Overview

Distribution

Range Description

This species occurs in north-east Africa. It is principally found in Ethiopia, although its range extends from the Red Sea Hills and Suakin (Sudan) through Eritrea and Djibouti (especially in the Goda Mountains) to northern Somalia. It is also found in the Red Sea Hills in the south-west Arabian Peninsula opposite the Horn of Africa. Historically, its range extended into Egypt, but not into recent times (i.e., post 1500AD; see Osborn and Osbornová 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Papio hamadryas is found on the African continent in the area of the southern Red Sea, in Ethiopia, Somalia, and Eritrea. This species also occurs in the Palearctic region, in Saudi Arabia and Yemen. The latter populations often occur in close association with humans, and, although considered endemic to the region, were probably introduced there accidentally at some point during the height of the ancient Egyptian Empire.

This species is part of a complex of closely related African baboon species. We have an account of the whole genus under Papio.

Biogeographic Regions: palearctic (Introduced , Native ); ethiopian (Native )

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore: The Johns Hopkins University Press.
  • Groves, C. 2001. Primate Taxonomy. Washington, D.C.: Smithsonian Insitution Press.
  • Jolly, C. 1993. Species, subspecies, and baboon systematics. Pp. 67-107 in W Kimbel, L Martin, eds. Species, Species Concepts, and Primate Evolution. New York: Plenum Publishing.
  • Primate Info Net, 2002. "Primate Info Net" (On-line). Hamadryas Baboon (Papio hamadryas). Accessed July 14, 2003 at http://www.primate.wisc.edu/pin/factsheets/papio_hamadryas.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These monkeys are highly sexually dimorphic in size and pelage characters. Adult males weigh around 21.5 kg and females around 9.4 kg. Male pelage is basically grayish-brown in color, with the ventrum colored like the back or darker. Hairs on the cheeks are lighter, forming "whiskers" which grade into a very pronounced, bushy, silver-colored mane. The long back hairs are wavey. Females are a plain olive-brown color. The skin may be very colorful in some animals. In both males and females, the skin surrounding the ischial callosities is pink or bright red. Males have skin of a similar color on their muzzle and face, whereas females possess a muted, grayish-brown face. The tail is long, and curved, with a graceful arch at the base. The natal pelage is black, although this is lost by approximately six months of age, when it is replaced by an olive-brown coat like that of the adult female.

The head and body length has been reported as 610 to 762 mm, with the tail adding an additional 382 to 610 mm.

Range mass: 9.2 to 21.5 kg.

Range length: 610 to 762 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Average basal metabolic rate: 21.095 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits arid subdesert, steppe, hillsides, escarpments, and mountains bordering the Red Sea, generally at altitudes up to 1,500 m. However, it appears to be seasonally migratory in at least some parts of its range in Ethiopia, where bands may move up into neighbouring mountainous areas (up to 3,300 m in the Simien Mountains National Park) in the wet season. This species is dependent on water, and is never found far from water sources. It is an opportunistic omnivore, and seasonally important foods include grass, buds, invertebrates, and the fruits of desert plants (notably heglig Balanites and buffalo thorn Ziziphus). The basic social unit consists of one male and several females.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hamadryas baboons are found in subdesert, steppe, alpine grass meadows, plains, and shortgrass savannahs. Their distribution is limited by the availability of watering holes and appropriate sleeping rocks or cliffs. In parts of Ethiopia, they are found in agricultural areas and are considered crop pests.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; mountains

Other Habitat Features: suburban ; agricultural

  • Napier, J., P. Napier. 1985. The natural history of the primates. Cambridge, Massachusetts: The MIT Press.
  • Stammbach, E. 1987. Desert, forest, and montain baboons: Multilevel societies. Pp. 112-120 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Papio hamadryas is omnivorous. They have been known to eat a variety of foods, including, but not limited to: fruits, tree gums, insects, eggs, acacia seeds, acacia flowers, grass seeds, grass, rhizomes, corms, roots tubers, small vertebrates. Because of the aridity of their habitat, these baboons must subsist on whatever edible items they can find.

One feeding adaptation thought to be shared by all baboons is the ability to subsist on a relatively low quality diet. Baboons can subsist on grasses for extended periods of time. This allows them to exploit dry terrestrial habitats, like deserts, semideserts, steppes, and grasslands.

Animal Foods: birds; mammals; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: omnivore

  • Oates, J. 1987. Food distribution and foraging behavior. Pp. 197-209 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because hamadryas baboons are prey items, they form an important link in local food webs, making nutrients they obtain from plants and small animals available to larger animals. They dig for tubers, roots, rhizomes and corms, so it is likely that these animals help to aerate the soil where they forage. Also, it is likely that they play some role in dispersing seeds they eat.

Ecosystem Impact: disperses seeds; soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Natural predators have been virtually eliminated from most of the range of P. hamadryas. However, it is thought that the higher levels of social organization seen in hamadryas baboons are a response to past predation. Bands undoubtedly help the baboons to defend themselves against predators, by increasing the number of adult animals to ward off attacks. Because bands and clans tend to congregate at just before reaching watering locations, a place where predators are likely to hide, such a function seems plausible. Also, troops seem to be a side effect of the desire of these animals to sleep on elevated rocks or cliffs. On explanation for this sleeping arrangement is that it inhibits access of predators to the animals. The availability of sleeping sites appears to be the principle limitation on the range of these animals.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Papio hamadryas preys on:
Arthropoda
Insecta
Reptilia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Papio hamadryas is prey of:
Aquila verreauxii
Panthera pardus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in all highly social species, communication is varied and complex. Hamadryas baboons utilize visual signals and gestures, vocalizations, and tactile communication. Visual signals include social presenting, in which a females or juveniles display their hind quarters to the male. This submissive signal differs from sexual presenting (which females do to elicit copulation) in that the hindquarters are much lower to the ground. Staring is a threat behavior, the effect of which is enhanced by the differently colored fur in the region of the eye which is revealed when the baboon stares. The mouth may be opened during this type of staring, although the canine teeth typically remain covered. Bobbing the head up and down is also considered a threatening behavior among hamadryas baboons. Canine teeth are displayed by a tension yawn, as another threatening gesture. This last behavior is performed only by males toward their rivals or toward predators.

Teeth chattering and lipsmacking, although not technically vocalizations, are auditory cues of reassurance, often performed by a dominant animal when another is presenting to him. Vocalizations made by these animals include a two-phase bark, or "wahoo" call, which adult males direct toward feline predators or toward other males. It is thought to communicate the presence of the male and his arousal. All hamadryas baboons, except infants, make rhythmic grunting vocalizations when approaching another animal to signal affiliative intentions. A shrill bark is produced by all except adult males to indicate alarm, especially due to sudden disturbances.

Although chemical communication has not been reported for these animals, anubis baboon females are known to produce aliphatic acids when they are sexually receptive. These acids are thought to enhance a female’s sexual attractiveness. It is possible that similar olfactory cues may exist in P. hamadryas.

As in all primates, P. hamadryas can spend a significant amount of time engaged in social grooming. Social grooming is thought to help develop and maintain social bonds between animals. Within hamadryas baboons, most social grooming is performed by females and is directed toward the leader of the OMU. Other forms of tactile communication in this species include reassuring touches and embraces, as well as a variety of agonistic bites and slaps.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum lifespan of a captive hamadryas baboon is measured at 37.6 years. It is likely that the maximum is slightly lower in the wild

Range lifespan

Status: captivity:
37.6 (high) years.

Average lifespan

Sex: male

Status: captivity:
37.5 years.

Average lifespan

Status: captivity:
35.6 years.

Average lifespan

Status: wild:
37.0 years.

Average lifespan

Status: captivity:
28.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.5 years (captivity) Observations: There are different subspecies of baboons, all with similar life-history parameters and a gradual ageing phenotype. Baboons have been shown both in captivity and in the wild to age about twice as fast as humans (Bronikowski et al. 2002). The IMR was estimated at age 5. One captive chacma baboon has been reported to live 45 years in captivity (Ronald Nowak 1999), but this has not been confirmed. One male hamadryas baboon lived 37.5 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The basic social and reproductive unit in hamadryas baboons is the one male unit (OMU). Within this OMU, there is a single adult male who mates with one or more females.

Reproductive behavior in P. hamadryas is closely tied to social organization. The basic breeding unit is the OMU, in which the leader male aggressively herds females, keeping them from straggling during the foraging march, and preventing them from socializing with other males. Females typically spend most of their social time in proximity to the leader male. Most social grooming within the OMU is focused on the leader male, with females grooming him, especially his mane, face, and buttocks. The pelage characters of males can therefore be thought of as strong mate attractants, and seem to function in the maintenance of the OMU.

Because of the division into OMUs, most females have only opportunities to mate with the OMU leader. However, males may follow a number of reproductive strategies, and females may at times "sneak" copulations with males other than their unit leader.

For males without an OMU, reproductive behavior is limited, and effort seems to be expended in attempts to establish an OMU. Establishment of an OMU can occur in one of two ways. First, a subadult male may attach himself to an already established OMU as a follower. In general, a follower male remains separated from the females of the OMU, although he travels with the OMU on the daily foraging march, and sleeps near the OMU at night. There may be some potential for such follower males to mate with females, if such copulations can be conducted without detection by the leader of the OMU. Evidence for such copulations comes from the pattern of testicular development in this species, as well as a limited number of observations of such "trysts." However, the principle goal of followers seems to be to either steal females from the OMU leader, having become familiar to these females through association with the OMU, or to depose the OMU leader and commandeer his entire harem of females.

Because OMU leaders actively restrict the interactions between their females and other males, chasing, biting, or otherwise punishing females who appear to be straying, one might wonder why a female would risk incurring his wrath by engaging in copulations with other males. One might speculate that such interactions might confuse paternity if there is a turnover in leadership of the OMU, and thereby inhibit tendencies toward infanticidal behavior on the part of the new leader male.

In general, hamadryas males "respect" the social bond between other males and their female affiliates. However, rarely within a band, there is intense physical competition between males. This seems to be associated with turnover of male OMU leaders.

The second strategy utilized by males to establish a OMU is to "adopt" a juvenile or subadult female. This strategy entails much less risk to the male, because there is no overt competition for the female in question. The male will care for the little female, grooming her, carrying her if necessary, and providing what would appear to many to be parental care. When the female reaches reproductive maturity, he will breed with her. This strategy seems especially effective because females hamadryas baboons do not readily consort with single males. Once a male has established a OMU with his "adopted" female, he may become much more attractive to other females.

Females exercise some choice in their mates. Females typically disperse from their natal group between 1.5 and 3.5 years of age. About 70% of females will change affiliation to a new OMU within a period of 3 years, often choosing to join OMUs that contain other females with whom they are already familiar. Through this type of transfer, it is possible for females to maintain bonds with one another throughout their lives.

Mating System: polygynous

Hamadryas baboons breed aseasonally. Mating is based on the occurence of estrus in females, and the reproductive condition of females is generally independent of season. However, Kummer (1968) did report a peak of births in May/June and November/December.

Females characteristically have an estrous cycle of 31 to 35 days in length. There is a noticeable menstrual flow for approximately three days per cycle if the female does not conceive. During the period around ovulation, the perineal skin of the female swells, alerting the male to her potentially fertile condition. During mating, there is generally a pattern of serial mounting initiated by the female, who presents her hindquarters to the male. The male mounts the female and thrusts several times. This mounting is followed by other mount/thrust episodes until the male ejaculates. Mating frequencies can be from 7 to 12.2 per hour while the female is receptive.

Gestation lasts about 172 days, after which the female gives birth to a single offspring. The neonate, weighing from 600 to 900 g, has a black coat, making it readily identifiable from older infants. Infants are completely dependent upon their mother for the first few months, until they begin to eat solid food and are able to walk on their own.

Puberty occurs between the ages of 4.8 and 6.8 years in males, and around the age of 4.3 years in females. Full size is attained in males around 10.3 years of age. Females, which are significantly smaller than males, reach adult size around 6.1 years of age.

Puberty in males is a lengthy process, and the timing of different developmental events reveals interesting details about the reproduction of these animals. Testicular development does not closely follow male growth in this species. Testes develop rapidly between the ages of 3.8 and 6 years, reaching full size prior to attainment of full adult body size. In contrast, body mass doubles between the ages of 7 and 8 years, after the testicles are fully developed. This pattern of development may indicate that subadult males, who do not possess OMUs of their own, may yet achieve some "sneak" copulations. Interestingly, the remainder of adult male secondary sexual characteristics, including the silver mane, white cheeks, and pink hindquarters, do not develop until after full adult size is reached. These characteristics are thought to function in the maintenance of the OMU, as they are very attractive to the females of the OMU and elicit large amounts of female grooming.

Females have an average interbirth interval of 24 months, although individual females have been known to have offspring as close together as 12 months. Some females have not given birth until 36 months after the birth of their previous offspring. It is likely, that as in anubis baboons, differences between females in the length of the interbirth interval are related to differences in nutritional status or social stress levels.

The average length of lactation is 239 days, but the timing of weaning may vary according to maternal condition, ecological variables, and social circumstances. Lactation can last from 6 to 15 months. The period of infant dependence is difficult to assess. Because this species is social, juveniles may continue to associate with their mothers until they disperse at or near adulthood. Also, because young females may be "kidnapped" by males wishing to establish an OMU, it is even more difficult to assess whether or not these individuals could survive without the quazi-parental care provided by the kidnapping male. In short, it would be reasonable to put the upper limit of the period of juvenile dependence at the mean interbirth interval (24 months), but to realize that this type of estimation is imprecise.

Breeding interval: Male hamadryas baboons can breed continuously, if females in their OMU are in reproductive condition. Females can produce offspring annually, but are more likely to produce an offspring every two years.annually

Breeding season: Hamadryas baboons are not seasonal breeders, and can mate throughout the year, provided females are in estrus.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Average gestation period: 172 days.

Range weaning age: 6 to 15 months.

Average time to independence: 24 months.

Average age at sexual or reproductive maturity (female): 4.3 years.

Range age at sexual or reproductive maturity (male): 4.8 to 6.8 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 814 g.

Average gestation period: 171 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
1514 days.

Most parental behavior is performed by the female. Females nurse and groom their offspring. There does not seem to be cooperative care of offspring among females, although it is not uncommon for one female in an OMU to groom the offspring of another female. As is the case for all baboons, infants are very attractive to other members of the social group, and are the focus of a great deal of investigation and attention, especially while they are still displaying their black natal coat.

Females can experience deceptive estrous cycles when a new male takes control of the OMU. This may be an adaptive parental behavior with an anti-infanticidal effect.

Males offer protection to infants by keeping control of the OMU. Males exclude other males from contact with their females and offspring, potentially inhibiting infanticide. Also, adult males maintain vigilance over the group, and are therefore likely to spot potential predators, protecting their offspring from that particular threat. Males are typically very tolerant of infants and juveniles within the OMU, and will often play with them or carry them.

The caretaking behavior of males toward to juvenile females during the formation of an OMU is quazi parental. Although from the perspective of the male this behavior is reproductive, it is parental from the perspective of the juvenile female. She obtains food, protection, warmth, and is often carried by the male, much as she would be by her own father or mother.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore: The Johns Hopkins University Press.
  • Kummer, H. 1968. Social Organisation of Hamdryas Baboons. A Field Study. Basel and Chicago: Karger, and University Press.
  • Jolly, C., J. Phillips-Conroy. 2003. Testicular size, mating system, and maturation schedules in wild anubis and hamadryas baboons. International Journal of Primatology, 24/1: 125-142.
  • Zinner, D., T. Deschner. 2000. Sexual swellings in female hamadryas baboons after male take-overs: "Deceptive" swellings as a possible female counter-strategy against infanticideticide. American Journal of Primatology, 52: 157-168.
  • Bercovitch, F. 1987. Female weight and reproductive condition in a population of olive baboons (Papio anubis). American Journal of Primatology, 12: 189-195.
  • Jolly, C. 1993. Species, subspecies, and baboon systematics. Pp. 67-107 in W Kimbel, L Martin, eds. Species, Species Concepts, and Primate Evolution. New York: Plenum Publishing.
  • Swedell, L. 2002. Affiliation among females in wild hamadryas baboons (Papio hamadryas hamadryas). International Journal of Primatology, 23/6: 1205-1225.
  • Nicolson, N. 1987. Infants, mothers, and other females. Pp. 330-342 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
  • Walters, J. 1987. Transition to Adulthood. Pp. 358-369 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
  • Whitten, P. 1987. Infants and adult males. Pp. 343-357 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
  • Stammbach, E. 1987. Desert, forest, and montain baboons: Multilevel societies. Pp. 112-120 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
  • Hrdy, S., P. Whitten. 1987. Patterning of sexual activity. Pp. 370-384 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago PRess.
  • Primate Info Net, 2002. "Primate Info Net" (On-line). Hamadryas Baboon (Papio hamadryas). Accessed July 14, 2003 at http://www.primate.wisc.edu/pin/factsheets/papio_hamadryas.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papio hamadryas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCTCATCAATCGTTGGCTGTTTTCAACAAACCACAAAGACATTGGAACTTTATACCTGTTATTTGGTGCATGAGCCGGAGTTACAGGCATGGCCCTAAGTCTTCTCATTCGAGCCGAACTGGGTCAACCCGGTAACCTACTAGGCAATGATCACATCTACAACGTCATTGTAACGGCCCATGCGTTCGTCATAATCTTTTTCATGGTTATACCTATTATAATCGGGGGTTTCGGAAATTGATTAGTGCCTCTAATAATTGGCGCTCCTGATATAGCATTCCCCCGTTTAAACAACATAAGTTTCTGACTCCTTCCCCCCTCTTTCCTACTACTAATAGCATCAACCGCAGTAGAAGCCGGTGCTGGGACAGGTTGAACAGTGTATCCTCCTTTGTCAGGGAACTTTTCCCACCCAGGGGCCTCCGTAGACCTAGTCATCTTCTCTCTTCACCTAGCGGGCATTTCCTCCATCCTAGGAGCCATCAACTTCATTACCACTATCATCAACATAAAACCCCCTGCAATATCCCAGTATCAAACCCCTTTATTTGTCTGATCAATCTTAATTACAGCAGTCCTCCTACTTCTCTCCCTACCAGTCCTAGCCGCCGGCATCACTATACTACTAACAGATCGCAATCTCAATACTACTTTCTTCGACCCTGTCGGAGGAGGGGACCCTATTCTATACCAACACCTATTTTGATTCTTCGGCCACCCCGAAGTTTACATCCTCATTCTCCCCGGGTTCGGAATAATTTCTCACATCGTAACCCACTACTCTGGAAAAAAAGAGCCGTTCGGGTATATAGGTATAGTCTGAGCTATAATATCAATCGGTTTCCTAGGCTTTATTGTGTGGGCCCATCATATGTTTACAGTAGGCATGGACGTAGACACACGAGCCTACTTTACTTCTGCCACCATAATTATTGCAATCCCTACGGGCGTTAAAGTTTTCAGCTGACTTGCCACACTCCACGGGGGCAACATTAAATGATCCCCTGCAATACTCTGAGCCCTAGGCTTTATTTTTCTATTCACCATGGGGGGCCTGACCGGCATTATCCTGGCAAACTCATCTCTAGACATTGTACTACACGACACATACTACGTCGTTGCCCACTTCCACTATGTTTTATCGATAGGAGCCGTCTTTGCCATTATGGGAGGCTTTATCCACTGATTCCCCCTATTTTCAGGTTATACATTAGACCAAACTTGCGCTAAAGCCCACTTTATTATTACATTCATGGGTGTAAACCTAACCTTTTTCCCACAACATTTCCTGGGCCTATCCGGAATACCCCGACGCTACTCCGACTACCCCGATGCCTATACCACATGAAATATCCTATCATCTATGGGTTCCTTTATTTCACTAACAGCAACAATCCTGATAATCTATATAATCTGGGAAGCTTTTGCCTCAAAACGCAAAGTACTACTAACCGAACACCCCTCCACTAGCCTAGAATGATTAAATGGATGTCCCCCACCCCACCACACATTTGAAGAACCAGCCTATATTAAACTAAGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papio hamadryas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gippoliti, S. & Ehardt, T.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Least Concern as this species is widespread and abundant, and there are no major range-wide threats believed to be resulting in a significant decline.

History
  • 1996
    Lower Risk/near threatened
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1988
    Rare
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN lists P. hamadryas as lower risk/ near threatened. These primates are threatened by habitat loss, harvesting for food and for research, as well as outright persecution. CITES does not list Papio on any appendix.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant, with the majority of the population in Ethiopia, and may even have increased because of loss of predators and small-scale agriculture. Kunzel et al. (2000) estimated the total population in Djibouti at around 2,000 animals, and that the population was stable.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major range-wide threats at present, although locally it may be at risk through loss of habitat due to major agricultural expansion and irrigation projects. In addition, adult males are hunted for their skins (which are used to embellish ceremonial cloaks in Ethiopia). They were formerly trapped in large numbers for medical research.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed under Appendix II of CITES, and is classed as Vermin in the African Convention along with all other species of baboon. A 'pure' subpopulation of this species is found in the Simien Mountains National Park, while P. hamadryas-P. anubis hybrids occur in the Awash National Park. In addition, the species occurs in the proposed Yangudi Rassa National Park, the Harar Wildlife Sanctuary, and a number of Wildlife Reserves in the lower Awash valley and in northern Eritrea (although it is important to note that the Awash reserves are all affected by agricultural schemes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hamadryas baboons are common in irrigated agricultural areas and can be terrible crop pests. They are large animals which can be aggressive when confronted.

Negative Impacts: injures humans (bites or stings); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hamadryas baboons are very interersting animals, and provide a great deal of entertainment to people who visit them in zoos. There are also populations of hamadryas baboons, especially on the Arabian peninsula, which attract visitors and tourists to view them. Some of these animals have been used in medical research.

Positive Impacts: research and education

  • Williams-Blangero, S., J. Vandenberg, J. Blangero, L. Konigsberg, B. Dyke. 1990. Genetic differentiation between baboon subspecies: Relevance for biomedical research. American Journal of Primatology, 20: 67-81.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hamadryas baboon

The hamadryas baboon (Papio hamadryas) is a species of baboon from the Old World monkey family. It is the northernmost of all the baboons, being native to the Horn of Africa and the southwestern tip of the Arabian Peninsula. These regions provide habitats with the advantage for this species of fewer natural predators than central or southern Africa where other baboons reside. The hamadryas baboon was a sacred animal to the ancient Egyptians and appears in various roles in ancient Egyptian religion, hence its alternative name of 'sacred baboon'.

Contents

Physical description [edit]

Males and females are distinguished by their differences in size and color.

Apart from the striking size difference between the sexes (males are often twice as large as females), which is common to all baboons, this species also shows sexual dimorphism in coloration. The fur of males is silver-white in color and they have a pronounced cape (mane and mantle) which they develop around the age of ten, while the females are capeless and brown. Their faces range in color from red to tan to a dark brown.

Males may have a body measurement of up to 80 cm (31 in) and weigh 20–30 kg (44–66 lb); females weigh 10–15 kg (22–33 lb) and have a body length of 40–45 cm (16–18 in).[4] The tail adds a further 40–60 cm (16–24 in) to the length, and ends in a small tuft. Infants are dark in coloration and lighten after about one year. Hamadryas baboons reach sexual maturity at about 51 mo for females and between 57 and 81 mo for males.[5]

Ecology [edit]

The hamadryas baboon eats fruit in captivity, although it is not a regular part of its diet in the wild.

The baboon's range extends from the Red Sea in Eritrea to Ethiopia, Djibouti and Somalia. Baboons are also native to and live in southwestern Arabia, in both Yemen and Saudi Arabia.[2] The Hamadryas baboon lives in semi-desert areas, savannas and rocky areas, requiring cliffs for sleeping and finding water. The hamadryas baboon is omnivorous and is adapted to its relatively dry habitat. During the wet seasons, the baboon feeds on a variety of foods, including blossoms, seeds, grasses, wild roots, and leaves from acacia trees.[6] During the dry season, the baboons eat leaves of the Dobera glabra and sisal leaves. Hamadryas baboon also eat insects, reptiles and small mammals. One was even observed carrying a dead dik dik.[7]

The baboons’ drinking activities also depend on the season. During the wet seasons, the baboons do not have to go far to find pools of water. During the dry seasons, they frequent up to three permanent waterholes.[7] Baboons will take siestas at the waterholes during midafternoon. Hamadryas baboons will also dig drinking holes only a short distance from natural waterholes.[7]

Social life [edit]

Group organization [edit]

Hamadryas harems together

The baboon has an unusual four-level social system called a multilevel society. Most social interaction occurs within small groups called one-male units or harems containing one male and up to ten females which the males lead and guard. A harem will typically include a younger "follower" male who may be related to the leader.[7][8][9] Two or more harems unite repeatedly to form clans.[10] Within clans, the dominant males of the units are probably close relatives of one another and have an age-related dominance hierarchy.[11][12] Bands are the next level. Two to four clans form bands of up to 200 individuals which usually travel and sleep as a group.[7][8][12] Both males and females rarely leave their bands. The dominant males will prevent infants and juveniles from interacting with infants and juveniles from other bands. Bands may fight with one another over food, etc., and the adult male leaders of the units are usually the combatants.[7][9] Bands also contain solitary males that are not harem leaders or followers and move freely within the band. Several bands may come together to form a troop. Several bands in a troop also often share a cliff-face where they sleep.[7][8][12]

Group behavior [edit]

The hamadryas baboon is unusual among baboon and macaque species in that its society is strictly patriarchal.[13] The males limit the movements of the females, herding them with visual threats and grabbing or biting any that wander too far away.[14] Males will sometimes raid harems for females, resulting in aggressive fights. Some males succeed in taking a female from another's harem, called a "takeover".[8][14][15] Visual threats are usually accompanied by these aggressive fights. This would include a quick flashing of the eyelids accompanied by a yawn to show off the teeth. As in many species, infant baboons are taken by the males as hostages during fights. However, males within the same clan tend to be related and respect the social bonds of their kin.[9] In addition, females demonstrate definite preferences for certain males, and rival males heed these preferences.[16] The less a female favors her harem males, the more likely she will be successfully taken by a rival.[16] Young males, often "follower" males, may start their own harems by maneuvering immature females into following them.[16] The male may also abduct a young female by force.[16] Either way, the male will mate with the female when she matures. Aging males often lose their females to followers and soon lose weight and their hair color changes to brown like a female.[16] While males in most other baboon species are transferred away from their male relatives and into different troops, male hamadryas baboons remain in their natal clans or bands and have associations with their male kin.[7][9]

Hamadryas males with female and young

Hamadryas baboons have traditionally been thought of having a female transfer society with females being moved away from their relatives of the same sex.[11] However, later studies show female baboons retain close associations with their female kin throughout their lives.[13] Females can spend about as much time with other females as they do with the harem males, and some females will even interact with each other outside of their harems.[13] In addition, it is not uncommon for females of the same natal group to end up in the same harem. The males likely restrict female bonding in hamadryas baboons rather than ecological factors.[13] Females can still associate and help their extended families despite their interactions being controlled by the harem males.[13]

Females within a harem do not display any dominance relationships as seen in other many other baboon and macaque species. The harem males suppress aggression between the females and prevent any dominance hierarchies from arising.[7][9] Despite this, some social differences between the females occur. Some females are more socially active and have a stronger social bond with the harem male. These females, known as the "central females", stay in closer proximity to the harem male then the other females.[9] Females that spend most their time farther from the harem male are called "peripheral females".[9]

Reproduction and parenting [edit]

Female baboons carrying their "younglings"

Like other baboons, the hamadryas baboon breeds aseasonally. The dominant male of a one-male unit does most of the mating, though other males may occasionally sneak in copulations, as well.[7][9][11][17] Females do most of the parenting. They nurse and groom the infant and one female in a unit may groom an infant that is not hers. Like all baboons, hamadryas baboons are intrigued by their infants and give much attention to them. Dominant male baboons prevent other males from coming into close contact with their infants. They also protect the young from predators. The dominant male tolerates the young and will carry and play with them.[7] When a new male takes over a female, she develops sexual swellings which may be an adaptation that functions to prevent the new male from killing the offspring of the previous male.[18] When males reach puberty, they show interest in mothering young infants.[7] They will kidnap the infants by luring them away from their harems and inviting them to ride on their backs. This is more often done by "follower" males. This kidnapping can lead to dehydration or starvation for the infant.[15] The harem leader would retrieve the infants from their kidnappers, which is mostly an act to protect their offspring.[15]

Human interaction [edit]

Depiction of a hamadryas baboon as the god Thoth (circa 1400 BC), in the British Museum

Cultural depictions [edit]

Hamadryas baboons often appear in ancient Egyptian art, as they were considered sacred to Thoth,[19] a major and powerful deity with many roles that included being the scribe of the gods. Astennu, attendant to Thoth, is represented as a hamadryas in his roles as recorder of the result of the Weighing of the Heart and as one of the four hamadryas baboons guarding the lake of fire in Duat, the ancient Egyptian underworld. A pre-dynastic precursor to Astennu was Babi, or 'Bull of the Baboons', a bloodthirsty god said to eat the entrails of the unrighteous dead. Babi was also said to give the righteous dead continued virility, and to use his penis as the mast of a boat to convey them to the Egyptian paradise.

Sometimes Thoth himself appears in the form of a hamadryas (often shown carrying the moon on his head), as an alternative to his more common representation as an ibis-headed figure. Hapi, one of the Four Sons of Horus that guarded the organs of the deceased in ancient Egyptian religion, is also represented as hamadryas-headed: Hapi protected the lungs, hence the common sculpting of a stone or clay hamadryas head as the lid of the canopic jar that held the lungs and/or represented the protection of the lungs. Hamadryas baboons were revered because certain behaviors that they perform were seen as worshiping the sun.[19]

Status and conservation [edit]

Transformation of field and pastureland represents the main threat to the hamadryas baboon; their natural predators (the leopard and the lion) have been nearly exterminated in their range. The IUCN listed this species as "least concern" in 2008.[2] There are no major range-wide threats at present, although locally it may be at risk through loss of habitat due to major agricultural expansion and irrigation projects.[2] The species occurs in the proposed Yangudi Rassa National Park, the Harar Wildlife Sanctuary, and a number of wildlife reserves in the lower Awash valley and in northern Eritrea.[2]

References [edit]

  1. ^ Groves, C. P. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 166–167. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b c d e Gippoliti, S. & Ehardt, T. (2008). Papio hamadryas. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Linnaeus, Carl (1758). Systema naturæ. Regnum animale. (10 ed.). p. 27. Retrieved 19 November 2012. 
  4. ^ "Sacred Baboon (Papio hamadryas)". World Association of Zoos and Acquariums. Retrieved July 2011. 
  5. ^ Rowe, Noel. The Pictorial Guide to Living Primates, Pogonias Press (Charlestown, Rhode Island: 1996)
  6. ^ Swedell 2002:b
  7. ^ a b c d e f g h i j k l Kummer, 1968
  8. ^ a b c d Swedell 2006
  9. ^ a b c d e f g h Stammbach, 1987
  10. ^ Schreier and Swedell 2009
  11. ^ a b c Sigg and Stolba et al. 1982
  12. ^ a b c Abegglen, 1984
  13. ^ a b c d e Swedell 2002
  14. ^ a b Swedell and Schreier 2009
  15. ^ a b c Swedell and Tesfaye
  16. ^ a b c d e Kummer 2001
  17. ^ Swedell and Saunders 2006
  18. ^ Zinner, D., T. Deschner, 2000.
  19. ^ a b The Baboons and Monkeys of Ancient Egypt Royce Hiller, Tour Egypt.net

General Sources [edit]

  • Kummer, H. (1968) Social Organisation of Hamdryas Baboons. A Field Study. Basel and Chicago: Karger, and University Press.
  • Sigg, H, Stolba, A, Abegglen, J. -J. and Dasser, V. (1982) "Life history of hamadryas baboons: Physical development, infant mortality, reproductive parameters and family relationships". Primates, 23(4): 473-487.
  • Abegglen J. J. (1984) On Socialization in Hamadryas Baboons. Blackwell University Press.
  • Stammbach, E. (1987) "Desert, forest, and mountain baboons: Multilevel societies". pp. 112–120 in Primate societies. B. Smuts, D. Cheney, R. Seyfarth, R. Wrangham. University of Chicago Press.
  • Zinner, D., T. Deschner. (2000) "Sexual swellings in female hamadryas baboons after male take-overs: 'Deceptive' swellings as a possible female counter-strategy against infanticideticide". American Journal of Primatology, 52(4): 157-168.
  • Kummer, H. "A Male Dominated Society: The Hamadryas Baboon of Cone Rock, Ethiopia.", pg 376-377 of The Encyclopedia of Mammals, 2nd edition (2001) MacDonald, D. (ed) Oxford University Press.
  • Swedell L (2002) "Affiliation among females in wild hamadryas baboons (Papio hamadryas hamadryas)". International Journal of Primatology 23(6): 1205-1226.
  • Swedell, L.(2002):b "Ranging Behavior, Group Size and Behavioral Flexibility in Ethiopian Hamadryas Baboons (Papio hamadryas hamadryas)". Folia Primotal., 73:95-103.
  • Swedell L, Tesfaye T (2003) "Infant Mortality After Takeovers in Wild Ethiopian Hamadryas Baboons". American Journal of Primatology 60(3): 113-118.
  • Swedell, L. 2006. Strategies of Sex and Survival in Hamadryas Baboons: Through a Female Lens. Pearson Prentice Hall.
  • Swedell L, Saunders J (2006) "Infant Mortality, Paternity Certainty, and Female Reproductive Strategies in Hamadryas Baboons". In Reproduction and Fitness in Baboons: Behavioral, Ecological, and Life History Perspectives (Swedell L, Leigh SR, eds), pp 19–51. New York, Springer.
  • Schreier A, Swedell L (2009) "The Fourth Level of Social Structure in a Multi-Level Society: Ecological and Social Functions of Clans in Hamadryas Baboons", American Journal of Primatology 71(11): 1-8.
  • Swedell L, Schreier A (2009) "Male aggression towards females in hamadryas baboons: Conditioning, coercion, and control". In: Sexual Coercion in Primates and Humans: An Evolutionary Perspective on Male Aggression Against Females (Muller MN, Wrangham RW, eds), pp 244–268. Cambridge, MA, Harvard University Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!