Overview

Brief Summary

Biology

Koalas are primarily nocturnal, spending most of their time in the branches of trees where they can feed, rest and gain some protection from ground-dwelling predators (6). Much of a koala's time is spent sleeping, and when awake they are still a fairly sedentary species. An adult consumes about 500g of fresh leaves per day (3). Koalas feed on a variety of trees, but the bulk of their diet comes from only a few eucalypt species (6), with marked local and regional differences for the species of eucalypts preferred (5). Eucalyptus leaves are very fibrous and highly toxic, but koalas have evolved to cope with these problems with special cheek teeth that grind the leaves into a fine paste, which is then digested by microbes in the caecum part of the intestine which is unusually long, at around 200cm, and has a blind end, unlike the caecum in most other mammals. Some of the poisons are detoxified in the liver. The diet does not provide much energy, but the long periods spent sleeping, along with their relatively small brains, help compensate for this (3). There is also evidence that suggests koalas may perform myrecism - regurgitating and re-chewing partially digested food, which extracts more energy from the food (7). Both males and females reach sexual maturity at around two years old, but males are rarely large enough to compete for mating access until four years old. Females normally give birth to one young every year but in older females this may reduce to one every two years. The newborn 'joey' is underdeveloped and crawls rapidly through the mother's fur to her pouch, where it suckles for six months. During weaning, in addition to milk, the joey feeds on a substance called 'pap' which is a liquefied form of the mother's faeces and provides the joey's digestive system with the micro-organisms necessary for digesting the eucalyptus leaves (4). Having first left the pouch during this time, the joey rides on its mother's belly, and later rides on her back. It normally remains with its mother until the following year's joey has emerged from the pouch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Koalas are bear-like in appearance, with a stout body and large paws, but are in fact marsupials, not bears. Their fur is predominantly grey to light brown, being lighter and shorter in the warmer north of their range, where the koalas are also smaller (3). The chin, chest and insides of the ears and forelimbs are white, with white speckling on the rump and long white hairs edging the large, round ears. Koalas are adapted to life spent mainly in the trees, with a vestigial tail, and unusually long forelimbs in relation to their hind limbs, and specially adapted paws to aid in gripping and climbing. They have large claws and rough pads on their paws. The first and second digits of the front paws, as well as the first digits of the hind paws, are opposed to the others, like thumbs, to help to grip branches. The first digit of each hind paw has no claw, and the second and third digits are partially fused together to form a grooming claw for removing ticks (5). Males are larger and heavier than females, with a broader face. Mature males are distinguishable from females as they have a brown gland on their chests that produces scent used to mark trees within the territory. Being marsupials, the females have a pouch with a backwards-facing opening and a strong, contracting ring-shaped muscle at the pouch opening which prevents the young from falling out (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Koala was formerly common throughout the broad band of forests and woodlands dominated by Eucalyptus spp. extending from north Queensland to the south-eastern corner of mainland South Australia, Australia (Maxwell et al. 1996). It currently ranges from northeastern, central, and southeastern Queensland with patchy populations in western areas, to eastern New South Wales including the coastal strip and highlands of the Great Dividing Range, the western plains and related riparian environments where suitable habitat occurs, Victoria, and southeastern South Australia. The geographic range has contracted significantly due to loss of large areas of habitat since European settlement. In Queensland, extent of occurrence and area of occupancy have contracted by about 30% (Gordon et al. 2006).

It has been introduced to at least 12 islands including: Kangaroo (South Australia, 450,000 ha), French (Victoria, 17,470 ha), Phillip (Victoria, 10,116 ha), and Magnetic (Queensland, 5,200 ha) (Abbott and Burbidge 1995). It has also been introduced within the mainland in the Adelaide Region and along the Murray River (Maxwell et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The koalas live in eastern Australia and range from northern Queensland to southwestern Victoria. They have been introduced to western Australia and nearby islands (LPZ, 1997).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Populations exist in a band down the eastern and southern coasts and inland areas of Queensland, New South Wales, Victoria and South Australia, as well as on islands off Queensland, Victoria and South Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Koalas from the southern end of the range are generally larger in size than their northern counterparts. In both areas they exhibit sexual dimorphism with the males being larger. In the south, males have an average head-body length of 78 cm and females 72 cm (MacDonald, 1984). The koala's have a vestigial tail. Average weights are: in the south, males--11.8 kg, females--7.9 kg; in the north, males--6.5 kg, females 5.1 kg (MacDonald, 1984) "Males are up to 50% heavier than females, have a broader face, somewhat smaller ears, and a large chest gland (MacDonald, 1984)." Females have two mammae; and rather than a chest gland, have a pouch that opens to the rear and extends upward and forward (Nowak, 1997). Koalas have dense, wooly fur that is gray to brown on top and varies with geographic location. There is white on the chin, chest and inner side of the forelimbs(MacDonald, 1984). The rump is often dappled with white patches and the ears are fringed with long white hairs (MacDonald, 1984). The coat is generally shorther and lighter in the north of range. The paws are large, and both fore and hind feet have five strongly clawed digits. On the forepaw the first and second digits oppose the other three which enables the koala to grip branches as it climbs. The first digit of the hind foot is short and greatly broadened while the second and third digits are relatively small and partly syndactylous but have separate claws (Nowak, 1997).

Range mass: 5.1 to 11.8 kg.

Average basal metabolic rate: 5.744 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Koalas occupy forests and woodlands where there are acceptable food trees. They are largely nocturnal and feed almost exclusively on eucalypts, but preferred food tree species vary with locality and there are quite distinct regional preferences (Martin et al. 2008). They are able to persist in fragmented habitats, and even survive in isolated trees across a predominantly agricultural landscape. Females reach sexual maturity at two years of age and usually give birth to a single young per year. Individual Koalas have been known to live up to 18 years in the wild, but most live between 10 and 14 years (Martin et al. 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koalas are arboreal, remaining mostly in the branches of the eucalyptus trees, where they are able to feed and stay out of reach of their predators. The koala is confined to eucalyptus forests below 600 m.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koalas live in eucalypt forests and woodlands, from cool-temperate to tropical areas (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Koalas are herbivorous feeding on both eucalypt and non-eucalypt species. However the bulk of their diet comes from only a few eucalypt species. Eucalyptus viminalis and E. ovata are preferred in the south, while E. punctata, E. camaldulensis and E. tereticornis are the taste of the north (MacDonald, 1984). The leaves are highly toxic; the animals get around this by having a flora of bacteria in their stomachs that metabolize the toxins of the leaves. Koalas have a highly specialized diet in which they eat only 20 of the 350 species of eucalyptus and prefer only 5 species. They feed at night. An adult koala can eat 500g daily. The koala has adapted to cope with its high fiber, low protein diet. "The cheek teeth are reduced to a single premolar and four broad, highly cusped molars on each jaw which finely grind the leaves for easier digestion (MacDonald, 1984)." In addition the koala's caecum is up to four times its body size.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: wild:
17.0 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.1 years (captivity) Observations: In captivity, the koala may live up to 22.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females are sexually mature at two years of age. Males are fertile at two years but usually don't mate until they reach four simply because competition for females requires larger size. Females are seasonally polyestrous, with an estrous cycle of about 27-30 days, and usually breed once every year (Nowak, 1997). The gestation period is 25-35 days with births occurring in mid-summer (December-January). Litters generally consist of only one young but twins have been reported (Nowak, 1997). The young weigh less than 0.5 grams when born, and attach to one of the nipples in the pouch. Young have a pouch life of 5-7 months, feeding on milk or predigested leaves that are nontoxic, and are weaned at 6-12 months (Nowak, 1997). Toward the end of their pouch life the young feed regularly on material passed through the mother's digestive tract (Nowak, 1997). Once the young begins to feed on leaves growth is rapid. The young leaves the pouch after seven months and is carried about on the mother's back. By eleven month's of age the young is independent, but may continue to live close to the mother for a few months. Koalas may live past 10 years in the wild, and there have been reports of life spans over 20 years in captivity.

Average birth mass: 0.36 g.

Average gestation period: 31 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
646 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolarctos cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGCTGACTATTCTCAACCAATCACAAAGATATTGGTACTATATATATACTATTTGGCGCCTGAGCTGGAATAGTAGGTACGGCCCTCAGCCTGTTAATCCGCATGGAACTTGGCCAACCAGGAGCTTTAATTGAAGAT---GACCAAATCTATAACGTTATTGTAACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGTGGCTTTGGTAACTGACTAGTACCACTAATAATCGGCGCCCCTGATATAGCATTTCCACGAATAAACAATATAAGCTTCTGACTACTTCCACCATCTTTTCTATTACTACTAGCATCTTCCACAGTAGAAGCTGGTGCAGGAACTGGATGGACAGTATACCCCCCACTAGCCAGCAATCTAGCCCATGCCGGGGCATCAGTAGACTTAGCAATTTTCTCCCTACATCTTGCAGGTATTTCCTCTATCCTAGGTGCTATCAACTTTATCACTACAATCATTAACATAAAACCACCAGCCTTATCTCAATATCAAATCCCATTATTTGTTTGATCAGTAATAATCACAGCAGTACTACTTCTCCTATCTCTTCCAATCTTAGCAGCAGGAATTACTATACTATTGACTGACCGCAACTTAAATACAACTTTTTTTGACCCAACTGGCGGAGGCGATCCTATTTTATACCAACACCTATTCTGATTTTTTGGTCACCCAGAAGTTTACATCTTAATCTTACCTGGGTTTGGCATAATCTCACACATTGTAACCTTCTATTCAGGAAAAAAAGAACCATTCGGCTATATAGGTATAGTCTGAGCAATAATATCCATTGGATTCCTAGGATTTATCGTATGAGCCCATCACATATTTACAGTAGGACTAGATGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phascolarctos cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gordon, G., Menkhorst, P., Robinson, T., Lunney, D., Martin, R. & Ellis, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. This is a high profile species that varies greatly in population size and density across its range, and requires intensive management in areas where it is considered a pest species, as well as in those regions where it is known to be in decline.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 05/09/2000
Lead Region: Foreign (Region 10) 
Where Listed: Australia


Population detail:

Population location: Australia
Listing status: T

For most current information and documents related to the conservation status and management of Phascolarctos cinereus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The koala holds no special status although the Environment Australia Biodiversity Group calls the koala lower risk--near threatened (1996). Koalas were nearly exterminated at the turn of the century because they were hunted for their fur, and because their environments were destroyed by fires caused by humans. After1927 as a result of public outcry the koala became legally protected. Currently their main threat is habitat destruction. Management of the koala can be difficult. Populations that are protected can reach such high numbers in an area that they destroy the trees on which they feed. Often portions of populations have to be relocated in order to reduce the number of individuals in a given area. However, this is complicated by the shortage of suitable forest areas where surplus animals can be released (MacDonald, 1984).

They are also threatened by the microorganism Chlamydia psittaci, which can make them sterile.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk - near threatened (LR/nt) on the IUCN Red List 2003 (1). Listed as Vulnerable in the southeast Queensland bioregion under the Nature Conservation Act 1992 and as Common in the rest of the state. Classified as Vulnerable under the New South Wales Threatened Species Conservation Act 1995. Victoria has no official listing and in South Australia, koalas are listed as Rare (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Koalas are uncommon and patchily distributed in most of their Queensland range, but are common in south-eastern Queensland. Queensland populations have persisted where habitat occurs, although fluctuating markedly in size (Gordon and Hrdina 2005; Gordon et al. 2006). They are widespread and common in Victoria. In New South Wales, they are known to be common in the Pilliga (the species' stronghold is along the north coast), but they are uncommon elsewhere. All South Australian populations became extinct by 1920, and current populations have been introduced outside their original range with the exception of the extreme south-east of the state. The introduced populations have expanded and caused severe environmental damage on Kangaroo Island (current population estimates on Kangaroo Island are of 28,000 ? these animals are highly inbred, resulting from a very small original source population of 10 animals). The Koala was listed in the 2001 State of the Environment report of the Commonwealth as one of the eight pest species of Australia.

While remaining populations are widely distributed, habitat fragmentation and modification has resulted in an increased prevalence of predation, in addition to geographic and genetic isolation (Maxwell et al. 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Current threats to this species include continued habitat destruction, fragmentation, and modification (which makes them vulnerable to predation by dogs, vehicle strikes, and other factors), bushfires, and disease, as well as drought associated mortality in habitat fragments. Public concern for the species is high. There are management problems with many populations; remnant populations living at high densities in isolated patches of habitat are at greatest risk (Martin et al. 2008). Effective management of some of the threats on the mainland could lead to excessive abundance and result in pest problems similar to those occurring on Kangaroo Island and in parts of Victoria.

The overall distribution of Koalas has been reduced since European settlement. This decline was primarily due to disease, bushfires, and widespread habitat destruction in the early decades of the 20th century. Commercial harvesting also took place across the range towards the end of the 19th century and early 20th century (huge numbers, running into the millions, were killed for their pelts for a large export industry in Victoria, New South Wales, and Queensland). This was banned in Victoria in the 1890s, and it continued sporadically (and under regulation) in Queensland until 1927 (Hrdina and Gordon 2004). There is no evidence, however, that the early spate of commercial harvesting had any long-term impact on the overall population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate change is predicted to cause an increase in drought frequency and fires in many parts of Australia as a result of reduced rainfall levels, increased evaporation rates, and an overall temperature increase of about 1ºC by 2030, according to a CSIRO report (IUCN 2009). Increasing frequency and intensity of droughts or periods of extreme heat would force Koalas to descend from trees more frequently in search of water or new habitats. This would make them more vulnerable to wild and domestic predators, as well as to road traffic. Dispersing Koalas often have to cross main roads and come into contact with domestic animals. It is estimated that around 4,000 Koalas are killed each year by dogs and cars alone (IUCN 2009).

Koalas’ warm fur and thick skin enables them to endure cold conditions in southern Australia, but they do not cope well with extreme heat. Unlike most arboreal marsupials, Koalas do not use nest hollows, which contributes to their greater susceptibility to extreme temperatures and drought. Bushfires, which have already wiped out numerous populations of Koalas, are likely to increase in both frequency and severity with climate change. Koalas are particularly vulnerable to bushfires as their slow movement and tree-dwelling lifestyle makes it difficult for them to escape and their food supply can be destroyed (IUCN 2009).

Climate change is likely to have some less obvious negative impacts on Koalas as well. Atmospheric carbon dioxide concentrations globally have increased from 280 ppm to 387 ppm since the Industrial Revolution. Projections for 2050 suggest that carbon dioxide concentrations are likely to increase markedly to between 500 and 600 ppm, depending on future emissions scenarios (IUCN 2009). Increased carbon dioxide levels tend to result in faster plant growth, but also to reduce protein levels and increase tannin levels in plants’ leaves, making them less nutritious and more difficult to digest (Lawler et al. 1997). As carbon dioxide levels continue to rise, Koalas and other browsers will need to cope with increasingly nutrient-poor and tannin-rich leaves.

Given the altered chemical composition of their food plants, Koalas could meet their nutritional needs by spending more time feeding and thus eating more. However, there is a limit to how much Koalas can increase the size of their guts. Furthermore, eating more leaves causes food to pass more quickly through the Koala’s digestive system, resulting in less thorough digestion and decreased nutrient uptake. Another possibility would be to exercise greater selectivity in tree and leaf choice (see Moore and Foley 2000, 2005; DeGabriel et al. 2009). Although Koalas could be more selective in their food selection, however, this would require more travel time to find the best trees and Koalas travelling in search of food are at an increased risk of predation and road accidents. Furthermore, the nutritional demands of breeding female koalas are higher than those of non-breeding individuals, raising the possibility that even if nonbreeding individuals were able to sustain themselves when faced with less nutritious food options than they have today, failure of breeding females to meet their nutrition needs could nevertheless lead to widespread reproductive failure and population declines (IUCN 2009).

Reports of large population declines in the first years of this century have prompted reassessments of the Koala’s threat status by the Australian government (IUCN 2009). In addition to factors related to climate change, other major factors contributing to Koala declines include disease and habitat destruction. The primary disease threat is from chlamydia, a widespread sexually-transmitted disease that causes blindness, pneumonia, and urinary and reproductive tract infections and death in Koalas. Habitat loss is also a major problem. Destruction and degradation of Koala habitat is particularly prevalent in the coastal regions of Australia, where urban development is rapidly encroaching on eucalyptus forests. In addition, habitat fragmentation limits Koalas’ ability to disperse to suitable areas and can intensify inbreeding problems (IUCN 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chlamydia bacterium), death by road traffic and predation by dog. Recently there has been a lot of attention in the media suggesting that koalas in some isolated patches of habitat have been the cause of defoliation of eucalyptus trees, resulting in calls for a cull of the koalas in these areas. That the koalas are to blame is a contentious issue amongst scientists and authorities and there is evidence to suggest that several other factors may be the cause (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in numerous protected areas. Recommended actions for the species (Maxwell et al. 1996; Martin and Handasyde 1999; Gordon pers. comm.) include: complete and implement National Strategy for Conservation of the Koala (currently in draft form); develop appropriate PVA models applicable to the diversity of habitat types utilised by the species; conduct regional and local surveys of distribution, assessment of tree preferences and identification of key critical habitat areas for conservation; formulate and implement detailed regional management plans for the conservation of these populations; manage populations to prevent over-browsing at some sites in Victoria and South Australia; develop positive community involvement in Koala conservation and management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Although koalas are a protected species, their numbers have markedly decreased due to habitat loss, and many populations are now living in isolated patches of habitat, putting them at greater risk of localised extinctions. Remaining koala habitat is mostly on privately-owned land so landowners have a responsibility to conserve them. As an important step in its aim to achieve national species-specific legislation that would effectively protect koala habitat over all of the koala's range, in July 2004 the Australian Koala Foundation submitted a nomination to the Australian Government, supported by a large amount of scientific data, to list the koala as Vulnerable nationally as a matter of urgency. To date this has not been achieved. Without legislation that encourages landowners, through incentives, to protect habitat on their land, there are fears koala numbers will decline to such an extent that populations will be incapable of ever recovering (5). Legislation, along with continued research and monitoring, will be necessary to prevent this Australian icon from further declining as a result of competing land use pressures (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

none noted

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the early 20th century the koala was hunted extensively for its warm, thick coat. However, they are now protected and can no longer be hunted.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Koala

For other uses, see Koala (disambiguation).

The koala (Phascolarctos cinereus or, inaccurately, koala bear[a]) is an arboreal herbivorous marsupial native to Australia. It is the only extant representative of the family Phascolarctidae, and its closest living relatives are the wombats.[3] The koala is found in coastal areas of the mainland's eastern and southern regions, inhabiting Queensland, New South Wales, Victoria and South Australia. It is easily recognisable by its stout, tailless body; round, fluffy ears; and large, spoon-shaped nose. The koala has a body length of 60–85 cm (24–33 in) and weighs 4–15 kg (9–33 lb). Pelage colour ranges from silver grey to chocolate brown. Koalas from the northern populations are typically smaller and lighter in colour than their counterparts further south. It is possible that these populations are separate subspecies, but this is disputed.

Koalas typically inhabit open eucalypt woodlands, and the leaves of these trees make up most of their diet. Because this eucalypt diet has limited nutritional and caloric content, koalas are largely sedentary and sleep for up to 20 hours a day. They are asocial animals, and bonding exists only between mothers and dependent offspring. Adult males communicate with loud bellows that intimidate rivals and attract mates. Males mark their presence with secretions from scent glands located on their chests. Being marsupials, koalas give birth to underdeveloped young that crawl into their mothers' pouches, where they stay for the first six to seven months of their life. These young koalas are known as joeys, and are fully weaned at around a year. Koalas have few natural predators and parasites but are threatened by various pathogens, like Chlamydiaceae bacteria and the koala retrovirus, as well as by bushfires and droughts.

Koalas were hunted by indigenous Australians and depicted in myths and cave art for millennia. The first recorded encounter between a European and a koala was in 1798, and an image of the animal was published in 1810 by naturalist George Perry. Botanist Robert Brown wrote the first detailed scientific description of the koala in 1814, although his work remained unpublished for 180 years. Popular artist John Gould illustrated and described the koala, introducing the species to the general British public. Further details about the animal's biology were revealed in the 19th century by several English scientists. Because of its distinctive appearance, the koala is recognised worldwide as a symbol of Australia. Koalas are listed as of Least Concern by the International Union for Conservation of Nature. The Australian government lists populations in Queensland and New South Wales as Vulnerable. The animal was hunted heavily in the early 20th century for its fur, and large-scale cullings in Queensland resulted in a public outcry that initiated a movement to protect the species. Sanctuaries were established, and translocation efforts moved to new regions koalas whose habitat had become fragmented or reduced. The biggest threat to their existence is habitat destruction caused by agriculture and urbanisation.

Etymology[edit]

The word koala comes from the Dharug gula. Although the vowel 'u' was originally written in the English orthography as "oo" (in spellings such as coola or koolah), it was changed to "oa", possibly in error. The word is mistakenly said to mean "doesn't drink".[4] Because of the koala's resemblance to a bear, it was often miscalled the koala bear, particularly by early settlers.[5] Other names like monkey bear, native bear, and tree-bear have also been used.[4] Indigenous names include cullawine, koolawong, colah, karbor, colo, coolbun, boorabee, burroor, bangaroo, pucawan, banjorah, and burrenbong; many of these mean "no drink".[6] The generic name, Phascolarctos, is derived from the Greek words phaskolos "pouch" and arktos "bear". The specific name, cinereus, is Latin for "ash coloured".[7]

Taxonomy and evolution[edit]





Peramelidae



Dasyuridae



Dromiciops



Diprotodontia

"possums"

Petauroidea



Phalangeroidea





H. moschatus




Potoroinae



Macropodinae





Vombatiformes

P. cinereus




T. carnifex




Ngapakaldia




Diprotodontidae

D. optatum




Z. trilobus



N. lavarackorum





M. williamsi




I. illumidens



Vombatidae











Phylogeny of Diprotodontia, (with outgroup)[8]

The koala was given its generic name Phascolarctos in 1816 by French zoologist Henri Marie Ducrotay de Blainville,[9] who would not give it a specific name until further review. In 1819, German zoologist Georg August Goldfuss gave it the binomial Lipurus cinereus. Because Phascolarctos was published first, according to the International Code of Zoological Nomenclature, it has priority as the official name of the genus.[10] French naturalist Anselme Gaëtan Desmarest proposed the name Phascolartos fuscus in 1820, suggesting that the brown-coloured versions were a different species than the grey ones. Other names suggested by European authors included Marodactylus cinereus by Goldfuss in 1820, P. flindersii by René Primevère Lesson in 1827, and P. koala by John Edward Gray in 1827.[2]

The koala is classified with wombats (family Vombatidae) and several extinct families (including marsupial tapirs, marsupial lions and giant wombats) in the suborder Vombatiformes within the order Diprotodontia.[11] Vombatiformes is a sister group to a clade that includes macropods (kangaroos and wallabies) and possums.[12] The ancestors of vombatiforms were likely arboreal,[8] and the koala's lineage was possibly the first to branch off around 40 million years ago during the Eocene.[13]

The modern koala is the only extant member of Phascolarctidae, a family that once included several genera and species. During the Oligocene and Miocene, koalas lived in rainforests and had less specialised diets.[14] Some species, such as the Riversleigh rainforest koala (Nimiokoala greystanesi) and some species of Perikoala, were around the same size as the modern koala, while others, such as species of Litokoala, were one-half to two-thirds its size.[15] Like the modern species, prehistoric koalas had well developed ear structures which suggests that long-distance vocalising developed early.[14] During the Miocene, the Australian continent began drying out, leading to the decline of rainforests and the spread of open Eucalyptus woodlands. The genus Phascolarctos split from Litokoala in the late Miocene[14][16] and had several adaptations that allowed it to live on a specialised eucalyptus diet: a shifting of the palate towards the front of the skull; larger molars and premolars; smaller pterygoid fossa;[14] and a larger gap between the molar and the incisor teeth.[17]

During the Pliocene and Pleistocene, when Australia experienced changes in climate and vegetation, koala species grew larger.[15] Phascolarctos cinereus may have emerged as a dwarf form of the giant koala (P. stirtoni). The reduction in the size of large mammals has been seen as a common phenomenon worldwide during the late Pleistocene, and it is traditionally believed that several Australian mammals, such as the agile wallaby, resulted from this dwarfing. A 2008 study questions this hypothesis, noting that P. cinereus and P. stirtoni were sympatric during the middle to late Pleistocene, and possibly as early as the Pliocene.[18] The fossil record of the modern koala extends back at least to the middle Pleistocene.[19]

Genetics and variations[edit]

Traditionally, three different subspecies have been recognised: the Queensland koala (P. cinereus adustus, Thomas 1923), the New South Wales koala (P. c. cinereus, Goldfuss 1817) and the Victorian koala (P. c. victor, Troughton 1835). These forms are distinguished by pelage colour and thickness, body size and skull shape. The Queensland koala is the smallest of the three, with shorter, silver fur and a shorter skull. The Victorian koala is the largest, with shaggier, brown fur and a wider skull.[20][21] The boundaries of these variations are based on state borders, and their status as subspecies are disputed. A 1999 genetic study suggests that the variations represent differentiated populations with limited gene flow between them, and that the three subspecies comprise a single evolutionarily significant unit.[21] Other studies have found that koala populations have high levels of inbreeding and low genetic variation.[22][23] Such low genetic diversity may have been a characteristic of koala populations since the late Pleistocene.[24] Rivers and roads have been shown to limit gene flow and contribute to the genetic differentiation of southeast Queensland populations.[25] In April 2013, scientists from the Queensland University of Technology announced they had fully sequenced the koala genome.[26]

Description[edit]

Scratching and grooming

The koala is a stocky animal with a large head and vestigial or non-existent tail.[27][28] It has a body length of 60–85 cm (24–33 in) and a weight of 4–15 kg (9–33 lb),[28] making it among the largest arboreal marsupial.[29] Koalas from Victoria are twice as heavy as those from Queensland.[20] The species is sexually dimorphic, with males 50% larger than females. Males are further distinguished from females by their more curved noses[29] and the presence of chest glands, which are visible as hairless patches.[30] As in most marsupials, the male koala has a bifurcated penis, and the female has two lateral vaginas and two separate uteri.[27] The male's penile sheath contains naturally occurring bacteria that play an important role in fertilisation.[31] The female's pouch opening is tightened by a sphincter that keeps the young from falling out.[32]

The pelage of the koala is thicker and longer on the back, and shorter on the belly. The ears have thick fur on both the inside and outside.[29] The back fur colour varies from light grey to chocolate brown.[27] The belly fur is whitish; on the rump it is dappled whitish, and darker at the back.[28] The koala has the most effective insulating back fur of any marsupial and is highly resilient to wind and rain, while the belly fur can reflect solar radiation.[33] The koala's curved, sharp claws are well adapted for climbing trees. The large forepaws have two opposable digits (the first and second, which are opposable to the other three) that allow them to grasp small branches. On the hindpaws, the second and third digits are fused, a typical condition for members of Diprotodontia, and the attached claws (which are still separate) are used for grooming.[34] As in humans and other primates, koalas have friction ridges on their paws.[35] The animal has a sturdy skeleton and a short, muscular upper body with proportionately long upper limbs that contribute to its climbing and grasping abilities. Additional climbing strength is achieved with thigh muscles that attach to the shinbone lower than other animals.[36] The koala has a cartilaginous pad at the end of the spine that may make it more comfortable when it perches in the fork of a tree.[32]

Mounted skeleton

The koala has one of the smallest brains in proportion to body weight of any mammal,[37] being 60% smaller than that of a typical diprotodont. The brain's surface is fairly smooth, typical for a "primitive" animal.[38] It occupies only 61% of the cranial cavity[37] and is pressed against the inside surface by cerebrospinal fluid. The function of this relatively large amount of fluid is not known, although one possibility is that it acts as a shock absorber, cushioning the brain if the animal falls from a tree.[38] The koala's small brain size may be an adaptation to the energy restrictions imposed by its diet, which is insufficient to sustain a larger brain.[37] Because of its small brain, the koala has a limited ability to perform complex, unfamiliar behaviours. For example, when presented with plucked leaves on a flat surface, the animal cannot adapt to the change in its normal feeding routine and will not eat the leaves.[39] The koala's olfactory senses are normal, and it is known to sniff the oils of individual branchlets to assess their edibility.[37] Its nose is fairly large and covered in leathery skin. Its round ears provide it with good hearing[32] and it has a well-developed middle ear.[14] A koala's vision is not well developed,[32] and its relatively small eyes are unusual among marsupials in that the pupils have vertical slits.[29] Koalas make use of a novel vocal organ to produce low-pitched sounds (see social spacing, below). Unlike typical mammalian vocal cords, which are folds in the larynx, these organs are placed in the velum (soft palate) and are called velar vocal cords.[40]

Teeth of a koala, from left to right: molars, premolars (dark), diastema, canines, incisors

The koala has several adaptations for its eucalypt diet, which is of low nutritive value, of high toxicity and high in dietary fibre.[41] The animal's dentition consists of the incisors and cheek teeth (a single premolar and four molars on each jaw), which are separated by a large gap (a characteristic feature of herbivorous mammals). The incisors are used for grasping leaves, which are then passed to the premolars to be snipped at the petiole before being passed to the highly cusped molars, where they are shredded into small pieces.[42] Koalas may also store food in their cheek pouches before it is ready to be chewed.[43] The partially worn molars of middle-aged koalas are optimal for breaking the leaves into small particles, resulting in more efficient stomach digestion and nutrient absorption in the small intestine,[44] which digests the eucalyptus leaves to provide most of the animal's energy.[42] A koala sometimes regurgitates the food into the mouth to be chewed a second time.[45]

Unlike kangaroos and eucalyptus-eating possums, koalas are hindgut fermenters, and their digestive retention can last for up to 100 hours in the wild, or up to 200 hours in captivity.[42] This is made possible by the extraordinary length of their caecum—200 cm (80 in) long and 10 cm (4 in) in diameter—the largest proportionally of any animal.[46] Koalas can select which food particles to retain for longer fermentation and which to pass through. Large particles typically pass through more quickly, as they would take more time to digest.[42] While the hindgut is proportionally larger in the koala than in other herbivores, only 10% of the animal's energy is obtained from fermentation. Since the koala gains a low amount of energy from its diet, its metabolic rate is half that of a typical mammal,[41] although this can vary between seasons and sexes.[42] The koala conserves water by passing relatively dry faecal pellets high in undigested fibre, and by storing water in the caecum.[44]

Ecology and behaviour[edit]

Walking on ground

The koala's geographic range covers roughly 1,000,000 square kilometres (390,000 sq mi), and 30 ecoregions.[47] It extends throughout eastern and southeastern Australia, encompassing northeastern, central and southeastern Queensland, eastern New South Wales, Victoria and southeastern South Australia. The koala was introduced near Adelaide and on several islands, including Kangaroo Island and French Island.[1] The population on Magnetic Island represents the northern limit of its range.[47] Fossil evidence shows that the koala's range stretched as far west as southwestern Western Australia during the late Pleistocene. They were likely driven to extinction in these areas by environmental changes and hunting by indigenous Australians.[48]

In Queensland, koalas are unevenly distributed and uncommon except in the southeast, where they are numerous. In New South Wales, they are abundant only in Pilliga, while in Victoria they are common nearly everywhere. In South Australia, koalas were extirpated by 1920 and subsequently re-introduced.[1] Koalas can be found in habitats ranging from relatively open forests to woodlands, and in climates ranging from tropical to cool temperate.[29] In semi-arid climates, they prefer riparian habitats, where nearby streams and creeks provide refuge during times of drought and extreme heat.[49]

Foraging and activities[edit]

Foraging

Koalas are herbivorous, and while most of their diet consists of eucalypt leaves, they can be found in trees of other genera, such as Acacia, Allocasuarina, Callitris, Leptospermum and Melaleuca.[50] Although the foliage of over 600 species of Eucalyptus is available, the koala shows a strong preference for around 30.[51] They tend to choose species that have a high protein content and low proportions of fibre and lignin.[44] The most favoured species are Eucalyptus microcorys, E. tereticornis, and E. camaldulensis, which, on average, make up more than 20 percent of their diet.[52] Despite its reputation as a fussy eater, the koala is more generalist than some other marsupial species, like the greater glider. Since eucalypt leaves have a high water content, the koala does not need to drink often;[50] its daily water turnover rate ranges from 71 to 91 millilitres per kilogram of body weight. Although females can meet their water requirements from eating leaves, larger males require additional water found on the ground or in tree hollows.[44] When feeding, a koala holds onto a branch with hindpaws and one forepaw while the other forepaw grasps foliage. Small koalas can move close to the end of a branch, but larger ones stay near the thicker bases.[53] Koalas consume up to 400 grams (14 oz) of leaves a day, spread over four to six feeding sessions.[54] Despite their adaptations to a low-energy lifestyle, they have meagre fat reserves and need to feed often.[55]

Because they get so little energy from their diet, koalas must limit their energy use and sleep 20 hours a day;[56] only 4 minutes a day are spent in active movement.[57] They are predominantly active at night and spend most of their waking hours feeding. They typically eat and sleep in the same tree, possibly for as long as a day.[58] On very hot days a koala may climb down to the coolest part of the tree which is colder than the surrounding air. The koala will hug the tree to lose heat without panting. [59] On warm days, a koala may rest with its back against a branch or lie on its stomach or back with its limbs dangling.[56] During cold, wet periods, it curls itself into a tight ball to conserve energy.[58] On windy days, a koala will find a lower, thicker branch to rest on. While it spends most of the time in the tree, the animal will descend to the ground to move to another tree, walking on all fours.[56] The koala usually grooms itself with its hind paws, but sometimes uses its forepaws or mouth.[60]

Social spacing[edit]

Koala resting in tree between branch and stem
Resting
A bellowing male in the Lone Pine Koala Sanctuary

Koalas are asocial animals and spend just 15 minutes a day on social behaviours. In Victoria, home ranges are small and have extensive overlap, while in central Queensland they are larger and overlap less.[61] Koala society appears to consist of "residents" and "transients", the former being mostly adult females and the latter males. Resident males appear to be territorial and dominate others with their larger body size.[62] Alpha males tend to establish their territories close to breeding females, while younger males are subordinate until they mature and reach full size.[63] Adult males occasionally venture outside their home ranges; when they do so, dominant ones retain their status.[61] When a male enters a new tree, he marks it by rubbing his chest gland against the trunk or a branch; males have occasionally been observed to dribble urine on the trunk. This scent-marking behaviour probably serves as communication, and individuals are known to sniff the base of a tree before climbing.[64] Scent marking is common during aggressive encounters.[65] Chest gland secretions are complex chemical mixtures—about 40 compounds were identified in one analysis—that vary in composition and concentration with the season and the age of the individual.[66]

Adult males communicate with loud bellows—low pitched sounds that consist of snore-like inhalations and resonant exhalations that sound like growls.[67] It has been hypothesized that these sounds are generated by unique vocal organs found in koalas.[40] Because of their low frequency, these bellows can travel far through air and vegetation.[68] Koalas may bellow at any time of the year, particularly during the breeding season, when it serves to attract females and possibly intimidate other males.[69] They also bellow to advertise their presence to their neighbours when they enter a new tree.[68] These sounds signal the male's actual body size as well as exaggerate it;[70] females pay more attention to bellows that originate from larger males.[71] Female koalas bellow, though more softly, in addition to making snarls, wails and screams. These calls are produced when in distress and when making defensive threats.[67] Young koalas squeak when in distress. As they get older, the squeak develops into a "squawk" that is produced both when in distress and to show aggression. When another individual climbs over it, a koala makes a low grunt with its mouth closed. Koalas make numerous facial expressions. When snarling, wailing or squawking, the animal curls the upper lip and points its ears forward. During screams, the lips retract and the ears are drawn back. Females bring the lips forward and raise their ears when agitated.[72]

Agonistic behaviour typically consists of squabbles between individuals climbing over or passing each other. This occasionally involves biting. Males who are strangers may wrestle, chase and bite each other.[73] In extreme situations, a male may try to displace a smaller rival from a tree. This involves the larger aggressor climbing up and attempting to corner the victim, who tries either to rush past him and climb down or to move to the end of a branch. The aggressor attacks by grasping the target by the shoulders and repeatedly biting him. Once the weaker individual is driven away, the victor bellows and marks the tree.[74] Pregnant and lactating females are particularly aggressive and will attack individuals that come too close.[73] In general, however, koalas tend to avoid energy-wasting aggressive behaviour.[63]

Reproduction and development[edit]

Mother with joey on back

Koalas are seasonal breeders, and births take place from October to May. Females in oestrus tend to hold their head further back than usual and commonly display tremors and spasms. However, males do not appear to recognise these signs, and have been observed to mount non-oestrous females. Because of his much larger size, a male can usually force himself on a female, mounting her from behind, and in extreme cases the male may pull the female out of the tree. A female may scream and vigorously fight off her suitors, but will submit to one who is dominant, or who is more familiar. The bellows and screams that accompany matings can attract other males to the scene, obliging the incumbent to delay mating and fight the intruders off. These fights may allow the female to assess who is dominant.[75] Older males usually have accumulated scratches, scars and cuts on the exposed parts of their noses and on their eyelids.[76]

The koala has a gestation period lasting 33–35 days,[77] and gives birth to a single young (although twins occur on occasion). As with all marsupials, the young or joey is born while at the embryonic stage, weighing only 0.5 g (0.02 oz). However, it has relatively well-developed lips, forelimbs and shoulders, as well as functioning respiratory, digestive and urinary systems. The joey crawls into its mother's pouch to continue the rest of its development.[78] Unlike most other marsupials, the koala does not clean her pouch.[79]

A female koala has two teats; the joey attaches itself to one of them and suckles for the rest of its pouch life.[78] The koala has one of the lowest milk energy production rates in relation to body size of any mammal. The female makes up for this by lactating for as long as 12 months.[80] At seven weeks of age, the joey's head grows longer and becomes proportionally large, pigmentation begins to develop, and its sex can be determined (the scrotum appears in males and the pouch begins to develop in females). At 13 weeks, the joey weighs around 50 g (1.8 oz) and its head has doubled in size. The eyes begin to open and fine fur grows on the forehead, nape, shoulders and arms. At 26 weeks, the fully furred animal resembles an adult, and begins to poke its head out of the pouch.[81]

As the young koala approaches six months, the mother begins to prepare it for its eucalyptus diet by pre-digesting the leaves, producing a faecal pap that the joey eats from her cloacum. The pap is quite different in composition than regular faeces, resembling instead the contents of the caecum, which has a high concentration of bacteria. Eaten for about a month, the pap provides a supplementary source of protein at a transition time from a milk to a leaf diet.[82] The joey fully emerges from the pouch for the first time at six or seven months of age, when it weighs 300–500 g (11–18 oz). It explores its new surroundings cautiously, clinging to its mother for support. By nine months, it weighs over 1 kg (2.2 lb) and develops its adult fur colour. Having permanently left the pouch, it rides on its mother's back for transportation, learning to climb by grasping branches.[83] Gradually, it spends more time away from its mother and at 12 months it is fully weaned, weighing around 2.5 kg (5.5 lb). When the mother becomes pregnant again, her bond with her previous offspring is permanently severed. Newly weaned young are encouraged to disperse by their mother's aggressive behaviour towards them.[84]

A young joey, preserved at Port Macquarie Koala Hospital

Females become sexually mature at about three years of age and can then become pregnant; in comparison, males reach sexual maturity when they are about four years old,[85] although they can produce sperm as early as two years.[84] While the chest glands can be functional as early as 18 months of age, males do not begin scent-marking behaviours until they reach sexual maturity.[66] Because the offspring have a long dependent period, female koalas usually breed in alternate years. Favourable environmental factors, such as a plentiful supply of high-quality food trees, allow them to reproduce every year.[86]

Health and mortality[edit]

Koalas may live from 13 to 18 years in the wild. While female koalas usually live this long, males may die sooner because of their more hazardous life.[87] Koalas usually survive falls from trees and immediately climb back up, but injuries and deaths from falls do occur, particularly in inexperienced young and fighting males.[88] At around six years of age, the koala's chewing teeth begin to wear down and their chewing efficiency decreases. Eventually, the cusps will disappear completely and the animal will die of starvation.[89]

Koalas have few predators; dingos and large pythons may prey on them, while birds of prey (such as Powerful Owls and Wedge-tailed Eagles) are threats to young. They are generally not subject to external parasites, other than ticks in coastal areas. Koalas may also suffer mange from the mite Sarcoptes scabiei, and skin ulcers from the bacterium Mycobacterium ulcerans, but neither are common. Internal parasites are few and largely harmless.[88] These include the tapeworm Bertiella obesa, commonly found in the intestine, and the nematodes Marsupostrongylus longilarvatus and Durikainema phascolarcti, which are infrequently found in the lungs.[90] In a three-year study of almost 600 koalas admitted to the Australian Zoo Wildlife Hospital in Queensland, 73.8% of the animals were infected with at least one species of the parasitic protozoal genus Trypanosoma, the most common of which was T. irwini.[91]

Koalas can be subject to pathogens like Chlamydiaceae bacteria,[88] which can cause keratoconjunctivitis, urinary tract infection and reproductive tract infection.[92] Such infections are widespread on the mainland but absent in some island populations.[93] The koala retrovirus (KoRV) may cause Koala Immune Deficiency Syndrome (KIDS), which is similar to AIDS in humans. Prevalence of KoRV in koala populations suggests a trend spreading from the north to the south of Australia. Northern populations are completely infected, while some southern populations (including Kangaroo Island) are free.[94]

The animals are vulnerable to bushfires due to their slow movements and the flammability of eucalypt trees.[95] The koala instinctively seeks refuge in the higher branches, where it is vulnerable to intense heat and flames. Bushfires also fragment the animal's habitat, which restricts their movement and leads to population decline and loss of genetic diversity.[96] Dehydration and overheating can also prove fatal.[97] Consequently, the koala is vulnerable to the effects of climate change. Models of climate change in Australia predict warmer and drier climates, suggesting that the koala's range will shrink in the east and south to more mesic habitats.[98] Droughts also affect the koala's well-being. For example, a severe drought in 1980 caused many Eucalyptus trees to lose their leaves. Subsequently, 63% of the population in southwestern Queensland died, especially young animals that were excluded from prime feeding sites by older, dominant koalas, and recovery of the population was slow.[39] Later, this population declined from an estimated mean population of 59,000 in 1995 to 11,600 in 2009, a reduction attributed largely to hotter and drier conditions resulting from droughts in most years between 2002 and 2007.[99] Another predicted negative outcome of climate change is the effect of elevations in atmospheric CO
2
levels
on the koala's food supply: increases in CO
2
cause Eucalyptus trees to reduce protein and increase tannin concentrations in their leaves, reducing the quality of the food source.[100]

Human relations[edit]

History[edit]

George Perry's illustration in his 1810 Arcana was the first published image of the koala.

The first written reference of the koala was recorded by John Price, servant of John Hunter, the Governor of New South Wales. Price encountered the "cullawine" on 26 January 1798, during an expedition to the Blue Mountains,[101] although his account was not published until nearly a century later in Historical Records of Australia.[102] In 1802, French-born explorer Francis Louis Barrallier encountered the animal when his two Aboriginal guides, returning from a hunt, brought back two koala feet they were intending to eat. Barrallier preserved the appendages and sent them and his notes to Hunter's successor, Philip Gidley King, who forwarded them to Joseph Banks. Similar to Price, Barrallier's notes did not get published until 1897.[103] Reports of the "Koolah" appeared in the Sydney Gazette in late 1803, and helped provide the impetus for King to commission the artist John Lewin to paint watercolours of the animal. Lewin painted three pictures, one of which was subsequently made into a print that was reproduced in George Culver's The Animal Kingdom (first published in 1827) and several European works on natural history.[104]

Botanist Robert Brown was the first to write a detailed scientific description of the koala in 1814, based on a female specimen captured near what is now Mount Kembla in the Illawarra region of New South Wales. Austrian botanical illustrator Ferdinand Bauer drew the animal's skull, throat, feet and paws. Brown's work remained unpublished and largely unnoticed, however, as his field books and notes remained in his possession until his death, when they were bequeathed to the British Museum of Natural History. They were not identified until 1994, while Bauer's koala watercolours were not published until 1989.[105] British surgeon Everard Home included details of the koala based on eyewitness accounts of William Paterson, who had befriended Brown and Bauer during their stay in New South Wales.[106] Home, who in 1808 published his report in the journal Philosophical Transactions of the Royal Society,[107] gave the animal the scientific name Didelphis coola.[108]

The first published image of the koala appeared in George Perry's (1810) natural history work Arcana.[109] Perry called it the "New Holland Sloth" on account of its perceived similarities to the Central and South American tree-living mammals of genus Bradypus. His disdain for the koala, evident in his description of the animal, was typical of the prevailing early 19th-century British attitude about the primitiveness and oddity of Australian fauna:[110]

"... the eye is placed like that of the Sloth, very close to the mouth and nose, which gives it a clumsy awkward appearance, and void of elegance in the combination ... they have little either in their character or appearance to interest the Naturalist or Philosopher. As Nature however provides nothing in vain, we may suppose that even these torpid, senseless creatures are wisely intended to fill up one of the great links of the chain of animated nature ...".[111]

Natural history illustrator John Gould popularised the koala with his 1863 work The Mammals of Australia.

Naturalist and popular artist John Gould illustrated and described the koala in his three-volume work The Mammals of Australia (1845–63) and introduced the species, as well as other members of Australia's little-known faunal community, to the general British public.[112] Comparative anatomist Richard Owen, in a series of publications on the physiology and anatomy of Australian mammals, presented a paper on the anatomy of the koala to the Zoological Society of London.[113] In this widely cited publication he provided the first careful description of its internal anatomy, and noted its general structural similarity to the wombat.[114] English naturalist George Robert Waterhouse, curator of the Zoological Society of London, was the first to correctly classify the koala as a marsupial in the 1840s. He identified similarities between it and its fossil relatives Diprotodon and Nototherium, which had been discovered just a few years before.[115] Similarly, Gerard Krefft, curator of the Australian Museum, noted evolutionary mechanisms at work when comparing the koala to its ancestral relatives in his 1871 The Mammals of Australia.[116]

The first living koala in Britain arrived in 1881, purchased by the Zoological Society of London. As related by prosecutor to the society, William Alexander Forbes, the animal suffered an accidental demise when the heavy lid of a washstand fell on it and it was unable to free itself. Forbes used the opportunity to dissect the fresh female specimen, and thus was able to provide explicit anatomical details on the female reproductive system, the brain, and the liver—parts not previously described by Owen, who had access only to preserved specimens.[117] Scottish embryologist William Caldwell—well known in scientific circles for determining the reproductive mechanism of the platypus—described the uterine development of the koala in 1884,[118] and used the new information to convincingly place the koala and the monotremes into an evolutionary time frame.[119]

Prince Henry, Duke of Gloucester, visited the Koala Park Sanctuary in Sydney in 1934[120] and was "intensely interested in the bears". His photograph, with Noel Burnet, the founder of the park, and a koala, appeared in the Sydney Morning Herald. After World War II, when tourism to Australia increased and the animals were exported to zoos overseas, the koala's international popularity rose. Several political leaders and members of royal families had their pictures taken with koalas, including Queen Elizabeth II, Prince Harry, Crown Prince Naruhito, Crown Princess Masako, Pope John Paul II, US President Bill Clinton, Soviet premier Mikhail Gorbachev and South African President Nelson Mandela.[121]

Cultural significance[edit]

Koala souvenir soft toys
Koala souvenir soft toys are popular with tourists
Amy and Oliver the bronze koalas (by artist Glenys Lindsay)
Amy and Oliver the bronze koalas (by Glenys Lindsay)

The koala is well known worldwide and is a major draw for Australian zoos and wildlife parks. It has been featured in advertisements, games, cartoons and as soft toys.[122] It benefited the Australian tourism industry by over an estimated billion dollars in 1998, a figure that has since grown.[123] In 1997, half of visitors to Australia, especially those from Korea, Japan, and Taiwan, sought out zoos and wildlife parks; about 75 percent of European and Japanese tourists placed the koala at the top of their list of animals to see.[124] According to biologist Stephen Jackson: "If you were to take a straw poll of the animal most closely associated with Australia, it's a fair bet that the koala would come out marginally in front of the kangaroo".[122] Factors that contribute to the koala's enduring popularity include its childlike body proportions and teddy bear-like face.[125]

The koala is featured in the Dreamtime stories and mythology of indigenous Australians. The Tharawal people believed that the animal helped row the boat that brought them to the continent.[126] Another myth tells of how a tribe killed a koala and used its long intestines to create a bridge for people from other parts of the world. This narrative highlights the koala's status as a game animal and the length of its intestines.[127] Several stories tell of how the koala lost its tail. In one, a kangaroo cuts it off to punish the koala for being lazy and greedy.[128] Tribes in both Queensland and Victoria regarded the koala as a wise animal and sought its advice. Bidjara-speaking people credited the koala for turning barren lands into lush forests.[129] The animal is also depicted in rock carvings, though not as much as some other species.[130]

Early European settlers in Australia considered the koala to be a prowling sloth-like animal with a "fierce and menacing look".[131] At the beginning of the 20th century, the koala's reputation took a more positive turn, largely due to its growing popularity and depiction in several widely circulated children's stories.[132] It is featured in Ethel Pedley's 1899 book Dot and the Kangaroo, in which it is portrayed as the "funny native bear".[131] Artist Norman Lindsay depicted a more anthropomorphic koala in The Bulletin cartoons, starting in 1904. This character also appeared as Bunyip Bluegum in Lindsay's 1918 book The Magic Pudding.[133] Perhaps the most famous fictional koala is Blinky Bill. Created by Dorothy Wall in 1933, the character appeared in several books and has been the subject of films, TV series, merchandise and a 1986 environmental song by John Williamson.[134] The first Australian stamp featuring a koala was issued by the Commonwealth in 1930.[135] A television ad campaign for Australia's national airline Qantas, starting in 1967 and running for several decades, featured a live koala (voiced by Howard Morris), who complained that too many tourists were coming to Australia and concluded "I hate Qantas".[136] The series has been ranked among the greatest commercials of all time.[137]

The song "Ode to a Koala Bear" appears on the B-side of the 1983 Paul McCartney/Michael Jackson duet album Say Say Say.[134] A koala is the main character in Hanna-Barbera's The Kwicky Koala Show and Nippon Animation's Noozles, both of which were animated cartoons of the early 1980s. Food products shaped like the koala include the Caramello Koala chocolate bar and the bite-sized cookie snack Koala's March. Dadswells Bridge in Victoria features a tourist complex shaped like a giant koala,[121] and the Queensland Reds rugby team has a koala as its mascot.[138] The Platinum Koala coin features the animal on the reverse and Elizabeth II on the obverse.[139]

Conservation issues[edit]

In 2008, the International Union for Conservation of Nature listed the koala under Least Concern for the following reasons: "Its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category."[1] Australian policy makers declined a 2009 proposal to include the koala in the Environment Protection and Biodiversity Conservation Act 1999.[19] In 2012, the Australian Government listed koala populations in Queensland and New South Wales as Vulnerable, because of a 40% population decline in the former and a 33% decline in the latter. Populations in Victoria and South Australia appear to be abundant; however, the Australian Koala Foundation argues that the exclusion of Victorian populations from protective measures is based on a misconception that the total koala population is 200,000, whereas they believe it is probably less than 100,000.[140]

Koala skins were widely traded early in the twentieth century.

Koalas were hunted for food by Aboriginals. A common technique used to capture the animals was to attach a loop of ropey bark to the end of a long, thin pole, so as to form a noose. This would be used to snare an animal high in a tree, beyond the reach of a climbing hunter; an animal brought down this way would then be killed with a stone hand axe or hunting stick (waddy).[141] According to the customs of some tribes, it was considered taboo to skin the animal, while other tribes thought the animal's head had a special status, and saved them for burial.[142]

The koala was heavily hunted by European settlers in the early 20th century,[143] largely for its thick, soft fur. More than two million pelts are estimated to have left Australia by 1924. Pelts were in demand for use in rugs, coat linings, muffs, and as trimming on women's garments.[144] Extensive cullings occurred in Queensland in 1915, 1917, and again in 1919, when over one million koalas were killed with guns, poisons and nooses. The public outcry over these cullings was probably the first wide-scale environmental issue that rallied Australians. Novelist and social critic Vance Palmer, writing in a letter to the The Courier-Mail, expressed the popular sentiment:

"The shooting of our harmless and lovable native bear is nothing less than barbarous ... No one has ever accused him of spoiling the farmer's wheat, eating the squatter's grass, or even the spreading of the prickly pear. There is no social vice that can be put down to his account ... He affords no sport to the gun-man ... And he has been almost blotted out already from some areas."[145]

Despite the growing movement to protect native species, the poverty brought about by the drought of 1926–28 led to the killing of another 600,000 koalas during a one-month open season in August 1927.[146] In 1934, Frederick Lewis, the Chief Inspector of Game in Victoria, said that the once abundant animal had been brought to near extinction in that state, suggesting that only 500–1000 remained.[147]

Scent gland on the chest of an adult male - Lone Pine Koala Sanctuary

The first successful efforts at conserving the species were initiated by the establishment of Brisbane's Lone Pine Koala Sanctuary and Sydney's Koala Park Sanctuary in the 1920s and 1930s. The owner of the latter park, Noel Burnet, became the first to successfully breed koalas and earned a reputation as the foremost contemporary authority on the marsupial.[148] In 1934, David Fleay, curator of Australian mammals at the Melbourne Zoo, established the first Australian faunal enclosure at an Australian zoo, and featured the koala. This arrangement allowed him to undertake a detailed study of its diet in captivity. Fleay later continued his conservation efforts at Healesville Sanctuary and the David Fleay Wildlife Park.[149]

Since 1870, koalas have been introduced to several coastal and offshore islands, including Kangaroo Island and French Island. Their numbers have significantly increased,[150] and since the islands are not large enough to sustain such high koala numbers, overbrowsing has become a problem.[151] In the 1920s, Lewis initiated a program of large-scale relocation and rehabilitation programs to transfer koalas whose habitat had become fragmented or reduced to new regions, with the intent of eventually returning them to their former range. For example, in 1930–31, 165 koalas were translocated to Quail Island. After a period of population growth, and subsequent overbrowsing of gum trees on the island, about 1300 animals were released into mainland areas in 1944. The practice of translocating koalas became commonplace; Victorian State manager Peter Menkorst estimated that from 1923 to 2006, about 25,000 animals were translocated to more than 250 release sites across Victoria.[152] Since the 1990s, government agencies have tried to control their numbers by culling, but public and international outcry has forced the use of translocation and sterilisation instead.[153]

Road sign depicting a koala and a kangaroo

One of the biggest anthropogenic threats to the koala is habitat destruction and fragmentation. In coastal areas, the main cause of this is urbanisation, while in rural areas habitat is cleared for agriculture. Native forest trees are also taken down to be made into wood products.[154] In 2000, Australia ranked fifth in the world by deforestation rates, having cleared 564,800 hectares (1,396,000 acres).[155] The distribution of the koala has shrunk by more than 50% since European arrival, largely due to fragmentation of habitat in Queensland.[47] The koala's "vulnerable" status in Queensland and New South Wales means that developers in these states must consider the impacts on this species when making building applications.[140] In addition, koalas live in many protected areas.[1]

While urbanisation can pose a threat to koala populations, the animals can survive in urban areas provided there are enough trees.[156] Urban populations have distinct vulnerabilities: collisions with vehicles and attacks by domestic dogs kill about 4000 animals every year.[100] Injured koalas are often taken to wildlife hospitals and rehabilitation centres.[156] In a 30-year retrospective study performed at a New South Wales koala rehabilitation centre, it was found that trauma (usually resulting from a motor vehicle accident or dog attack) was the most frequent cause of admission, followed by symptoms of chlamydia infection.[157] Wildlife caretakers are issued with special permits but have to release the animals back into the wild when they are either well enough or, in the case of joeys, old enough. As with most native animals, the koala cannot legally be kept as a pet in Australia or anywhere else.[158]

See also[edit]

Notes[edit]

  1. ^ Koala bear is a common term outside of Australia, though koalas are marsupials, not bears.

References[edit]

  1. ^ a b c d e Gordon, G.; Menkhorst, P.; Robinson, T.; Lunney, D.; Martin, R.; Ellis, M. (2008). "'Phascolarctos cinereus'". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-03-08. 
  2. ^ a b Moyal, p. 45.
  3. ^ a b Groves, C. P. (2005). "Order Diprotodontia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 43. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ a b Dixon, R. M. W.; Moore, B.; Ramson, W. S.; Thomas, M. (2006). Australian Aboriginal Words in English: Their Origin and Meaning (2nd ed.). Oxford University Press. p. 65. ISBN 978-0-19-554073-4. 
  5. ^ Leitner, G.; Sieloff, I. (1998). "Aboriginal words and concepts in Australian English". World Englishes 17 (2): 153–69. doi:10.1111/1467-971X.00089. 
  6. ^ Donegan, J. (2000). "Unfair game: Queensland's open season on koalas in 1927". Access: History 3 (1): 35–50. 
  7. ^ Kidd, D. A. (1973). Collins Latin Gem Dictionary. Collins. p. 53. ISBN 978-0-00-458641-0. 
  8. ^ a b Weisbecker, V.; Archer, M. (2008). "Parallel evolution of hand anatomy in kangaroos and vombatiform marsupials: Functional and evolutionary implications". Palaeontology 51 (2): 321–38. doi:10.1111/j.1475-4983.2007.00750.x. 
  9. ^ de Blainville, H. (1816). "Prodrome d'une nouvelle distribution systématique du règne animal". Bulletin de la Société Philomáthique, Paris (in French) 8: 105–24. 
  10. ^ Jackson, pp. 58–59.
  11. ^ Long, J. A. (2002). Prehistoric Mammals of Australia and New Guinea: One Hundred Million Years of Evolution. Johns Hopkins University Press. pp. 77–82. ISBN 978-0-8018-7223-5. 
  12. ^ Asher, R.; Horovitz, I.; Sánchez-Villagra, M. (2004). "First combined cladistic analysis of marsupial mammal interrelationships". Molecular Phylogenetics and Evolution 33 (1): 240–50. doi:10.1016/j.ympev.2004.05.004. PMID 15324852. 
  13. ^ Beck, R. M. D. (2008). "A dated phylogeny of marsupials using a molecular supermatrix and multiple fossil constraints". Journal of Mammalogy 89 (1): 175–89. doi:10.1644/06-MAMM-A-437.1. 
  14. ^ a b c d e Louysa, J.; Aplin, K.; Beck, R. M. D.; Archer, M. (2009). "Cranial anatomy of Oligo-Miocene koalas (Diprotodontia: Phascolarctidae): Stages in the evolution of an extreme leaf-eating specialization". Journal of Vertebrate Paleontology 29 (4): 981–92. doi:10.1671/039.029.0412. 
  15. ^ a b Archer, M.; Arena, R.; Bassarova, M.; Black, K.; Brammall, J.; Cooke, B. M.; Creaser, P; Crosby, K.; Gillespie, A.; Godthelp, H.; Gott, M.; Hand, S. J.; Kear, B. P.; Krikmann, A.; Mackness, B.; Muirhead, J.; Musser, A.; Myers, T.; Pledge, N. S.; Wang, Y.; Wroe, S. (1999). "The evolutionary history and diversity of Australian mammals". Australian Mammalogy 21: 1–45. 
  16. ^ Black, K.; Archer, M.; Hand, S. J. (2012). "New Tertiary koala (Marsupialia, Phascolarctidae) from Riversleigh, Australia, with a revision of phascolarctid phylogenetics, paleoecology, and paleobiodiversity". Journal of Vertebrate Paleontology 32 (1): 125–38. doi:10.1080/02724634.2012.626825. 
  17. ^ Tyndale-Biscoe, p. 226.
  18. ^ Price, G. J. (2008). "Is the modern koala (Phascolarctos cinereus) a derived dwarf of a Pleistocene giant? Implications for testing megafauna extinction hypotheses". Quaternary Science Reviews 27 (27–28): 2516–21. doi:10.1016/j.quascirev.2008.08.026. 
  19. ^ a b Price, G. J. (2013). "Long-term trends in lineage 'health' of the Australian koala (Mammalia: Phascolarctidae): Using paleo-diversity to prioritize species for conservation". In Louys, J. (ed.). Paleontology in Ecology and Conservation. Springer Earth System Sciences. Springer. pp. 171–92. ISBN 978-3-642-25037-8. 
  20. ^ a b Martin and Handasyde, p. 7.
  21. ^ a b Houlden, B. A.; Costello, B. H.; Sharkey, D.; Fowler, E. V.; Melzer, A.; Ellis, W.; Carrick, F.; Baverstock, P. R.; Elphinstone, M. S. (1999). "Phylogeographic differentiation in the mitochondrial control region in the koala, Phascolarctos cinereus (Goldfuss 1817)". Molecular Ecology 8 (6): 999–1011. doi:10.1046/j.1365-294x.1999.00656.x. PMID 10434420. 
  22. ^ Houlden, B. A.; England, P. R.; Taylor A. C.; Greville, W. D.; Sherwin, W. B. (1996). "Low genetic variability of the koala Phascolarctos cinereus in south-eastern Australia following a severe population bottleneck". Molecular Ecology 52 (2): 269–81. PMID 8673272. 
  23. ^ Wilmer, J. M. W.; Melzer, A.; Carrick, F.; Moritz, C. (1993). "Low genetic diversity and inbreeding depression in Queensland Koalas". Wildlife Research 20 (2): 177–87. doi:10.1071/WR9930177. 
  24. ^ Tsangaras, K.; Ávila-Arcos, M. C.; Ishida, Y.; Helgen, K. M.; Roca, A. L.; Greenwood, A. D. (2012). "Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)". BMC Genetics 13: 92. doi:10.1186/1471-2156-13-92. PMC 3518249. PMID 23095716. 
  25. ^ Lee, K. E.; Seddon, J. M.; Corley, S.; Williams, E.; Johnston, S.; Villers, D.; Preece, H.; Carrick, F. (2010). "Genetic variation and structuring in the threatened koala populations of Southeast Queensland". Conservation Genetics 11 (6): 2091–103. doi:10.1007/s10592-009-9987-9. 
  26. ^ Davey, M. (10 April 2013). "Australians crack the code of koala's genetic blueprint". The Age. Retrieved 25 June 2013. 
  27. ^ a b c Jackson, pp. 1–4.
  28. ^ a b c Nowak, R. (2005). Walker's Marsupials of the World. Johns Hopkins University Press. pp. 135–36. ISBN 978-0-8018-8211-1. 
  29. ^ a b c d e Jackson, S. (2003). Australian Mammals: Biology and Captive Management. CSIRO Publishing. pp. 147–51. ISBN 978-0-643-06635-9. 
  30. ^ Martin and Handasyde, p. 55.
  31. ^ "UQ researchers unlock another koala secret". UQ News. University of Queensland. 9 May 2001. Retrieved 26 June 2013. 
  32. ^ a b c d "Physical Characteristics". Australian Koala Foundation. Retrieved 2 April 2013. 
  33. ^ Degabriele, R.; Dawson, T. J. (1979). "Metabolism and heat balance in an arboreal marsupial, the koala (Phascolarctos cinereus)". Journal of Comparative Physiology B 134 (4): 293–301. doi:10.1007/BF00709996. ISSN 1432-1351. 
  34. ^ Martin and Handasyde, p. 5.
  35. ^ Coppock, C. A. (2007). Contrast: An Investigator's Basic Reference Guide to Fingerprint Identification Concepts. Charles C Thomas Publisher. p. 21. ISBN 978-0-398-08514-8. 
  36. ^ Moyal, p. 183.
  37. ^ a b c d Jackson, p. 81.
  38. ^ a b Martin and Handasyde, p. 52.
  39. ^ a b Tyndale-Biscoe, p. 234.
  40. ^ a b Charlton, B. D.; Frey, R.; McKinnon, A. J.; Fritsch, G.; Fitch, W. T.; Reby, D. (2013). "Koalas use a novel vocal organ to produce unusually low-pitched mating calls". Current Biology 23 (23): R1035. doi:10.1016/j.cub.2013.10.069. [low-pitched voice explained by unique organ Lay summary] – ScienceDaily. 
  41. ^ a b Jackson, p. 76.
  42. ^ a b c d e Martin and Handasyde, pp. 46–49.
  43. ^ Lee, A. L.; Martin, R. W. (1988). The Koala: A Natural History. New South Wales University Press. p. 20. ISBN 978-0-86840-354-0. 
  44. ^ a b c d Tyndale-Biscoe, p. 231.
  45. ^ Logan, M. (2001). "Evidence for the occurrence of rumination-like behaviour, or merycism, in the koala (Phascolarctos cinereus, Goldfuss)". Journal of Zoology 255 (1): 83–87. doi:10.1017/S0952836901001121. 
  46. ^ Moyal, p. 188.
  47. ^ a b c McGregor, D. C.; Kerr, S. E.; Krockenberger, A. K. (2013). "The distribution and abundance of an island population of koalas (Phascolarctos cinereus) in the far north of their geographic range". In Festa-Bianchet, Marco. PLoS One 8 (3): e59713. doi:10.1371/journal.pone.0059713. PMC 3601071. 
  48. ^ Martin and Handasyde, pp. 12–13.
  49. ^ Smith, A. G.; McAlpine, C. A.; Rhodes, J. R.; Lunney, D.; Seabrook, L.; Baxter, G. (2013). "Out on a limb: Habitat use of a specialist folivore, the koala, at the edge of its range in a modified semi-arid landscape". Landscape Ecology 28 (3): 418–26. doi:10.1007/s10980-013-9846-4. 
  50. ^ a b Jackson, pp. 73–74.
  51. ^ Martin, R. (2001). "Koala". In Macdonald, D. Encyclopedia of Mammals (2nd ed.). Oxford University Press. pp. 852–54. ISBN 978-0-7607-1969-5. 
  52. ^ Osawa, R. (1993). "Dietary preferences of Koalas, Phascolarctos cinereus (Marsupiala: Phascolarctidae) for Eucalyptus spp. with a specific reference to their simple sugar contents". Australian Mammalogy 16 (1): 85–88. 
  53. ^ Jackson, p. 96.
  54. ^ Moyal, p. 187.
  55. ^ Moyal, p. 189.
  56. ^ a b c Jackson, pp. 93–94.
  57. ^ Grand, T. I.; Barboza, P. S. (2001). "Anatomy and development of the koala, Phascolarctos cinereus: An evolutionary perspective on the superfamily Vombatoidea". Anatomy and Embryology 203 (3): 211–23. doi:10.1007/s004290000153. PMID 11303907. 
  58. ^ a b Martin and Handasyde, p. 39.
  59. ^ Koalas hug trees to lose heat
  60. ^ Jackson, pp. 97–98.
  61. ^ a b Jackson, pp. 98–99.
  62. ^ Ellis, W. A.; Hale, P. T.; Carrick, F. (2002). "Breeding dynamics of koalas in open woodlands". Wildlife Research 29 (1): 19–25. doi:10.1071/WR01042. 
  63. ^ a b Moyal, p. 191.
  64. ^ Martin and Handasyde, pp. 54–56.
  65. ^ Smith, M. (1980). "Behaviour of the Koala, Phascolarctos cinereus (Goldfuss), in captivity IV. Scent-marking". Australian Wildlife Research 7 (1): 35–40. doi:10.1071/WR9800035. 
  66. ^ a b Tobey, J. R.; Nute, T. R.; Bercovitch, F. B. (2009). "Age and seasonal changes in the semiochemicals of the sternal gland secretions of male koalas (Phascolarctos cinereus)". Australian Journal of Zoology 57 (2): 111–18. doi:10.1071/ZO0809. 
  67. ^ a b Smith, M. (1980). "Behaviour of the Koala, Phascolarctos cinereus (Goldfuss), in captivity III*. Vocalisations". Australian Wildlife Research 7 (1): 13–34. doi:10.1071/WR9800013. 
  68. ^ a b Martin and Handasyde, pp. 56–58.
  69. ^ Ellis, W.; Bercovitch, F.; FitzGibbon, S.; Roe, P.; Wimmer, J.; Melzer, A.; Wilson, R. (2011). "Koala bellows and their association with the spatial dynamics of free-ranging koalas" (PDF). Behavioral Ecology 22 (2): 372–77. doi:10.1093/beheco/arq216. 
  70. ^ Charlton, B. D.; Ellis, W. A. H.; McKinnon, A. J.; Cowin, G. J.; Brumm, J.; Nilsson, K.; Fitch, W. T. (2011). "Cues to body size in the formant spacing of male koala (Phascolarctos cinereus) bellows: Honesty in an exaggerated trait". Journal of Experimental Biology 214 (20): 3414–22. doi:10.1242/jeb.061358. 
  71. ^ Charlton, B. D.; Ellis, W. A. H.; Brumm, J.; Nilsson, K.; Fitch, W. T. (2012). "Female koalas prefer bellows in which lower formants indicate larger males". Animal Behaviour 84 (6): 1565–71. doi:10.1016/j.anbehav.2012.09.034. 
  72. ^ Jackson, pp. 102–05.
  73. ^ a b Smith, M. (1980). "Behaviour of the Koala, Phascolarctos cinereus (Goldfuss), in captivity VI*. Aggression". Australian Wildlife Research 7 (2): 177–90. doi:10.1071/WR9800177. 
  74. ^ Jackson, pp. 101–02.
  75. ^ Martin and Handasyde, pp. 58–60.
  76. ^ Moyal, p. 192.
  77. ^ Gifford, A.; Fry, G.; Houlden, B. A.; Fletcher, T. P.; Deane, E. M. (2002). "Gestational length in the koala, Phascolarctos cinereus". Animal Reproduction Science 70 (3): 261–66. doi:10.1016/S0378-4320(02)00010-6. PMID 11943495. 
  78. ^ a b Martin and Handasyde, pp. 60–61.
  79. ^ Moyal, p. 181.
  80. ^ Martin and Handasyde, p. 62.
  81. ^ Martin and Handasyde, p. 63.
  82. ^ Tyndale-Biscoe, p. 235.
  83. ^ Martin and Handasyde, pp. 64–66.
  84. ^ a b Martin and Handasyde, pp. 66–69.
  85. ^ Ellis, W. A. H.; Bercovitch, F. B. (2011). "Body size and sexual selection in the koala". Behavioral Ecology and Sociobiology 65 (6): 1229–35. doi:10.1007/s00265-010-1136-4. 
  86. ^ Tyndale-Biscoe, p. 236.
  87. ^ Martin and Handasyde, pp. 69.
  88. ^ a b c Martin and Handasyde, pp. 71–75.
  89. ^ Lanyon, J. M.; Sanson, G. D. (1986). "Koala (Phascolarctos cinereus) dentition and nutrition. II. Implications of tooth wear in nutrition". Journal of Zoology 209 (2): 169–81. doi:10.1111/j.1469-7998.1986.tb03573.x. 
  90. ^ Spratt, D. M.; Gill, P. A. (1998). "Durikainema phascolarcti n. sp. (Nematoda: Muspiceoidea: Robertdollfusidae) from the pulmonary arteries of the koala Phascolarctos cinereus with associated pathological changes". Systematic Parasitology 39 (2): 101–06. doi:10.1023/A:1005957809179. 
  91. ^ McInnes, L. M.; Gillett, A.; Hanger, J.; Reid, S. A.; Ryan, U. M. (2011). "The potential impact of native Australian trypanosome infections on the health of koalas (Phascolarctos cinereus)". Parasitology 138 (7): 873–83. doi:10.1017/S0031182011000369. PMID 21524321. 
  92. ^ Jackson, pp. 229–30.
  93. ^ Martin and Handasyde p. 114.
  94. ^ Stoye, J. P. (2006). "Koala retrovirus: A genome invasion in real time". Genome Biology 7 (11): 241. doi:10.1186/gb-2006-7-11-241. PMC 1794577. PMID 17118218. 
  95. ^ Martin and Handsyde, p. 26.
  96. ^ Moyal, pp. 209–11.
  97. ^ Jackson, p. 80.
  98. ^ Adams-Hosking, C.; Grantham, H. S.; Rhodes, J. R.; McAlpine, C.; Moss, P. T. (2011). "Modelling climate-change-induced shifts in the distribution of the koala". Wildlife Research 38 (2): 122–30. doi:10.1071/WR10156. 
  99. ^ Seabrook, L.; McAlpine, C.; Baxter, G.; Rhodes, J.; Bradley, A.; Lunney, D. (2011). "Drought-driven change in wildlife distribution and numbers: A case study of koalas in south west Queensland". Wildlife Research 38 (6): 509–24. doi:10.1071/WR11064. 
  100. ^ a b Foden, W.; Stuart, S. N. (2009). Species and Climate Change: More than Just the Polar Bear (Report). IUCN Species Survival Commission. pp. 36–37. http://data.iucn.org/dbtw-wpd/edocs/2009-051.pdf.
  101. ^ Phillips, B. (1996). Koalas: The Little Australians We'd All Hate to Lose. Australian Government Publishing Service. p. 13. ISBN 978-0-644-09697-3. 
  102. ^ Moyal, p. 8.
  103. ^ Moyal, pp. 9–10.
  104. ^ Moyal, pp. 12–13.
  105. ^ Moyal, pp. 16–28.
  106. ^ Moyal, pp. 33–36.
  107. ^ Home, E. (1808). "An account of some peculiarities in the anatomical structure of the wombat, with observations on the female organs of generation". Philosophical Transactions of the Royal Society 98: 304–12. doi:10.1098/rstl.1808.0020. 
  108. ^ Moyal, p. 36.
  109. ^ Moyal, p. 37.
  110. ^ Moyal, p. 40.
  111. ^ Perry, G. "Koalo, or New Holland Sloth". Arcana; or the Museum of Natural History: 109. 
  112. ^ Moyal, pp. 87–93.
  113. ^ Owen, R. (1836). "Richard Owen, esq., in the chair". Proceedings of the Zoological Society of London 4 (1): 109–13. 
  114. ^ Moyal, pp. 94–86.
  115. ^ Moyal, pp. 46–48.
  116. ^ Moyal, pp. 103–05.
  117. ^ Moyal pp. 105–06.
  118. ^ Caldwell, H. (1884). "On the arrangement of the embryonic membranes in marsupial mammals". Quarterly Journal of Microscopical Sciences. s2–24 (96): 655–58. 
  119. ^ Moyal, p. 111.
  120. ^ "At Koala Park". The Sydney Morning Herald (NSW : 1842 – 1954) (NSW: National Library of Australia). 28 November 1934. p. 14. Retrieved 14 May 2013. 
  121. ^ a b Jackson, pp. 155–58.
  122. ^ a b Jackson, p. ix.
  123. ^ Moyal, p. 201.
  124. ^ Moyal, p. 216.
  125. ^ Martin and Handasyde, p. 3.
  126. ^ Jackson, p. 21.
  127. ^ Martin and Handasyde, p. 17.
  128. ^ Jackson, p. 28.
  129. ^ Jackson, pp. 41–43.
  130. ^ Jackson, pp. 45–46.
  131. ^ a b Jackson, pp. 142–44.
  132. ^ Moyal, p. 162.
  133. ^ Jackson, p. 147.
  134. ^ a b Jackson, pp. 149–52.
  135. ^ Moyal, p. 164.
  136. ^ "Teddy will be missed". Boca Raton News. 15 March 1976. Retrieved 16 August 2013. 
  137. ^ "100 greatest TV spots of all time". Drew Babb & Associates. Retrieved 16 August 2013. 
  138. ^ Jackson, p. 160.
  139. ^ "Platinum Australian Koala". Goldline.com. Retrieved 28 March 2013. 
  140. ^ a b "Koalas added to threatened species list". ABC. 30 April 2012. Retrieved 2 May 2012. 
  141. ^ Moyal, pp. 59–61.
  142. ^ Moyal, pp. 80–81.
  143. ^ Moyal, pp. 121–28.
  144. ^ Moyal, p. 125.
  145. ^ Moyal, p. 127.
  146. ^ Evans, R. (2007). A History of Queensland. Cambridge University Press. p. 168. ISBN 978-0-521-87692-6. 
  147. ^ Moyal, p. 122.
  148. ^ Moyal, pp. 157–59.
  149. ^ Moyal, pp. 159–61.
  150. ^ Jackson, pp. 163–64.
  151. ^ Jackson, p. 179.
  152. ^ Moyal, pp. 166–67.
  153. ^ Jackson, pp. 184–87.
  154. ^ Martin and Handasyde, pp. 104–07.
  155. ^ Jackson, pp. 220–22.
  156. ^ a b Holtcamp, W. (5 January 2007). "Will Urban Sprawl KO the Koala?". National Wildlife. Retrieved 22 March 2013. 
  157. ^ Griffith, J. E.; Dhand, N. K.; Krockenberger, M. B.; Higgins, D. P. (2013). "A retrospective study of admission trends of koalas to a rehabilitation facility over 30 years". Journal of Wildlife Diseases 49 (1): 18–28. doi:10.7589/2012-05-135. PMID 23307368. 
  158. ^ "Frequently asked questions (FAQs)". Australian Koala Foundation. Retrieved 21 March 2013. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!