Articles on this page are available in 1 other language: Chinese (Simplified) (8) (learn more)

Overview

Brief Summary

Biology

Relatively little is known of these elusive monkeys. Recent studies have thrown light on many aspects of their behaviour and ecology, but still more research is required. They are highly social monkeys (4), forming units of 20 – 30 in winter, which often come together into larger troops of up to 200 in the summer (3). Several of these groups may in turn combine temporarily to form enormous bands of up to 600 (3). These larger groups are sub-divided into smaller family units comprising of one dominant male and around 4 females with their young (2). Most activity occurs in the trees, but some feeding may take place on the ground (2). When threatened, the monkeys take refuge by climbing very quickly high up into the trees. They feed mainly on pine needles and young firs, but they also take bamboo shoots, leaves, buds and fruits (2). Although golden snub-nosed monkeys display mating behaviour throughout the year, most births tend to occur in spring and summer (2) (4). Most matings are solicited by the female, who signals her readiness to mate with a number of signals and postures (4). One young is normally produced after a gestation period of 7 months, although occasionally two infants may be produced (2) (4). It is the mother that provides most of the infant's care, although males have been seen grooming their offspring (4). Sexual maturity is attained at 7 years in males and 4-5 years in females (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The golden snub-nosed monkey has blackish grey shoulders, upper arms, back, crown, and tail, with the back being covered in a longer layer of fine silver hairs. In males, the sides of the head, forehead, sides of the neck and underparts are bright golden in colour, hence the common name of this species. Females are generally similar in appearance to males, but the head and upperparts are more brownish black (2). Their noses are, as the name suggests, flattened and set back from the muzzle. The wide nostrils face forwards and there are two small flaps of skin above the nostrils that nearly touch the forehead (2). These monkeys produce a wide range of vocalisations, often without making facial movements. Chorus-like vocalisations are common in the wild, in which entire groups may call together (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in west-central China (Ganssu, Hubei, Shaanxi, and Sichuan provinces) (Groves 2001).

Rhinopithecus roxellana roxellana
Occurs in western Sichuan (Qingchuan, Pingwu, Songpan, Beichuan, Nanping, Maoxian, Heishui, Wenchuan, Baoxing, Tianquan, Lushan, Luding counties, on Qionglaishan Mountain, Mingshan Mountain, Daxiangling and Xiaoxiangling Mountain), southern Gansu (Wenxian county in Mingshan Mountain) and southern Shaanxi (Ningqian country) (L. Yongcheng pers. comm.).

Rhinopithecus roxellana qinlingensis
Occurs in southern Shaanxi (Qinling Mountains, including the counties of Taibai, Zhouzhi, Foping, Yangxian, Ningshaan) (Wang et al. 1998; Li et al. 2001).

Rhinopithecus roxellana hubeiensis
Occurs in western Hubei and northeastern Sichuan (Shennongjia forest region of Daba Mountain, in Fangxian, Xingshan, and Batong counties) (Wang et al. 1998; Li unpubli. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Golden monkeys, Rhinopithecus roxellana, live in the mountainous regions of southwestern China, along the Tibetan Plateau. The largest populations are found in the Wolong Natural Reserve in Sichuan Province, but the range of golden monkeys extends as far south as Gansu province.

(Emanoil, 1994; Kirkpatrick, 1995)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is endemic to southwestern China along the Tibetan plateau. The largest populations occur in Woolong Natural Reserve in Sichuan Province (4). They also occur in Gansu, Hubei and Shaanxi Provinces (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These monkeys are reported to range from 570 mm to 760 mm in head and body length. The tail is between 510 and 720 mm. Coat color is sexually dimorphic. Males and females have a golden belly, forehead and neck. Males have grayish black on the nape, shoulders, arms, back, head and tail. In females, these parts are brownish black.

The nose is flattened, with nostrils facing forward. Two flaps of skin on the widely opened nostrils form peaks that almost touch the forehead.

(Nowak, 1999)

Range length: 570 to 760 mm.

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found only in montane forests where snow cover can last for up to six months of the year (Allen 1938; Davison 1982). In the Qinling Mountains it is found in mixed deciduous-broadleaf forests from 1,400 to 2,800 m (Gao and Liu 1995; Li et al. 2001). It can also occur in other forest types, including mixed conifer-broadleaf and deciduous broadleaf. Rhinopithecus roxellana roxellana and Rhinopithecus roxellana hubeiensis are found more often in mixed conifer and deciduous broadleaf forests. It is semi-terrestrial, diurnal, and folivorous, but will also eat seeds, fruit, bark, insects, and small vertebrates.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhinopithecus roxellana is found in temperate broad leaf and conifer forests at elevations ranging from 1,600 to 4,000 m above sea level. These monkeys live in mountain forests all year long, but they may migrate to slightly lower elevations during the winter. Golden monkeys and other species in the genus Rhinopithecus are among the few primates who live in temperate zones.

(Emanoil, 1994; Kirkpatrick, 1995; Schaller, 1985)

Range elevation: 1,600 to 4,000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits high mountainous forests, reaching elevations of around 3000 meters (3), but they may descend to lower altitudes in winter (2). They live in temperate broadleaved and coniferous forests (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rhinopithecus roxellana is a largely arboreal species. The diet varies according to the season. During the warm weather months, R. roxellana feeds primarily on leaves from broad-leaf trees and fir and pine needles. Buds, bark, and fruit seeds provide supplementary nutrition. During the winter, however, these monkeys switch to a more limited diet of bark and lichen. Although the species feeds largely from arboreal sources, it will descend to the ground to feed on grasses and wild onions.

(Emanoil, 1994; Kirkpatrick, 1995; Schaller, 1985)

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; lichens

Primary Diet: herbivore (Folivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

To the extent that these animals are prey for carnivores, they may play a part in local food webs. It is likely that they affect plant growth through their herbivory.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

It is not known whether other animals prey upon these primates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Golden monkeys are a highly vocal species, with males and females specializing in certain calls. Male vocal behavior is characterized by whines (long, wavering cries that accompany grooming and eating) and bawls (short, exhaled cries that are not situation-specific). Female vocal behavior typically consists of chucks ("ee-tcha" sounds that occur in highly stimulating contexts) and shrills (squeaks and squeals uttered in response to male whines). Both sexes indulge in other vocalizations -- grunts, sighs, moans, belches -- but to a much lesser degree. An interesting aspect of golden monkey vocalizations is the ventriloquist-like absence of any body or facial movement. This is particularly true of whines and shrills, which are often exchanged by males and females while they are eating. Captive male-female pairs of golden monkeys often vocalize in duets, not unlike those observed in some species of monogamous birds. In the wild, chorus-type vocalizations involving groups or sub-groups are common.

(Kirkpatrick 1995, Tenaza 1988)

In addition to vocalizations, these monkeys communicate with body posture (presenting for mating, etc.), and tactile communication (mounting, mating, grooming, nursing). Chemical communication has not been reported, but may be present.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although the lifespan of these monkeys has not been described, individuals in the related species, douc langurs (Pygathrix nameaus) are reported to have lived about 26 years in captivity.

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.5 years (captivity) Observations: One wild born specimen was 29-30 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Within groups, the adult sex ratio of R. roxellana is heavily biased toward females, with a 5:1 ratio observed in some groups. This is consistent with the polygynous social organziation displayed by the monkeys. During the mating season, copulation is usually solicited by the female, who signals her estrus with proceptive behaviors, such as establishing eye contact with the male and then running a short distance away. The female also signals readiness via prostration, which involves lying with the head hanging down, the forearms stretched out or bent, the legs curled up, and the tail angling freely. Often, the prostrating female will point her anogenital region toward the male. The male responds initially with a wide opening of his mouth, and if he is interested (only about 50 percent of the time) he will mount the female. Ejaculation occurs in only a small percentage of the unions during the mating season (and it never occurs outside the mating season). For this reason, the sequence of solicitation and mounting between a male and a female may occur several times a day during the three-month mating period. Due to the scarcity of male ejaculate, a female may try to thwart the solicitation of another female to improve her chances for a successful copulation.

Mating System: polygynous

Golden monkeys display mating behavior throughout the year, but they breed on a seasonal basis, with all conceptions taking place within a three-month period. This period may start as early as August or as late as November, depending on the region where the monkeys live.

Once a female becomes pregnant, gestation lasts about seven months, with births occurring between April and August. Usually, one offspring is born.

(Kirckpatrick 1985, Ren et al. 1995, Schaller 1985)

Data are not available on many of the reproductive parameters of these monkeys. However, like-sized primate typically breed every year to two years, depending upon food availability. Weaning usually occurs around one year of age. In R. roxellana nursing may extend for a longer period because of the harsh climate which these animals occupy. Sexual maturity is reported to be at 4 to 5 years of age for females, and at 7 years for males.

Breeding interval: The interbirth interval of these animals is not known with certainty.

Breeding season: Golden monkeys breed between August and November.

Average number of offspring: 1.

Average gestation period: 7 months.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Mothers provide most of the care. Males have been observed grooming infants, however. Because of the social structure, which ensures that one male breeds with a group of several females, it is likely that this male, confident of his paternity, assists the females in some ways, by protecting offspring as well as by grooming them. In most primates, the period of dependence is fairly extended, and it is likely that this is the case for R. roxellana.

(Nowak, 1999)

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinopithecus roxellana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGGCTATTCTCTACAAATCATAAAGATATTGGAACTTTATACTTGTTATTTGGCGCATGGGCCGGAACCATGGGTATGGCTATAAGTCTCCTTATTCGAGCTGAACTAGGTCAACCTGGCAACCTGTTAGGCAAT---GATCACATTTATAATGTTATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTCGGAAATTGACTAGTACCCCTAATAATTGGCGCTCCTGACATAGCATTTCCTCGTCTAAATAATATAAGCTTCTGACTTCTTCCACCATCTTTCCTACTTCTTCTTGCATCAGCCATAGTAGAGGCTGGTGCCGGGACAGGCTGAACAGTCTATCCGCCTCTAGCGGGAAACTTCTCTCACCCAGGAGCCTCTGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTATTTCTTCTATCTTAGGAGCTATTAATTTTATCACAACTATTATTAATATAAAACCCCCTGCTATATCTCAATATCAAACCCCCCTGTTTGTTTGATCAGTTCTAATTACAGCAGTCCTATTACTCCTATCCCTACCTGTATTAGCTGCTGGTATTACAATACTATTAACAGACCGTAATCTCAATACTACTTTCTTTGACCCTGCTGGAGGGGGGGATCCGATCTTATATCAACACCTATTCTGATTTTTCGGCCATCCTGAAGTCTATATTCTTATTTTACCTGGCTTTGGAATAATTTCACATATCGTAACATACTACTCTGGAAAAAAAGAACCTTTCGGATATATAGGCATAGTCTGAGCTATAGTATCAATCGGATTTTTAGGTTTTATCGTATGAGCCCACCATATATTTACTGTTGGAATAGACGTAGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinopithecus roxellana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2ac

Version
3.1

Year Assessed
2008

Assessor/s
Yongcheng, L. & Richardson, M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
The species is listed as Endangered as there has been a decline of over 50% in the last 3 generations (approximately 40 years) due to forest loss. This decline is continuing, though in some areas the populations are declining at a lower rate.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Determining the conservation status of these animals is difficult because of the nomenclatural problems associated with them. They are listed by IUCN as vulnerable. CITES lists all Rhinopithecus species on Appendix I. Golden monkeys are also listed as endangered by the U.S. endangered species act.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/27/1990
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinopithecus roxellana , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

All subspecies of the golden snub-nosed monkey (Rhinopithecus roxellana) – the Hubei golden snub-nosed monkey (Rhinopithecus roxellana hubeiensis) the Qinling golden snub-nosed monkey (Rhinopithecus roxellana qinlingensis) and the Moupin golden snub-nosed monkey (Rhinopithecus roxellana roxellana) – are Classified as Vulnerable (VU C2a) on the IUCN Red List 2003 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rhinopithecus roxellana roxellana
There are about 10,000 individuals in 100 troops in Sichuan (6,000 individuals in Mingshan Mountain, 3,500 in Qionglaishan Mountain, and 500 in Daxiangling and Xiaoxianling Mountain), about 800 individuals in 8 troops in Gansu, and about 170-200 individuals in 1 or 2 troops in Shaanxi (Zhang 1995; Jiang 2005; Li unpubl. 2006).

Rhinopithecus roxellana qinlingensis
There are approximately 3,800-4,000 total individuals belonging to 39 troops (Li et al. 2001). Around half of these are mature individuals. Since the mid 1990s, the population appears to have stabilized.

Rhinopithecus roxellana hubeiensis
There are about 600-1,000 individuals in 5-6 troops (Ren et al. 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Rhinopithecus roxellana
The major threat for the species is forest loss due to agricultural expansion, especially outside of protected areas.

Rhinopithecus roxellana roxellana
The major threat is habitat loss. Secondarily, there is a serious threat from continued illegal hunting of this subspecies. There is also harassment owing to tourist activities, including the herding of troops for tourists to view.

Rhinopithecus roxellana qinlingensis
In the Qinling Mountains tourism is having a significant negative impact, mainly due to the creation of roads and other infrastructure. Before 1990, there were threats from illegal hunting, but this has stopped due to increased government protection.

Rhinopithecus roxellana hubeiensis
There is a serious threat to this subspecies from tourism-related activities, along with continued habitat loss. Before 1990, there were threats from illegal hunting, but this has stopped due to increased government protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

It was once thought that the fur of Rhinopithecus species could prevent rheumatism, and Manchu officials were the only people allowed to wear the pelts. Hunting for the pelts continues to this day, and other parts of the monkeys are used in traditional medicines (2). These monkeys are also hunted for their meat (4). Furthermore, habitat loss is a great and on-going problem (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I, and as Category I of the Chinese Wildlife Protection Act, 1989.
Protected areas where this species definitely known to occur include: Baihe Nature Reserve, Changqing Nature Reserve, Foping Nature Reserve, Laoxiancheng Nature Reserve, Shennongjia Nature Reserve, Taibai Nature Reserve, Wanglang Nature Reserve, Zhouzhi Nature Reserve (M. Richardson pers. comm.), although according to L. Yongcheng (pers. comm.) it is to be found in a much larger number of nature reserves. It is almost never seen in captivity outside of Asia (M. Richardson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Research into this endearing primate is underway. Hopes are that the more we learn about the habits and ecology of this species, the more likely it will be that successful conservation programmes can be devised (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These animals have no known negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Golden monkeys are hunted by humans for fur and meat. The fur is sold for medicinal preparations and the meat is sold for food. The illegal trade of golden monkey fur makes insignificant contributions to local economies, however, and the monkey's meat provides little protein for local diets.

(Kirkpatrick 1995)

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Golden snub-nosed monkey

The golden snub-nosed monkey (Rhinopithecus roxellana) is an Old World monkey in the Colobinae subfamily.[1] It is endemic to a small area in temperate, mountainous forests of central and Southwest China.[3] They inhabit these mountainous forests of Southwestern China at elevations of 1,500-3,400 m above sea level.[4] The Chinese name is Sichuan golden hair monkey (川金丝猴). It is also widely referred to as the Sichuan snub-nosed monkey.[4][5][6] Of the three species of snub-nosed monkeys in China, the golden snub-nosed monkey is the most widely distributed throughout China.[4]

Snow occurs frequently within its range and it can withstand colder average temperatures than any other non-human primates.[7] Its diet varies markedly with the seasons, but it is primarily an herbivore with lichens being its main food source. It is diurnal and largely arboreal, spending some 97% of their time in the canopy. There are three subspecies. Population estimates range from 8,000 to 15,000 and it is threatened by habitat loss.[2]

Although typical colobine monkeys are largely arboreal quadrupeds and live in the canopies of moist tropical forests, there are a number of exceptions. The genus Rhinopithecus is unusual among colobines in having forelimbs almost as long as their hind limbs and ischial callosities separated in males and females.[8]

Found in the highly seasonal deciduous coniferous mixed forests in Hubei, Shaanxi, Gansu, and Sichuan, where the monkeys experience severe winters with snow cover for 4 months and lowest average temperature of any non-human primate in the world.[8]

Contents

Taxonomy [edit]

Hubei's monkeys honored by a statue at Houzibao (the place name means, "a bunch of monkeys"). Located in Xingshan County near Shennongjia border, this is indeed part of the Hubei golden snub-nosed monkey's traditional homeland

Biologists presently identify three subspecies of this monkey,[1] which can be distinguished primarily by the length of their tails, as well as by certain skeletal and dental features.[2] The dense human settlement of much of eastern Sichuan and the Han River valley of southern Shaanxi creates geographical separation between the three subspecies.

  • Moupin golden snub-nosed monkey, Rhinopithecus roxellana roxellana. This subspecies is found in the mountainous areas flanking the Sichuan Basin from the west and north. According to the estimates made between 1995 and 2006, the population includes some 10,000 individuals, living mostly in Sichuan. Of them, some 6,000 lived in the Min Mountains of northern Sichuan, 3,500 in the Qionglai Mountains further west, and 500 in the Daxiangling and Xiaoxiangling ranges of south-central Sichuan. Smaller groups are also found just north of Sichuan border, in the border counties of Gansu (Wen County; about 800 individuals in 8 troops) and Shaanxi (Ningqiang County, about 170-200 individuals in 1 or 2 troops).[2]
  • Qinling golden snub-nosed monkey, Rhinopithecus roxellana qinlingensis. According to an estimate published in 2001, this subspecies included some 3,800-4,000 individuals (about half of them adults) in 39 in Qinling Mountains of southern Gansu.[2] The Qinling Mountains are separated from the more southern Min - Daba Mountains belt by the wide and comparatively densely populated Han River valley.[9]
  • Hubei golden snub-nosed monkey, Rhinopithecus roxellana hubeiensis. Members of this subspecies reside in the Daba Mountains (in particular, their Shennongjia section) of the westernmost Hubei (Shennongjia Forest District, Fang, Xingshan and Badong counties) and the northeaster Chongqing Municipality.[2][10] According to a 1998 estimate, the population included 600-1,000 individuals in 5-6 troops.[2] In 2005, the management of the Shennongjia Nature Reserve reported that the population had grown between 1990 and 2005 from 500 to over 1200.[11]

Physical characteristics [edit]

The adult and subadult golden snub-nosed monkey is sexually dimorphic.

Adult males (estimated at over 7 years of age) have large bodies covered with very long, golden guard hairs on their backs and cape area. The crest is medium brown while the back, crown to nape, arms and outer thighs are deep brown. The brown crest also contains physically upright hairs, which the shape are useful for individual identification.[4] Also, when their mouths are open, researchers can observe long canines.

Subadult males (estimated at 5–7 years of age) have a similar sized body as the fully developed male adult, but have a more slender body. The golden guard hairs on the cape are short and sparse, and their median brown crests show microbanding, while also turning from a brown color.[4]

Adult females (estimated at over 5 years of age) are smaller in size and are about half the size of adult males. The dorsum, crow to nape, cape, arms and outer thighs are brown to deep brown in some of the older females.[4] However, golden guard hairs are also present on the back and cape area, but they are shorter in length than in the males. The brown crest shows microbanding. Their breasts and nipples are large and easily visible which is also useful for identification. After pregnancy, it is common to observe infants and newborns hanging beneath the abdomen of females when they are climbing or walking.[4]

Subadult females (estimated at 3–4 years old) are smaller than adult females and are about two-thirds the size. The body hair is brown, gradually turning golden but lacking the beautiful golden guard hairs. Their median brown crest also shows microbanding. Their breasts and nipples are also not as large as they are in adult females.[4]

Juveniles (ranging from at least 1 year of age to 3 years old) are quite small, being less than two-thirds the size of adult females. Their body hair is light brown, gradually turning reddish gold. The rest of their body (dorsum, crown to nape, cape, arms and outer thighs) hair is brown. Golden hairs in the dorsum or cape area are not recognizable nor is the median brown crest present in subadult to adult females and males.[4] Sexual discrimination is difficult because their external genital organs are underdeveloped.

Infants (estimated at 3 months to 1 year old) are light brownish gray or light brown, appearing white in sunlight. They are often observed playing with juveniles or other infants, but are noted to spend most of their time beside their mothers or sucking milk.[4] They are also observed clinging from the front of their mothers (primarily the lower abdomen) for protection, feeding, and nurturing. Their sex of the individual cannot be distinguished at this point of time as well as in Newborns.

Newborn babies (estimated at less than 3 months of age) are dark to light gray. They turn light brownish grey after about 2 months.[4] They are also observed rarely leaving their mothers or other females carrying them, known as alloparenting. Sex at this time is indistinguishable.

Habitat and distribution [edit]

The distribution range of the golden snub-nosed monkey is limited to the mountains in four provinces in China: Sichuan, Gansu, Shaanxi, and Hubei.[2][12] This monkey is found at elevations of 1,500-3,400 m. It lives at different elevations and increases or decreases the size of its home range with the change of seasons. The change in home range size and location is dependent upon the availability and distribution of food. The total area covered by its seasonal home ranges is surprisingly large for an arboreal species. One of the largest home ranges found covered 40 km2.[5]

The golden snub-nosed monkey lives in temperate areas. It is limited to broadleaf deciduous, broadleaf deciduous-conifer mixed, or conifer forests.[5]

In a study from 2000-2003 that was conducted in an area surrounding Yuhuangmiao village in Zhouzhi National Nature Reserve, in the Shaanxi Province in China, many methods were used to observe the Sichuan snub-nosed monkeys.[4] The average annual temperature observed over the study period was 6.4°C with a minimum of -8.3°C in January and a maximum of 21.7°C in July.[4] These temperatures observed are blamed for the limited vegetation of the monkeys. The vegetation varies with altitude from deciduous broadleaf forests at low elevations to mixed coniferous broadleaf forests above 2,200 m and coniferous forests above 2,600 m.[4]

Behavior [edit]

The golden snub-nosed monkey is found in groups ranging in size from 5-10 individuals to bands of about 600.[5] The social organization of this species can be quite complex. The one-male-units (OMUs) are the basic social unit within groups of golden snub-nosed monkeys with many of the OMUs forming a bigger group. These multi-tier societies consist of several OMUs that include one adult male plus a number of adult females and their offspring. Some observers have even come to conclude that these large foraging groups are multi-male and multi-female societies.[13]

Two golden snub-nosed monkeys in captivity outside of Xi'an, China

The male may stay solitary, often remaining away from the rest of the group members as they rest. Adult females tend to socialize more with one another than with other males or juveniles. Group members remain close to one another, interactions between different OMUs often result in confrontations.[4] Females of the golden snub-nosed monkey are usually observed to form several close associations with other females. However in conflicts against other units in the surrounding site, both males and females support each other, while also protecting their young (usually observed at a distance by putting the young in the center of the pack).[4]

Protecting the young is a group effort. Mothers often have helpers assisting them with the care of their young.[14] When faced with danger from a predator such as the Northern Goshawk (Accipiter gentilis), the young are placed at the center of the group while the stronger adult males go to the scene of the alarm. The rest of the day, the members of the group remain closer to one another with the young protected at the center.[15]

There is little information available on the sleeping cluster patterns of the Sichuan snub-nosed monkeys. However, in a detailed observation of the free-ranging band in the Qinling Mountains in central China, results have suggested that winter night activity of Rhinopithecus Roxellana is a compromise between antipredator and thermoregulatory strategies and an adaptation to ecological conditions of their temperate habitat.[16] Keeping warm is critical for survival in freezing temperatures, but their thick coats can provide this warmth as well as sleeping in these clusters. Monkeys often sleep in the lower stratum of the tree canopy, avoiding the upper canopy where it is cold and windy. They form larger sleeping clusters at night than in the daytime. The most common types of night-sleeping clusters were adult females and their young, followed by adult females with other adult females.[16] Adult males are usually observed sleeping by themselves or on the lookout for predators or dangers.

There are several hypotheses to explain the formation of sleeping clusters, the most important one being a thermoregulatory process. The thermoregulatory hypothesis suggests that a primary function of sleeping in clusters is the conservation of heat during cold temperatures.[16] Along with thermoregulation, safety from predators is an important principle underlying the formation of sleeping clusters in primates. This antipredation hypothesis suggest that increased cohesion and large sleeping congregations might facilitate predator detection and enhance group defense.[16]

Reproduction [edit]

Females are sexually mature at about 5 years old. Males are sexually mature at about 5–7 years old.[4] Mating may occur throughout the year but peaks in the month of October. This approximates gestation at 6–7 months in length. The golden snub-nosed monkey gives birth from March to June.[17]

In primate research, although male-male competition for mates and female mate choice are the common causes of sexual selection, female-female competition over males is especially important in polygynous species.[18] The Sichuan snub-nosed monkey is a seasonal breeding species of colobine endemic to China, and lives in a multi-level social system. Because the basic social and reproductive unit is the harem or one male unit (OMU), which consists of a single resident male, a number of adult females, sub-adult females, juveniles and infants, it has been suggested that sexual competition in this polygynous species is skewed. Females faced with multiple competitors will exhibit a high level of sexual competition, while the single resident male will not experience within-group sexual competition.[citation needed]

Diet [edit]

The golden snub-nosed monkey eats (from greatest to least in amount) lichens, young leaves, fruits or seeds, buds, mature leaves, herbs, bark, and flowers. This diet varies from season to season, showing a correlation once again between food availability and home range. This diet also shows a complicated seasonal variation. The monthly diet varies from primarily lichen eater between November and April, to a mixture of folivore and lichen eater from May to July, and to a mixture of frugivore (or seed eater) and lichen eater or primarily lichen eater between August and October.[8] For this seasonal variation, the amount of lichens consumed appears to decrease in the summer with the greater availability of fruit or seeds. The monkeys' preferred lichen species seem to be Connus controversa, Cerasus discadenia, Salix willichiana, and Malus halliana. Lichens are found in great profusion on dead trees.[6]

This primate prefers to forage in larger trees of a tree species, and spends most of the time using primary forest and young forest, rarely uses shrub forest and does not use grassland.[8] Even though they primarily forest in the trees and sometimes on the ground, they have certain predators to be aware of. Both mammal predators, such as red dog (Cuon alpinus), wolf (Canis lupus), asiatic golden cat (Catapuma temmincki), and leopard (Panthera pardus), and eagle predators, like golden eagle (Aquila chrysaetos) and Northern Goshawk (Accipiter gentilis).[8]

Conservation [edit]

A skeleton of the species.

The golden snub-nosed monkey is endangered due to habitat loss. For instance, lichens are the main staple of the monkey's diet and dead trees have the greatest lichen coverage. Unfortunately, dead trees are harvested, thus reducing the quality of the habitat and availability of food. The monkey is a highly selective feeder, so damage to its habitat seriously impacts the species.[5]

This primate is found in a number of protected areas, including Baihe Nature Reserve, Foping National Nature Reserve, Shennongjia National Geopark and Wanglang National Nature Reserve. The golden snub-nosed monkey is also listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) meaning that international trade in this species is prohibited.[2]

See also [edit]

References [edit]

  1. ^ a b c Groves, C. P. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 174. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b c d e f g h i Yongcheng, L. & Richardson, M. (2008). Rhinopithecus roxellana. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Guo, Songtao, Li, Baoguo, Watanabe, Kunio (October 2007). "Diet and activity budget of Rhinopithecus roxellana in the Qinling Mountains, China". Primates: Journal of Primatology 48 (4): 268–276. 
  4. ^ a b c d e f g h i j k l m n o p q Zhang, Peng, Watanabe, Kunio, Li, Baoguo, Tan, Chia L (October 2006). "Social Organization of Sichuan snub-nosed monkeys (Rhinopithcus roxellana) in the Qinling Mountains, Central China". Primates 47 (4): 374–382. doi:10.1007/s10329-006-0178-8. PMID 16625309. 
  5. ^ a b c d e Li, Baoguo, Chen, Chao, Ji, Weihong, Ren, Baoping (2000). "Seasonal Home Range Changes of the Sichuan Snub-Nosed Monkey (Rhinopithecus roxellana) in the Qinling Mountains of China". Folia Primatologica: International Journal of Primatology 7: 375–386. 
  6. ^ a b Yiming, Li (May 2005). "Seasonal variation of diet and food availability in a group of Sichuan snub-nosed monkeys in Shennongjia Nature Reserve, China". American Journal of Primatology 68 (3): 217–233. doi:10.1002/ajp.20220. PMID 16477596. 
  7. ^ Gron, K.J. (2007). "Primate Factsheets: Golden snub-nosed monkey (Rhinopithecus roxellana) Taxonomy, Morphology, & Ecology". Retrieved 2008-01-28. 
  8. ^ a b c d e Li, Yiming. (2007). Terrestriality and tree stratum use in a group of sichuan snub-nosed monkeys. Primates, 48(3), 197-207. doi:10.1007/s10329-006-0035-9
  9. ^ E.g., 使用中国地图集 (Shiyong Zhongguo Dituji, "Practical Atlas of China"), 2008, ISBN 978-7-5031-4772-2; map of Shaanxi on pp. 162-163
  10. ^ Chongqing Municipality was separated from Sichuan Province in 1997, and included much of Sichuan's part of the Daba Mountains, and all of former Sichuan-Hubei border. Thus older sources referring to the "northeastern Sichuan", may often mean counties transferred to the new Chongqing Municipality.
  11. ^ Number of golden monkeys doubled (Xinhua, www.chinaview.cn, 2005-08-08)
  12. ^ IUCN Range map
  13. ^ Zhang, Peng, Watanabe, Kunio, Li, Baoguo, Tan, Chia L (October 2006). "Social Organization of Sichuan snub-nosed monkeys (Rhinopithcus roxellana) in the Qinling Mountains, Central China". Primates 47 (4): 374–382 (http://www.springerlink.com/content/ep326v4886519434/)
  14. ^ Xi, Wenzhong, Li, Baoguo, Zhao, Dapeng, Ji, Weihong, Zhang, Peng (June 2008). "Benefits to Female Helpers in Wild Rhinopithecus roxellana". International Journal of Primatology 29 (3): 593–600. doi:10.1007/s10764-008-9260-y. 
  15. ^ Zhang, Shuyi, Ren, Baoping, Li, Baoguo (1999). "A Juvenile Sichuan Golden Monkey (Rhinopithecus roxelanna) Predated by a Goshawk (Accipter gentilis) in the Qinling Mountains". Folia Primatologica: International Journal of Primatology 70: 175–176. doi:10.1159/000021693. 
  16. ^ a b c d Zhang, P., Li, B., Watanabe, K., & Qi, X. (2011). Sleeping cluster patterns and retiring behaviors during winter in a free-ranging band of the sichuan snub-nosed monkey. Primates, 52(3), 221-8. doi:10.1007/s10329-011-0241-y
  17. ^ Zhang, Shuyi, Liang, Bing, Wang, Lixin (2000). "Seasonality of Matings and Births in Captive Sichuan Golden Monkeys (Rhinopithecus roxellana)". American Journal of Primatology 51 (4): 265–269. doi:10.1002/1098-2345(200008)51:4<265::AID-AJP6>3.0.CO;2-8. PMID 10941443. 
  18. ^ Li, B., & Zhao, D. (2007). Copulation behavior within one-male groups of wild rhinopithecus roxellana in the qinling mountains of china. Primates, 48(3), 190-6. doi:10.1007/s10329-006-0029-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!