Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Comprehensive Description

Dorylus (Anomma) nigricans Illiger subspecies arcens (Westwood) HNS

Eleven maxima and media workers from Medje (Lang and Chapin), taken from the stomach of a toad (Bufo funereus), are very dark, almost black, and are evidently referable to this subspecies, though the largest specimens are only about 10.5 mm. long, whereas the largest workers, according to Emery and Santschi, measure 13 mm. The surface of the body is very shining, the head more opaque in front.

  • Wheeler, W. M. (1922): The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45, 39-269: 46-46, URL:http://plazi.org:8080/dspace/handle/10199/17097
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Anomma arcens Westwood, 1847b: 16, pl. 1, fig. 3 (w.) LIBERIA. AntCat AntWiki

Taxonomic history

Combination in Dorylus (Anomma): Emery, 1895l PDF: 710.
Subspecies of Dorylus burmeisteri: Emery, 1892f PDF: 554.
Senior synonym of Dorylus pubescens: Emery, 1895l PDF: 710.
Currently subspecies of Dorylus nigricans: Emery, 1895l PDF: 710; Wheeler, 1922: 738.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1912:
  - J'ai recu de la Cote d'Ivoire (Lohier) toute une serie de cette belle race. Elle est bien caracterisee par sa couleur noire ou presque noire, la grande taille de ses soldats (13 mill.), la forme de la tete a cotes peu convexes et tres convergents en arriere. Les mandibules ont un arc plus etendu que chez les autres races, leur section au tiers externe est cylindrique comme chez burmeisteri mais relativement plus mince. Us correspondent exactement a la description de Westwood.
 

Wheeler, W. M., 1922:
 Eleven maxima and media workers from Medje (Lang and Chapin), taken from the stomach of a toad (Bufo funereus), are very dark, almost black, and are evidently referable to this subspecies, though the largest specimens are only about 10.5 mm. long, whereas the largest workers, according to Emery and Santschi, measure 13 mm. The surface of the body is very shining, the head more opaque in front.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eleven maxima and media workers from Medje (Lang and Chapin), taken from the stomach of a toad (Bufo funereus), are very dark, almost black, and are evidently referable to this subspecies, though the largest specimens are only about 10.5 mm. long, whereas the largest workers, according to Emery and Santschi, measure 13 mm. The surface of the body is very shining, the head more opaque in front.

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- J'ai recu de la Cote d'Ivoire (Lohier) toute une serie de cette belle race. Elle est bien caracterisee par sa couleur noire ou presque noire, la grande taille de ses soldats (13 mill.), la forme de la tete a cotes peu convexes et tres convergents en arriere. Les mandibules ont un arc plus etendu que chez les autres races, leur section au tiers externe est cylindrique comme chez burmeisteri mais relativement plus mince. Us correspondent exactement a la description de Westwood.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus arcens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGAATTCTAGGATCTTCAATAAGAATAATTATTCGTTTAGAGTTAGGAACATGTGGAACAATAATTTTTAAT---GATCAAGTTTTTAATGTTATTGTTACTAGACACGCTTTTATCATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGATTCGGTAATTTTATCGCACCTTTAATGATTGGGGCTCCTGACATGGCTTACCCTCGAATGAATAATATAAGATTTTGGTTATTACCCCCTTCAATTACTTTAATAATCATAAGAAATTTTATTAATACAGGTTCCGGAACTGGGTGAACAGTGTACCCACCGTTAGCTTCAAATATTTACCATAACGGGGCATCAATTGACCTAACTATTTTCTCATTACATATCGCAGGAATATCATCAATTTTAGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAAAATCTAACTATAGATAAAACTCCATTATTTGTTTGATCTATTTTAATTACAGCTATTCTTTTATTGCTCTCATTGCCAGTTTTAGCAGGAGCAATTACTATATTATTAACTGATGGTAATATTAATACATCATTTTTTTACCCATCAGGAGGTGGAGACCCTATTCTTTATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus arcens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!