Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Brief Summary

Biology

Very little is known about these elusive monkeys, and the first comprehensive study of their ecology and behaviour only took place in the 1990s (5). Unusually for langur monkeys (which normally feed on leaves), the diet of the Yunnan snub-nosed monkey is composed primarily of lichens, such as those of the genus Bryotia (7). Lichen is an abundant and easy to digest food source but it is relatively poor nutritionally; this unusual diet has led to other aspects of behaviour that are unique amongst tree-dwelling primates (5). For example, large groups of up to 300 individuals have been observed (5), probably as a result of low food competition between members (7). These troops appear to be made up of small family groups consisting of an adult male, three to five females and their offspring (5), although the whole troop will tend to travel and rest together (7). Reliance on lichen, which can take between 10 to 15 years to regenerate, has also caused these monkeys to have a more wandering way of life (5). A troop will cover around 1,500 metres in one day and their home range reaches as much as 25 square kilometres (7). The birth rate is also low for this species; scientists estimate that a female gives birth about once every three years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Yunnan snub-nosed monkey is the most endangered of China's three snub-nosed monkey species. The long, shaggy coat is mainly black on the back, arms and legs and white on the front (2). White hair is also present on the flanks and this is particularly long on the adult males. The lips are a deep pink, whilst the face is paler and there are yellowish-grey hairs on the shoulders (2). These monkeys get their common name for their unusual noses; the nasal bones are absent and the nostrils are upturned (2) (5). Young are born white but become grey over several months (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs only in southwestern China (Tibet and Yunnan). It is found in fragmented populations in the Yun Ling Mountains in northwestern Yunnan and southeastern Tibet, west of the Yangtze River and east of the Mekong River (Yang 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the Yunling Mountains in south-western China, around 13 isolated sub-populations exist in north-western Yunnan Province and south-eastern Tibet (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in high-altitude evergreen forests, both the lower (about 3,000 m) and upper (about 4,700 m) limits of its known ranges (Long et al.. 1996) are the highest recorded for a primate. It prefers fir-larch forest between the Yangtze and Mekong Rivers (Long et al. 1994). At Bamei, in northern Yunnan Province, it was found to live primarily in cypress forests (Zhong et al. 1998).

It is mainly folivorous, though Kirkpatrick et al. (2001) report that lichens are also an important part of its diet in the northern part of its range. It is semi-terrestrial and diurnal (Wu and Xian 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yunnan snub-nosed monkeys are found at a higher altitude than any other primate, with the exception of man (6). They inhabit coniferous forest, which is found between 3,000 and 4,500 metres above sea level and experiences frost for around 280 days of the year (2) (3); snow to a depth of over one metre can accumulate (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one wild born specimen was about 14.7 years old when still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinopithecus bieti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCTCATTAACCGCTGACTATTCTCTACAAATCATAAAGATATTGGAACTCTATACTTATTATTTGGCGCATGGGCCGGAACCATAGGTATGGCTATAAGTCTCCTTATTCGAGCTGAGTTAGGCCAACCCGGCAACCTATTAGGCAATGATCACATTTATAATGTTATCGTTACAGCCCATGCATTTGTCATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGTTTCGGAAATTGACTAGTACCCCTAATAATTGGCGCTCCTGACATAGCATTTCCTCGTCTAAATAATATAAGCTTCTGACTTCTTCCACCATCTTTCCTACTTCTTATTGCATCAGCCATAGTAGAGGCTGGCGCCGGGACAGGCTGAACAGTCTACCCGCCTCTAGCAGGGAACTTCTCTCACCCAGGAGCCTCTGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTATTTCTTCTATCTTAGGGGCTATTAATTTTATCACAACTATTATTAATATAAAACCCCCTGCTATATCTCAATATCAAACCCCCCTCTTTGTTTGATCAGTTCTAATTACAGCAGTCCTATTACTCTTATCCCTACCTGTATTAGCTGCTGGTATTACAATACTATTAACAGACCGTAACCTCAACACTACTTTCTTTGACCCTGCTGGAGGGGGAGACCCGATCTTATATCAACACCTATTCTGATTTTTTGGCCACCCTGAAGTCTATATTCTTATTTTACCTGGCTTTGGAATAATTTCACACATTGTAACATATTATTCTGGAAAAAAAGAACCTTTCGGGTATATAGGCATAGTCTGAGCTATAGTATCAATTGGATTTTTAGGTTTTATCGTATGAGCCCACCACATATTTACTGTTGGAATAGACGTAGATACACGAGCCTATTTTACCTCTGCTACTATAATTATTGCAATTCCAACTGGCGTTAAAGTATTTAGCTGACTCGCTACGCTACACGGAGGAAATATCAAGTGATCTCCAGCAATACTCTGAGCCCTAGGCTTTATTTTCCTTTTTACCGTAGGAGGCTTAACCGGTATTGTACTAGCAAACTCATCACTAGATATCGTACTACATGATACATACTATGTTGTAGCTCATTTCCACTACGTCTTATCTATAGGAGCTGTGTTTGCTATTATGGGAGGCTTTATTCACTGATTCCCCCTATTCTCAGGCTATACCCTAGACCAAGTCTGTGCCAAAGCACATTTTATTATCATATTTGTAGGCGTAAATTTAACCTTCTTCCCACAACACTTTCTTGGCTTATCCGGAATACCCCGACGCTATTCTGATTACCCTGATGCCTACACCACATGAAATATTGTATCATCCATAGGCTCCTTTATTTCTCTAGTAGCTATACTACTAATAGTCTATATAATCTGAGAAGCTTTTGCCTCGAAACGCAAGGTTCTACTAATCGAACAACCTACGTCTAATCTAGAGTGATTACATGGCTCCCCACCACCATATCATACATTTGATGAACCAACATTCATCAAAGTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinopithecus bieti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Bleisch, W. & Richardson, M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Endangered as there are less than 1,000 mature individuals, and the species has likely declined by well over 20% in the last 2 generations (approximately 25 years).

History
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/27/1990
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinopithecus bieti , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In 2006 the total known population was estimated at less than 2,000, with less than 1,000 mature individuals. There are currently 15 subpopulations, with 3 locations where subpopulations are known to have been extirpated since 1994 (L. Yongcheng pers. comm.). Although the remaining populations are well known, there are very likely to be as yet unsurveyed populations.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to this species is hunting, often as a non-targeted species caught in snares set for musk deer. A preliminary PVA using Vortex found that five smallest subpopulations are at risk of declines and extinction in the next 100 years from effects inbreeding and poaching, while 5 largest subpopulations were considered more secure (Xiao et al. 2005). The species is also threatened by habitat loss, especially from logging. Since 1999, when a ban stopped most commercial logging in the region, habitat loss has slowed, but it is still a large potential threat in the future. Clearing of forest land for summer grazing pasture had decreased suitable habitat for the monkeys by 31% between 1958 and 1997 (Xiao et al. 2003). In addition, fires set for agriculture are a threat to some of the areas, particularly in Tibetan Autonomous Region. A subpopulation of about 50 individuals in one area was apparently extirpated due to pesticide spraying for control of forest pests (Zhong Tai in litt.)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Numbers of Yunnan snub-nosed monkeys have declined principally in response to habitat loss and hunting pressure (6). The human population in this remote corner of China has exploded in recent decades and forests are being cleared, both for timber and to make way for agriculture (5). The populations of snub-nosed monkeys that remain are isolated in fragments of the former forest (8). Hunting of this primate was banned in China in 1975, but lack of funds and staff means that this law is hard to enforce, and hunting persists (2). Monkeys are also accidentally trapped in snares set out for other wildlife (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I. Most of the remaining populations are in protected areas, with only four groups found outside of them. There are currently 11 groups in protected areas: Hongla Snow Mountain Nature Reserve in the Tibetan Autonomous Region (which contains about 300 individuals), and Baima Snow Mountain and Laojun Mountain Nature Reserves in Yunnan.

There is a major focus in China on captive breeding of this species, with breeding pairs at the Kunming Zoo and Kunming Institute of Zoology. Most of these individuals are captured from the wild, and so far the program is not sustainable (Wang Sung pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Government of China banned the hunting of snub-nosed monkeys in 1975, although this has proven difficult to enforce (2). Around half the population of the Yunnan snub-nosed monkey occurs within protected reserves such as Baima Snow Mountain Nature Reserve where wardens are trying to work closely with the local people to secure the future of this species (5). In 1998, a national logging ban on all remaining old-growth forests came into force, which will help to preserve some of the monkey's precious habitat (5). Yunnan snub-nosed monkeys are a vital part of the mountain ecosystem, preventing the accumulation of lichen in these ancient forests of the foothills of the Himalayas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black snub-nosed monkey

The black snub-nosed monkey (Rhinopithecus bieti), also known as the Yunnan snub-nosed monkey, is an endangered species of primate in the Cercopithecidae family. It is endemic to China,[1] where it is known to the locals as the Yunnan golden hair monkey (滇金丝猴) and the black golden hair monkey (黑金丝猴).[citation needed] It is threatened by habitat loss.[2] It was named after Bishop Félix Biet who collected it.

Contents

Characteristics [edit]

The black snub-nosed monkey is a large, stocky and well-furred primate belonging to the leaf-monkey Colobinae subfamily. Despite its morphological distinctiveness and noteworthy biology this is one of the lesser known primate species. In recent years, however, knowledge about the behavior and ecology of the black snub-nosed monkey has grown. Lack of information is mainly a result of difficult research conditions due to the monkey's semi-nomadic lifestyle, elusive nature and inhospitable habitat with extremely steep hillsides, impenetrable bamboo thickets, freezing winter climate with snow as well as damp and foggy summers with minimum visibility.

This species has a highly restricted distribution in the biodiversity hotspot of the Yunling Mountains which border the Himalaya range. The actual distribution range is limited to the Yun Ridge (云岭) portion of the Hengduan Mountains.[3] Only 17 groups with a total population of less than 1,700 animals have survived in northwest Yunnan and neighboring regions in the Autonomous Prefecture of Tibet. Group size is small, typically only 20 to 60; groups of over 100 have never been observed. The territory of each group varies from 20 to 135 square km.[4]

History [edit]

The black snub-nosed monkey was almost completely unknown until the 1990s. The fact that no single zoo outside China has ever kept the black snub-nosed monkey in captivity has contributed to the enigmatic status of this species. The black snub-nosed monkey lives in one of the most extreme environments of any nonhuman primate. Its habitat is either pure temperate coniferous forest or deciduous/evergreen broadleaf and coniferous forest.[5] The highest recorded altitude of a group of this species is 4700 m.[3] The black snub-nosed monkey lives in very large super-groups which are made up of single-male core families or harems.[6] The monkey moves fast and far in a cohesive group and covers vast areas in search of lichens and other seasonally available food items.

Reproduction [edit]

The reproduction cycles of black snub-nosed monkey is generally similar to that of golden snub-nosed monkeys, except the time of birth is often two to three months later due to colder climate.[7] Like most primates, the snub-nosed monkey gives birth at night, making it difficult for researchers to observe. An rare observation of a daytime birth found a multiparous female assisting another female in the birthing process, similar to human midwifery practice.[8]

See also [edit]

References [edit]

  1. ^ a b Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 173. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b Bleisch, W. & Richardson, M. (2008). Rhinopithecus bieti. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ a b Long, Y. C., Kirkpatrick, R. C., Zhong, T., and Xiao, L. (1994). "Report on the distribution, population, and ecology of the Yunnan snub-nosed monkey (Rhinopithecus bieti)". Primates 35 (2): 241–250. doi:10.1007/BF02382060. 
  4. ^ Long, Y., and Wu, R. (2006). "Population, home range, conservation status of the Yunnan snub-nosed monkey (Rhinopithecus bieti)". Abstracts of the China Fusui International Primatological Symposium: 10–11. 
  5. ^ Ding, W., and Zhao, Q. (2004). "Rhinopithecus bieti at Tacheng, Yunnan: diet and daytime activities". International Journal of Primatology 25 (3): 583–598. doi:10.1023/B:IJOP.0000023576.60883.e5. 
  6. ^ Grüter, C. C., and Zinner, D. (2004). "Nested societies. Convergent adaptations in snub-nosed monkeys and baboons?". Prim. Rep. 70: 1–98. 
  7. ^ Kirkpatrick, R. C., Long, Y. C., Zhong, T., and Xiao, L. (1998). "Social organization and range use in the Yunnan snub-nosed monkey Rhinopithecus bieti". International Journal of Primatology 19: 13–51. doi:10.1023/A:1020302809584. 
  8. ^ Ding, Wei; Yang, Le; Xiao, Wen (5 February 2013). "Daytime birth and parturition assistant behavior in wild black-and-white snub-nosed monkeys (Rhinopithecus bieti) Yunnan, China". Behavioural Processes. doi:10.1016/j.beproc.2013.01.006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!