C. maenas on the west coast of North America would need to be weighed against these potential non-target impacts.[29]

Fishery [edit]

C. maenas is fished on a small scale in the north-east Atlantic Ocean, with approximately 1200 tonnes being caught annually, mostly in France and the United Kingdom. In the northwest Atlantic, C. maenas was the subject of fishery in the 1960s, and again since 1996, with up to 86 tonnes being caught annually.[30]

Taxonomic history [edit]

Carcinus maenas was first given a binomial name, Cancer maenas, by Carl Linnaeus in his 1758 10th edition of Systema Naturae.[31] An earlier description was published by Georg Eberhard Rumphius in his 1705 work De Amboinsche Rariteitkamer, calling the species Cancer marinus sulcatus, but this predates the starting point for zoological nomenclature.[31] A number of later synonyms have also been published:[31]

  • Monoculus taurus Slabber, 1778
  • Cancer granarius Herbst, 1783
  • Cancer viridis Herbst, 1783
  • Cancer pygmaeus Fabricius, 1787
  • Cancer rhomboidalis Montagu, 1804
  • Cancer granulatus Nicholls, 1943
  • Megalopa montagui Leach, 1817
  • Portunus menoides Rafinesque-Schmaltz, 1817
  • Portunus carcinoides Kinahan, 1857

The lectotype chosen for the species came from Marstrand, Sweden, but it is assumed to have been lost.[31] In 1814, writing for The Edinburgh Encyclopaedia, William Elford Leach erected a new genus, Carcinus to hold this species alone (making it the type species of the genus, by monotypy).[31] In 1847, Nardo described a distinct subspecies occurring in the Mediterranean Sea, which is now recognised as a distinct species, Carcinus aestuarii.[1]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!