Overview

Brief Summary

Biology

Guerezas generally live in small, cohesive groups, typically ranging in size from 3 to 15 individuals, but occasionally up to as many as 23 (2) (7). These social groups sometimes support several adult males, but normally comprise one adult male, accompanied by several adult females and juveniles. Despite being a diurnal species, the guereza spends over half the day resting, with the remaining hours of daylight devoted mostly to feeding and moving about. When active, this primarily arboreal species can be seen bounding through the canopy, leaping the gaps from tree to tree. The guereza sleeps during the night, with a single group generally occupying several adjacent trees nearby a source of food. To communicate, the guereza employs various vocalisations, the most distinctive of which is an impressive roar usually made by the dominant adult male and echoed by males in neighbouring groups (2). These roaring bouts, which usually take place during the night or at dawn, are thought to play a role in male-male competition and help maintain spacing between groups (2) (7). Leaves and fruit are the main constituents of the guereza's diet (2). In order to derive adequate nutritional value from leaves, the guereza, like other colobus monkeys, has evolved a large, multi-chambered stomach, capable of digesting enormous amounts of foliage, with the help of gut microbes that efficiently break down cellulose (2) (5) (6). The guereza itself is a source of food for several predators including crowned hawk-eagles, chimpanzees and possibly leopards (2). Reproduction takes place at all times of the year, with the adult male, or dominant male in multi-male groups, normally having exclusive access to the females members of the group. After a gestation period lasting just over five months, the female usually gives birth to a single white-haired infant. For the first few months of an infant's life, it is the focus of the group's attention, and is frequently handled, particularly by the females. When moving about during this time, the infant always hangs onto the fur of its mother's chest, but after around 20 weeks becomes more independent, and after 50 weeks no longer clings to its mother or suckles (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The guereza is a large, sturdy colobus monkey with an attractive black-and-white coat (2) (4). Glossy, black fur covers much of the body, but contrasts with short, white hair surrounding the face, a u-shaped, cape-like mantle of long white hair that extends down the shoulders and across the lower back, and a bushy white tuft to the tip of the tail (2) (4) (5) (6). Although not clearly resolved, eight guereza subspecies are currently recognised, each occupying a distinctive range and exhibiting slight variations in appearance. The main features that set the subspecies apart are the length and colouration of the mantle, which sometimes appears creamy or yellow, the length of the tail, and the extent of the tail tuft. At birth, the hair of infant guerezas is completely white, in striking contrast with the predominately black fur of the adult guereza (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This widespread species ranges from the area of the Donga River region of Nigeria and the Yabassi District of Cameroon, eastwards across the Oubangui River from the Central African Republic to the northern Democratic Republic of the Congo, and then discontinuously eastwards to southern Sudan, Uganda, the Kenyan and Ethiopian highlands, and Mount Kilimanjaro, Mount Meru and the Kahé District of Tanzania (Groves in press).

There are eight subspecies:

The subspecies C. g. occidentalis occurs from eastern Nigeria, Cameroon and Gabon, eastwards to south-western Sudan and Uganda.

The nominate C. g. guereza is found in forested areas of the Ethiopian highlands west of the Rift Valley and down into the lowland reaches along the Awash River, the Omo River and in the Blue Nile gorge.

C. g. gallarum is restricted to the Ethiopian highlands east of the Rift Valley.

The subspecies C. g. dodingae is endemic to the Didinga Hills in south-eastern Sudan.

C. g. matschiei is found in Kenya west of the Rift Valley, and also in some of the forests within the Rift, west to Mount Elgon (Kenya and Uganda), and south to the Ngorongoro Crater and the Grumeti River in Tanzania.

C. g. percivali is restricted to the Matthews Range of Kenya.

C. g. kikuyuensis is known only from the Ngong Escarpment, Mount Kenya and the Aberdare Mountain Range, Kenya.

C. g. caudatus is present on montane forests of Mt. Kilimanjaro and Mt. Meru, and the adjoining forests at slightly lower altitudes (Kahe; Momela Lakes in Arusha National Park), Tanzania and Kenya.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Colobus guereza is found in diverse regions of equatorial Africa. This species is found in the lowland tropical rainforest to the upper reaches of the Montane forests of the upper Donga river and tributaries, as well as Acacia-dominated riverine galleries and evergreen thicket forests. Guerezas are also found in the equatorial areas of Africa including Nigeria, east and west of the Niger river, and locally distributed in relic forests north of the rainforest zone. They are also found along the Donga river, Gashaka, Ngelnyaki, Cameroon, Ethiopia, Gojjam, Kulla, Kenya, Uganda, Tanzania, N Congo, E Gabon, Central African Republic, NE Zaire, W Kenya, NW Rwanda, and S Sudan.

(Bateman, 1984; Grzimek, 1988; Happold, 1987; Honacki, 1982; Kingdon, 1987; MacDonald, 1984; Nowak, 1991)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The guereza has a relatively widespread, central African distribution, extending from Nigeria, Cameroon and Gabon in a band eastwards across to Ethiopia, Kenya and Tanzania (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Colobus guereza is a heavy bodied animal with a long tail. The head and body length is 45 to 72 cm and the tail length is 52 to 100 cm. Guerezas are slightly sexually dimorphic in that the males can weigh up to 1.19 times more than females. Guerezas have only four digits on each hand; the thumb is absent or represented by a small phalangeal tubercle that sometimes bears a nail. The loss of the thumb may be an adaptation for quick movements through the trees.

Members of the genus Colobus, which are in the subfamily Colobinae, are distinguished from members of the other subfamily, Cercopithecinae, by the absence of cheek pouches and the presence of prominent ischial callosities that are separate in females and contiguous in males.

The stomach of C. guereza is complex. It is subdivided by a partition into 2 subregions. The upper region contains a neutral medium, which is necessary for the fermentation of foliage by anaerobic bacteria. The black and white monkeys' large salivary glands provide a buffer fluid between the two regions of the stomach.

The coloration of fur is distinctly black and white. The face is gray and has no fur. The coat is glossy black, and the face and callosities are surrounded by white. A U-shaped white mantle of varying length is found on the sides. The outside of the thigh is variably whitish, and the tail is either a whitish or yellowish color from tip to base. There is also a large white tuft at the end of the tail.

The skull is prognathous, that is, the lower jaw projects beyond the upper. The orbits are relatively small and oval with narrow superciliary ridges. A postorbital bar forms a plate on the side of the skull separating the orbit from the temporal fossa. The nostrils are more or less lengthened by an extension of nasal skin, and the nose nearly touches the mouth.

The molar teeth have high pointed cusps, and the inside of the upper molars and the outside of the lower molars are slightly convexly buttressed. The enamel on the inside of the lower incisors is thick, and there is a lateral process on the lower second incisor.

The young of the C. guereza do not share the black and white coloration, but instead have pure white fur for the first weeks of their life.

(Bateman, 1984; Grzimek, 1972; Grzimek, 1988; Happold, 1987; Honacki, 1982; Kingdon, 1987; MacDonald, 1984; Nowak, 1991)

Range mass: 5 to 14 kg.

Range length: 45 to 72 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 17.037 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in lowland and montane tropical moist forest, and gallery forest. They are often common in secondary or degraded forest. Animals live in small family groups.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Guerezas live in forest, woodlands, or wooded grasslands. They can also survive in dry, moist, or riparian forests that are either in lowlands or up to 3,300 m. They are most abundant in secondary forests or along rivers. They tend to live in the lower part of the trees if their area does not overlap with that of any other group of monkeys. When trees are not densely spaced, guerezas feed and travel on the ground.

(Bateman, 1984; Grzimek, 1988; Happold, 1987; MacDonald, 1995; Nowak, 1991)

Range elevation: 3,300 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The guereza is found in a wide range of wooded habitats, including all types of closed canopy forests up to an altitude of 4,500 metres, gallery forest and wooded savannah, with a particular preference for degraded or secondary forest (1) (2) (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Guereza are the second most folivorous of the Colobus species. Their diet consists primarily of leaves (especially from Celtis durandii, or Hackeberry Tree) with about 58% of young unripe leaves, 12.5% mature leaves, 13.5% fruits, 4% leaf buds, and 2% blossoms. However, this distribution is highly varied seasonally and geographically; thus at times mature leaves may account up to 34% of the diet. Guerezas seem to prefer leaves that are less susceptible to seasonal fluctuations. Guereza get water from dew and the moisture content of their diet, or rainwater held in the tree trunk hollows. In captivity C. guereza is fed monkey chow, fruits and vegetables.

Natural enemies of the guereza are crowned hawk eagles, leopards, and sometimes chimpanzees.

(Bateman, 1984; Grzimek, 1988; Kingdon, 1987; Metro Washington Park Zoo, 1995; Nowak 1991,   http://www.aza.org/aza/ssp/colmonk.html)

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As herbivores which serve as prey for several other species, these monkeys may play an important role in food webs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Natural enemies of guerezas are crowned hawk eagles, leopards, and sometimes chimpanzees.

(Bateman, 1984; Grzimek, 1988; Kingdon, 1987; Metro Washington Park Zoo, 1995; Nowak 1991,   http://www.aza.org/aza/ssp/colmonk.html)

Known Predators:

  • crowned hawk eagles
  • leopards
  • chimpanzees

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male guerezas roar loud nocturnal and dawn choruses as a means of spacing groups. Five vocal sounds have been recorded: roars, snorts, purrs, honks, and screams.

In addition to vocal communication, visual signals, such as flapping of fringe fur, facial expression, and body posture are used in aggressive communication between groups.

Tactile communication in this species includes grooming, playing, and fighting.

(Bateman, 1984; Grzimek, 1972; Grzimek, 1988; Happold, 1987; Nowak, 1991; The Phoenix Zoo)

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A member of the related species Colobus polykomos is reported to have lived 23.5 years in captivity. The lifespan of C. guereza is similar, throught to be about 29 years in captivity and about 20 years in the wild.

(Bateman, 1984; Grzimek, 1988; Nowak, 1991)

Range lifespan

Status: wild:
20 (high) years.

Range lifespan

Status: captivity:
29 (high) years.

Average lifespan

Status: captivity:
24.0 years.

Average lifespan

Sex: male

Status: captivity:
24.5 years.

Average lifespan

Sex: female

Status: captivity:
23.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 35 years (captivity) Observations: One wild born female lived 31.6 years in captivity, making her nearly 35 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Guerezas have a polygynous mating system.

Mating System: polygynous

There seems to be little or no reproductive seasonality in most populations of Colobus monkeys that have been studied, but there tends to be a birth peak, timed so that weaning coincides with the greatest seasonal abundance of solid food. The age of full sexual maturity in the guerezas is at least 6 years in males and 4 years in females. Each adult female produces one young every 20 months after a gestation period of about 6 months.

Sexual behavior is usually initiated by the female by tongue smacking. During copulation, the female remains prone.

(Bateman, 1984; Grzimek, 1988; Metro Washington Park Zoo, 1995)

Breeding interval: Guerezas breed once every two years.

Breeding season: Breeding is not strictly seasonal, although births are timed so that weaning occurs at the time of greatest food availability.

Average number of offspring: 1.

Average gestation period: 6 months.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 397.8 g.

Average gestation period: 175 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2192 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1461 days.

At birth, the infants are about 20 cm in head-body length and weigh about 0.4 kg. The eyes are open and the infant clings to the mother's or father's stomach. The weaning age is not known. Both the female and the male take part in the parenting of the child. Female guerezas remain in their natal group. This means that mothers and daughters have life-long relationships.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colobus guereza

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0387-06|AY863427|Colobus guereza| AACCGCTGGTTATTCTCTACAAATCATAAAGATATTGGAACTTTATATTTACTATTCGGAGCATGGGCCGGAATAATGGGTATAGCTATA---AGTCTTCTAATCCGAGCTGAACTAGGCCAACCCGGCAACCTGCTAGGTAAT---GACCACATTTACAATGTTATTGTTACGGCCCACGCATTCGTCATAATTTTCTTTATAGTTATACCTATCATAATCGGAGGATTCGGAAACTGATTAGTGCCTCTGATA---ATTGGTGCCCCTGACATAGCATTTCCCCGCTTAAACAATATAAGCTTTTGACTTCTCCCACCATCTTTTCTACTTCTTCTCGCATCAGCTGCAGTAGAAGCCGGTGCCGGAACTGGCTGAACCCTTTACCCGCCTCTGGCAGGAAACTTCTCCCATCCGGGAGCCTCTGTAGACTTA---ACCATCTTCTCACTCCATCTAGCAGGTATCTCCTCTATTCTAGGAGCTATTAATTTTATTACTACCATTATTAACATAAAACCCCCCGCAATTTCCCAATATCAGACCCCCTTATTCGTCTGGTCAGTAATAATTACAGCAGTCCTATTACTACTATCTCTCCCCGTACTAGCGGCC---GGCATCACAATACTATTAACAGATCGCAACCTCAACACTACCTTCTTCGACCCCGCCGGTGGAGGAGACCCCATCTTATATCAACATTTATTCTGGTTTTTTGGTCACCCCGAAGTCTATATCCTTATTTTACCAGGCTTTGGAATAATTTCCCATATTGTAACATACTATTCTGGAAAAAAA---GAACCATTCGGGTATATAGGTATAGTCTGAGCTATAATATCAATTGGCTTTTTAGGCTTTATTGTATGAGCCCACCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Colobus guereza

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kingdon, J., Struhsaker, T., Oates, J.F., Hart, J. & Groves, C.P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Least Concern as although locally threatened in parts of its range, this widespread species is not thought to be declining fast enough to place it in a higher category of threat.

History
  • 2000
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
  • 1988
    Not Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There has been a drastic decline in Colubus populations over the last 100 years. Guerezas are noted in Appendix II of the Concentration in International Trade of Endangered Species (CITES). Population sizes of black and white monkeys are currently declining in many localities due to hunting and deforestation by humans. Nevertheless, since 1934 it has been reported that guerezas are "not uncommon" in suitable protected habitats. For example, guerezas are still abundant in most parts of their lowland ranges in Cameroon and the Nigerian border, and in East African reserves and parks. Although guerezas are still abundant, there is the potential for extinction of eastern populations from unrestricted skin trading.

(Honacki, 1982; Happold, 1987; Kingdon, 1987; Metro Washington Park Zoo, 1995;   http://www.aza.org/aza/ssp/colmonk.html 1996)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (2). Subspecies: Colobus guereza caudatus (Mt. Kilimanjaro guereza), C. g. kikuyuensis (Mt. Kenya guereza), C. g. guereza (Omo River guereza) and C. g. occidentalis (Western guereza) classified as Least Concern (LC) on the IUCN Red List. C. g. gallarum (Djaffa Mountains guereza), C. g. dodingae (Dodinga Hills guereza) and C. g. matschiei (Mau Forest guereza) classified as Data Deficient (DD) on the IUCN Red List. C. g. percivali (Mt. Uaraguess guereza) classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A very widespread species that is still locally adundant in many areas.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened in parts of its range by habitat loss through deforestation for timber, conversion to exotic forest plantations and conversion to agricultural land (e.g., von Hippel et al. 2000). Hunting may also be severely impacting populations in the western part of the species range; Mwenja (2007) commented, in passing, that this subspecies is killed for its skins by local pastoralists in and around the Matthews Range Forest Reserve.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The guereza remains relatively widespread and abundant, and, owing to its tolerance of forest degradation, is considered to be one of the least threatened species of colobus monkey (1) (2). However, while the species as a whole is a low priority for conservation, several subspecies are in a more precarious state than others. Clearance of forests for agriculture is a major concern for some guereza populations, particularly those belonging to the subspecies C. g. gallarum and C. g. matschiei, both of which have a relatively small range in East Africa. Unfortunately, in the absence of recent survey work, it is not known how much pressure these populations are under. Consequently, both subspecies are currently listed as Data Deficient on the IUCN Red List, as is C. g. dodingae which was last recorded in the 1960s. The persecution of guereza for bushmeat and pelts is an additional threat in parts of its range. In particular, commercial trade in guereza skins is believed to be putting C. g. percivali, the only subspecies classified as Endangered, at considerable risk of extinction (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES and on Class B of the African Convention on the Conservation of Nature and Natural Resources. It occurs in a number of protected areas. Further taxonomic work is needed to assess the validity of the various described subspecies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A priority for guereza conservation is to carry out further research to resolve the uncertain taxonomic status of the different subspecies, and to accurately determine the conservation status of those subspecies currently classified as Data Deficient (1). Work is currently underway to collect baseline data on C. g. percivali in Kenya, which will establish appropriate conservation initiatives for this Endangered guereza (8). Fortunately for the species as a whole, not all guereza populations are under significant threat and many occur within protected areas (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These monkeys do not really initiate contact with humans. Therefore, the only negative effects from these black and white monkeys are the few instances when guerezas eat agricultural crops, probably due to inhospitable environmental conditions.

(Grzimek, 1988)

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Guerezas are used in animal testing concerning human diseases, behavior, and physiology. For example, studies have been performed that test for certain behavioral responses when the territory of a guereza group is threatened. Another study tested the effects of rickets (vitamin-D deficiency) on guerezas. Other studies deal with how phenotypic variability is inversely related to selection intensity. A final example is a study dealing with the effects of an experimental serum for Mycobacterium bovis. The data collected in these studies has proved invaluable.

Colobus guereza is one of many monkey species that is sacred to the Hindu and Buddhist religions. They play a major role in these religions as icons of sacred gods.

Colobus guereza fur has been a luxury for people in some cultures and has brought in large amounts of money to trade and fur companies.

(Grzimek, 1988; Morrisey, 1995; Stetter, 1995; Suedmeyer, 1996; Von-Hippel, 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mantled Guereza

Mantled Guereza!<-- This template has to be "warmed up" before it can be used, for some reason -->

Opisthokonta

The Mantled Guereza (Colobus guereza), also known simply as the Guereza, the Eastern Black-and-white Colobus,[2] or the Abyssinian Black-and-white Colobus,[3] is a colobus monkey, a kind of Old World monkey. It is native to much of west central and east Africa, including Cameroon, Equatorial Guinea, Nigeria, Ethiopia, Kenya, Tanzania, Uganda and Chad.

Contents

Appearance

Colobus guereza-2010.ogv
Two captive Mantled Guereza in Ueno Zoo, Japan. (video)

This black-and-white colobus species grows to about 18-28 inches, with a 20-35 inch tail. It weighs 12-32 pounds. It has no cheek pouches, and, like most colobi, the thumb is nearly absent. Its coat is a glossy black with its face and rump surrounded by white and a U-shaped white mantle on its sides and rear of back. Its tail is white at the end. Young are all white. The point of its nose nearly touches its mouth. Its hind legs are long and well-muscled for leaping through the trees and bounding along branches. Its rump callouses allow it to sit for long periods of time on slender branches without discomfort.

Habitat

Back and tail of a Mantled Guereza at the Milwaukee County Zoological Gardens

Diurnal and arboreal, it lives in the uppermost branches of tropical forests, woodlands and wooded grassland (where it may travel on the ground), including lowlands and high elevations. It is most abundant in secondary forests or along rivers. The Mantled Guereza's digestive system is designed to process leaves; its stomach is enlarged, specialized and contains bacteria for fermentation. It will also occasionally eat flowers, twigs, buds, seeds and shoots. Fruit makes up about a third of its diet.

Social system and reproduction

Troop size of the Mantled Guereza is usually 6-9, with one or more adult males. Its home range is about 40 acres (160,000 m2). This species has a preferred area within its home range from which other groups are chased, but not permanently excluded. Visual and vocal displays occur when groups meet, and loud nocturnal and dawn choruses by adult males serve to space out groups.

Single young born after a 5-month gestation, with offspring are produced about every 20 months. Young become fully mature in about 4-6 years. Their life span in captivity is upwards of 23 years.

Classification

There are several distinct subspecies of this colobus:[1]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 168. ISBN 0-801-88221-4. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100605. 
  2. ^ a b Kingdon, J., Struhsaker, T., Oates, J. F., Hart, J. & Groves, C. P. (2008). Colobus guereza. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Wolfheim, J.H. (1983) Primates Of The World: Distribution, Abundance And Conservation Routledge ISBN 3718601907
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!