Articles on this page are available in 1 other language: Chinese (Simplified) (8) (learn more)

Overview

Brief Summary

Biology

Relatively little is known of these elusive monkeys. Recent studies have thrown light on many aspects of their behaviour and ecology, but still more research is required. They are highly social monkeys (4), forming units of 20 – 30 in winter, which often come together into larger troops of up to 200 in the summer (3). Several of these groups may in turn combine temporarily to form enormous bands of up to 600 (3). These larger groups are sub-divided into smaller family units comprising of one dominant male and around 4 females with their young (2). Most activity occurs in the trees, but some feeding may take place on the ground (2). When threatened, the monkeys take refuge by climbing very quickly high up into the trees. They feed mainly on pine needles and young firs, but they also take bamboo shoots, leaves, buds and fruits (2). Although golden snub-nosed monkeys display mating behaviour throughout the year, most births tend to occur in spring and summer (2) (4). Most matings are solicited by the female, who signals her readiness to mate with a number of signals and postures (4). One young is normally produced after a gestation period of 7 months, although occasionally two infants may be produced (2) (4). It is the mother that provides most of the infant's care, although males have been seen grooming their offspring (4). Sexual maturity is attained at 7 years in males and 4-5 years in females (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The golden snub-nosed monkey has blackish grey shoulders, upper arms, back, crown, and tail, with the back being covered in a longer layer of fine silver hairs. In males, the sides of the head, forehead, sides of the neck and underparts are bright golden in colour, hence the common name of this species. Females are generally similar in appearance to males, but the head and upperparts are more brownish black (2). Their noses are, as the name suggests, flattened and set back from the muzzle. The wide nostrils face forwards and there are two small flaps of skin above the nostrils that nearly touch the forehead (2). These monkeys produce a wide range of vocalisations, often without making facial movements. Chorus-like vocalisations are common in the wild, in which entire groups may call together (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Golden monkeys, Rhinopithecus roxellana, live in the mountainous regions of southwestern China, along the Tibetan Plateau. The largest populations are found in the Wolong Natural Reserve in Sichuan Province, but the range of golden monkeys extends as far south as Gansu province.

(Emanoil, 1994; Kirkpatrick, 1995)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in west-central China (Ganssu, Hubei, Shaanxi, and Sichuan provinces) (Groves 2001).

Rhinopithecus roxellana roxellana
Occurs in western Sichuan (Qingchuan, Pingwu, Songpan, Beichuan, Nanping, Maoxian, Heishui, Wenchuan, Baoxing, Tianquan, Lushan, Luding counties, on Qionglaishan Mountain, Mingshan Mountain, Daxiangling and Xiaoxiangling Mountain), southern Gansu (Wenxian county in Mingshan Mountain) and southern Shaanxi (Ningqian country) (L. Yongcheng pers. comm.).

Rhinopithecus roxellana qinlingensis
Occurs in southern Shaanxi (Qinling Mountains, including the counties of Taibai, Zhouzhi, Foping, Yangxian, Ningshaan) (Wang et al. 1998; Li et al. 2001).

Rhinopithecus roxellana hubeiensis
Occurs in western Hubei and northeastern Sichuan (Shennongjia forest region of Daba Mountain, in Fangxian, Xingshan, and Batong counties) (Wang et al. 1998; Li unpubli. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is endemic to southwestern China along the Tibetan plateau. The largest populations occur in Woolong Natural Reserve in Sichuan Province (4). They also occur in Gansu, Hubei and Shaanxi Provinces (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

These monkeys are reported to range from 570 mm to 760 mm in head and body length. The tail is between 510 and 720 mm. Coat color is sexually dimorphic. Males and females have a golden belly, forehead and neck. Males have grayish black on the nape, shoulders, arms, back, head and tail. In females, these parts are brownish black.

The nose is flattened, with nostrils facing forward. Two flaps of skin on the widely opened nostrils form peaks that almost touch the forehead.

(Nowak, 1999)

Range length: 570 to 760 mm.

Sexual Dimorphism: male larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Rhinopithecus roxellana is found in temperate broad leaf and conifer forests at elevations ranging from 1,600 to 4,000 m above sea level. These monkeys live in mountain forests all year long, but they may migrate to slightly lower elevations during the winter. Golden monkeys and other species in the genus Rhinopithecus are among the few primates who live in temperate zones.

(Emanoil, 1994; Kirkpatrick, 1995; Schaller, 1985)

Range elevation: 1,600 to 4,000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found only in montane forests where snow cover can last for up to six months of the year (Allen 1938; Davison 1982). In the Qinling Mountains it is found in mixed deciduous-broadleaf forests from 1,400 to 2,800 m (Gao and Liu 1995; Li et al. 2001). It can also occur in other forest types, including mixed conifer-broadleaf and deciduous broadleaf. Rhinopithecus roxellana roxellana and Rhinopithecus roxellana hubeiensis are found more often in mixed conifer and deciduous broadleaf forests. It is semi-terrestrial, diurnal, and folivorous, but will also eat seeds, fruit, bark, insects, and small vertebrates.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits high mountainous forests, reaching elevations of around 3000 meters (3), but they may descend to lower altitudes in winter (2). They live in temperate broadleaved and coniferous forests (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rhinopithecus roxellana is a largely arboreal species. The diet varies according to the season. During the warm weather months, R. roxellana feeds primarily on leaves from broad-leaf trees and fir and pine needles. Buds, bark, and fruit seeds provide supplementary nutrition. During the winter, however, these monkeys switch to a more limited diet of bark and lichen. Although the species feeds largely from arboreal sources, it will descend to the ground to feed on grasses and wild onions.

(Emanoil, 1994; Kirkpatrick, 1995; Schaller, 1985)

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; lichens

Primary Diet: herbivore (Folivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

To the extent that these animals are prey for carnivores, they may play a part in local food webs. It is likely that they affect plant growth through their herbivory.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is not known whether other animals prey upon these primates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Golden monkeys are a highly vocal species, with males and females specializing in certain calls. Male vocal behavior is characterized by whines (long, wavering cries that accompany grooming and eating) and bawls (short, exhaled cries that are not situation-specific). Female vocal behavior typically consists of chucks ("ee-tcha" sounds that occur in highly stimulating contexts) and shrills (squeaks and squeals uttered in response to male whines). Both sexes indulge in other vocalizations -- grunts, sighs, moans, belches -- but to a much lesser degree. An interesting aspect of golden monkey vocalizations is the ventriloquist-like absence of any body or facial movement. This is particularly true of whines and shrills, which are often exchanged by males and females while they are eating. Captive male-female pairs of golden monkeys often vocalize in duets, not unlike those observed in some species of monogamous birds. In the wild, chorus-type vocalizations involving groups or sub-groups are common.

(Kirkpatrick 1995, Tenaza 1988)

In addition to vocalizations, these monkeys communicate with body posture (presenting for mating, etc.), and tactile communication (mounting, mating, grooming, nursing). Chemical communication has not been reported, but may be present.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Although the lifespan of these monkeys has not been described, individuals in the related species, douc langurs (Pygathrix nameaus) are reported to have lived about 26 years in captivity.

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.5 years (captivity) Observations: One wild born specimen was 29-30 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Within groups, the adult sex ratio of R. roxellana is heavily biased toward females, with a 5:1 ratio observed in some groups. This is consistent with the polygynous social organziation displayed by the monkeys. During the mating season, copulation is usually solicited by the female, who signals her estrus with proceptive behaviors, such as establishing eye contact with the male and then running a short distance away. The female also signals readiness via prostration, which involves lying with the head hanging down, the forearms stretched out or bent, the legs curled up, and the tail angling freely. Often, the prostrating female will point her anogenital region toward the male. The male responds initially with a wide opening of his mouth, and if he is interested (only about 50 percent of the time) he will mount the female. Ejaculation occurs in only a small percentage of the unions during the mating season (and it never occurs outside the mating season). For this reason, the sequence of solicitation and mounting between a male and a female may occur several times a day during the three-month mating period. Due to the scarcity of male ejaculate, a female may try to thwart the solicitation of another female to improve her chances for a successful copulation.

Mating System: polygynous

Golden monkeys display mating behavior throughout the year, but they breed on a seasonal basis, with all conceptions taking place within a three-month period. This period may start as early as August or as late as November, depending on the region where the monkeys live.

Once a female becomes pregnant, gestation lasts about seven months, with births occurring between April and August. Usually, one offspring is born.

(Kirckpatrick 1985, Ren et al. 1995, Schaller 1985)

Data are not available on many of the reproductive parameters of these monkeys. However, like-sized primate typically breed every year to two years, depending upon food availability. Weaning usually occurs around one year of age. In R. roxellana nursing may extend for a longer period because of the harsh climate which these animals occupy. Sexual maturity is reported to be at 4 to 5 years of age for females, and at 7 years for males.

Breeding interval: The interbirth interval of these animals is not known with certainty.

Breeding season: Golden monkeys breed between August and November.

Average number of offspring: 1.

Average gestation period: 7 months.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Mothers provide most of the care. Males have been observed grooming infants, however. Because of the social structure, which ensures that one male breeds with a group of several females, it is likely that this male, confident of his paternity, assists the females in some ways, by protecting offspring as well as by grooming them. In most primates, the period of dependence is fairly extended, and it is likely that this is the case for R. roxellana.

(Nowak, 1999)

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinopithecus roxellana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGGCTATTCTCTACAAATCATAAAGATATTGGAACTTTATACTTGTTATTTGGCGCATGGGCCGGAACCATGGGTATGGCTATAAGTCTCCTTATTCGAGCTGAACTAGGTCAACCTGGCAACCTGTTAGGCAAT---GATCACATTTATAATGTTATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTCGGAAATTGACTAGTACCCCTAATAATTGGCGCTCCTGACATAGCATTTCCTCGTCTAAATAATATAAGCTTCTGACTTCTTCCACCATCTTTCCTACTTCTTCTTGCATCAGCCATAGTAGAGGCTGGTGCCGGGACAGGCTGAACAGTCTATCCGCCTCTAGCGGGAAACTTCTCTCACCCAGGAGCCTCTGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTATTTCTTCTATCTTAGGAGCTATTAATTTTATCACAACTATTATTAATATAAAACCCCCTGCTATATCTCAATATCAAACCCCCCTGTTTGTTTGATCAGTTCTAATTACAGCAGTCCTATTACTCCTATCCCTACCTGTATTAGCTGCTGGTATTACAATACTATTAACAGACCGTAATCTCAATACTACTTTCTTTGACCCTGCTGGAGGGGGGGATCCGATCTTATATCAACACCTATTCTGATTTTTCGGCCATCCTGAAGTCTATATTCTTATTTTACCTGGCTTTGGAATAATTTCACATATCGTAACATACTACTCTGGAAAAAAAGAACCTTTCGGATATATAGGCATAGTCTGAGCTATAGTATCAATCGGATTTTTAGGTTTTATCGTATGAGCCCACCATATATTTACTGTTGGAATAGACGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinopithecus roxellana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Determining the conservation status of these animals is difficult because of the nomenclatural problems associated with them. They are listed by IUCN as vulnerable. CITES lists all Rhinopithecus species on Appendix I. Golden monkeys are also listed as endangered by the U.S. endangered species act.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2ac

Version
3.1

Year Assessed
2008

Assessor/s
Yongcheng, L. & Richardson, M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
The species is listed as Endangered as there has been a decline of over 50% in the last 3 generations (approximately 40 years) due to forest loss. This decline is continuing, though in some areas the populations are declining at a lower rate.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/27/1990
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinopithecus roxellana , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

All subspecies of the golden snub-nosed monkey (Rhinopithecus roxellana) – the Hubei golden snub-nosed monkey (Rhinopithecus roxellana hubeiensis) the Qinling golden snub-nosed monkey (Rhinopithecus roxellana qinlingensis) and the Moupin golden snub-nosed monkey (Rhinopithecus roxellana roxellana) – are Classified as Vulnerable (VU C2a) on the IUCN Red List 2003 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rhinopithecus roxellana roxellana
There are about 10,000 individuals in 100 troops in Sichuan (6,000 individuals in Mingshan Mountain, 3,500 in Qionglaishan Mountain, and 500 in Daxiangling and Xiaoxianling Mountain), about 800 individuals in 8 troops in Gansu, and about 170-200 individuals in 1 or 2 troops in Shaanxi (Zhang 1995; Jiang 2005; Li unpubl. 2006).

Rhinopithecus roxellana qinlingensis
There are approximately 3,800-4,000 total individuals belonging to 39 troops (Li et al. 2001). Around half of these are mature individuals. Since the mid 1990s, the population appears to have stabilized.

Rhinopithecus roxellana hubeiensis
There are about 600-1,000 individuals in 5-6 troops (Ren et al. 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Rhinopithecus roxellana
The major threat for the species is forest loss due to agricultural expansion, especially outside of protected areas.

Rhinopithecus roxellana roxellana
The major threat is habitat loss. Secondarily, there is a serious threat from continued illegal hunting of this subspecies. There is also harassment owing to tourist activities, including the herding of troops for tourists to view.

Rhinopithecus roxellana qinlingensis
In the Qinling Mountains tourism is having a significant negative impact, mainly due to the creation of roads and other infrastructure. Before 1990, there were threats from illegal hunting, but this has stopped due to increased government protection.

Rhinopithecus roxellana hubeiensis
There is a serious threat to this subspecies from tourism-related activities, along with continued habitat loss. Before 1990, there were threats from illegal hunting, but this has stopped due to increased government protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It was once thought that the fur of Rhinopithecus species could prevent rheumatism, and Manchu officials were the only people allowed to wear the pelts. Hunting for the pelts continues to this day, and other parts of the monkeys are used in traditional medicines (2). These monkeys are also hunted for their meat (4). Furthermore, habitat loss is a great and on-going problem (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I, and as Category I of the Chinese Wildlife Protection Act, 1989.
Protected areas where this species definitely known to occur include: Baihe Nature Reserve, Changqing Nature Reserve, Foping Nature Reserve, Laoxiancheng Nature Reserve, Shennongjia Nature Reserve, Taibai Nature Reserve, Wanglang Nature Reserve, Zhouzhi Nature Reserve (M. Richardson pers. comm.), although according to L. Yongcheng (pers. comm.) it is to be found in a much larger number of nature reserves. It is almost never seen in captivity outside of Asia (M. Richardson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Research into this endearing primate is underway. Hopes are that the more we learn about the habits and ecology of this species, the more likely it will be that successful conservation programmes can be devised (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

These animals have no known negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden monkeys are hunted by humans for fur and meat. The fur is sold for medicinal preparations and the meat is sold for food. The illegal trade of golden monkey fur makes insignificant contributions to local economies, however, and the monkey's meat provides little protein for local diets.

(Kirkpatrick 1995)

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!