Overview

Brief Summary

Biology

Koalas are primarily nocturnal, spending most of their time in the branches of trees where they can feed, rest and gain some protection from ground-dwelling predators (6). Much of a koala's time is spent sleeping, and when awake they are still a fairly sedentary species. An adult consumes about 500g of fresh leaves per day (3). Koalas feed on a variety of trees, but the bulk of their diet comes from only a few eucalypt species (6), with marked local and regional differences for the species of eucalypts preferred (5). Eucalyptus leaves are very fibrous and highly toxic, but koalas have evolved to cope with these problems with special cheek teeth that grind the leaves into a fine paste, which is then digested by microbes in the caecum part of the intestine which is unusually long, at around 200cm, and has a blind end, unlike the caecum in most other mammals. Some of the poisons are detoxified in the liver. The diet does not provide much energy, but the long periods spent sleeping, along with their relatively small brains, help compensate for this (3). There is also evidence that suggests koalas may perform myrecism - regurgitating and re-chewing partially digested food, which extracts more energy from the food (7). Both males and females reach sexual maturity at around two years old, but males are rarely large enough to compete for mating access until four years old. Females normally give birth to one young every year but in older females this may reduce to one every two years. The newborn 'joey' is underdeveloped and crawls rapidly through the mother's fur to her pouch, where it suckles for six months. During weaning, in addition to milk, the joey feeds on a substance called 'pap' which is a liquefied form of the mother's faeces and provides the joey's digestive system with the micro-organisms necessary for digesting the eucalyptus leaves (4). Having first left the pouch during this time, the joey rides on its mother's belly, and later rides on her back. It normally remains with its mother until the following year's joey has emerged from the pouch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Koalas are bear-like in appearance, with a stout body and large paws, but are in fact marsupials, not bears. Their fur is predominantly grey to light brown, being lighter and shorter in the warmer north of their range, where the koalas are also smaller (3). The chin, chest and insides of the ears and forelimbs are white, with white speckling on the rump and long white hairs edging the large, round ears. Koalas are adapted to life spent mainly in the trees, with a vestigial tail, and unusually long forelimbs in relation to their hind limbs, and specially adapted paws to aid in gripping and climbing. They have large claws and rough pads on their paws. The first and second digits of the front paws, as well as the first digits of the hind paws, are opposed to the others, like thumbs, to help to grip branches. The first digit of each hind paw has no claw, and the second and third digits are partially fused together to form a grooming claw for removing ticks (5). Males are larger and heavier than females, with a broader face. Mature males are distinguishable from females as they have a brown gland on their chests that produces scent used to mark trees within the territory. Being marsupials, the females have a pouch with a backwards-facing opening and a strong, contracting ring-shaped muscle at the pouch opening which prevents the young from falling out (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Koala was formerly common throughout the broad band of forests and woodlands dominated by Eucalyptus spp. extending from north Queensland to the south-eastern corner of mainland South Australia, Australia (Maxwell et al. 1996). It currently ranges from northeastern, central, and southeastern Queensland with patchy populations in western areas, to eastern New South Wales including the coastal strip and highlands of the Great Dividing Range, the western plains and related riparian environments where suitable habitat occurs, Victoria, and southeastern South Australia. The geographic range has contracted significantly due to loss of large areas of habitat since European settlement. In Queensland, extent of occurrence and area of occupancy have contracted by about 30% (Gordon et al. 2006).

It has been introduced to at least 12 islands including: Kangaroo (South Australia, 450,000 ha), French (Victoria, 17,470 ha), Phillip (Victoria, 10,116 ha), and Magnetic (Queensland, 5,200 ha) (Abbott and Burbidge 1995). It has also been introduced within the mainland in the Adelaide Region and along the Murray River (Maxwell et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The koalas live in eastern Australia and range from northern Queensland to southwestern Victoria. They have been introduced to western Australia and nearby islands (LPZ, 1997).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Populations exist in a band down the eastern and southern coasts and inland areas of Queensland, New South Wales, Victoria and South Australia, as well as on islands off Queensland, Victoria and South Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Koalas from the southern end of the range are generally larger in size than their northern counterparts. In both areas they exhibit sexual dimorphism with the males being larger. In the south, males have an average head-body length of 78 cm and females 72 cm (MacDonald, 1984). The koala's have a vestigial tail. Average weights are: in the south, males--11.8 kg, females--7.9 kg; in the north, males--6.5 kg, females 5.1 kg (MacDonald, 1984) "Males are up to 50% heavier than females, have a broader face, somewhat smaller ears, and a large chest gland (MacDonald, 1984)." Females have two mammae; and rather than a chest gland, have a pouch that opens to the rear and extends upward and forward (Nowak, 1997). Koalas have dense, wooly fur that is gray to brown on top and varies with geographic location. There is white on the chin, chest and inner side of the forelimbs(MacDonald, 1984). The rump is often dappled with white patches and the ears are fringed with long white hairs (MacDonald, 1984). The coat is generally shorther and lighter in the north of range. The paws are large, and both fore and hind feet have five strongly clawed digits. On the forepaw the first and second digits oppose the other three which enables the koala to grip branches as it climbs. The first digit of the hind foot is short and greatly broadened while the second and third digits are relatively small and partly syndactylous but have separate claws (Nowak, 1997).

Range mass: 5.1 to 11.8 kg.

Average basal metabolic rate: 5.744 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Koalas occupy forests and woodlands where there are acceptable food trees. They are largely nocturnal and feed almost exclusively on eucalypts, but preferred food tree species vary with locality and there are quite distinct regional preferences (Martin et al. 2008). They are able to persist in fragmented habitats, and even survive in isolated trees across a predominantly agricultural landscape. Females reach sexual maturity at two years of age and usually give birth to a single young per year. Individual Koalas have been known to live up to 18 years in the wild, but most live between 10 and 14 years (Martin et al. 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Koalas are arboreal, remaining mostly in the branches of the eucalyptus trees, where they are able to feed and stay out of reach of their predators. The koala is confined to eucalyptus forests below 600 m.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Koalas live in eucalypt forests and woodlands, from cool-temperate to tropical areas (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Koalas are herbivorous feeding on both eucalypt and non-eucalypt species. However the bulk of their diet comes from only a few eucalypt species. Eucalyptus viminalis and E. ovata are preferred in the south, while E. punctata, E. camaldulensis and E. tereticornis are the taste of the north (MacDonald, 1984). The leaves are highly toxic; the animals get around this by having a flora of bacteria in their stomachs that metabolize the toxins of the leaves. Koalas have a highly specialized diet in which they eat only 20 of the 350 species of eucalyptus and prefer only 5 species. They feed at night. An adult koala can eat 500g daily. The koala has adapted to cope with its high fiber, low protein diet. "The cheek teeth are reduced to a single premolar and four broad, highly cusped molars on each jaw which finely grind the leaves for easier digestion (MacDonald, 1984)." In addition the koala's caecum is up to four times its body size.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: wild:
17.0 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.1 years (captivity) Observations: In captivity, the koala may live up to 22.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females are sexually mature at two years of age. Males are fertile at two years but usually don't mate until they reach four simply because competition for females requires larger size. Females are seasonally polyestrous, with an estrous cycle of about 27-30 days, and usually breed once every year (Nowak, 1997). The gestation period is 25-35 days with births occurring in mid-summer (December-January). Litters generally consist of only one young but twins have been reported (Nowak, 1997). The young weigh less than 0.5 grams when born, and attach to one of the nipples in the pouch. Young have a pouch life of 5-7 months, feeding on milk or predigested leaves that are nontoxic, and are weaned at 6-12 months (Nowak, 1997). Toward the end of their pouch life the young feed regularly on material passed through the mother's digestive tract (Nowak, 1997). Once the young begins to feed on leaves growth is rapid. The young leaves the pouch after seven months and is carried about on the mother's back. By eleven month's of age the young is independent, but may continue to live close to the mother for a few months. Koalas may live past 10 years in the wild, and there have been reports of life spans over 20 years in captivity.

Average birth mass: 0.36 g.

Average gestation period: 31 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
646 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolarctos cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0669-06|NC_008133|Phascolarctos cinereus| AATCGCTGACTATTCTCAACCAATCACAAAGATATTGGTACTATATATATACTATTTGGCGCCTGAGCTGGAATAGTAGGTACGGCCCTC---AGCCTGTTAATCCGCATGGAACTTGGCCAACCAGGAGCTTTAATTGAAGAT---GACCAAATCTATAACGTTATTGTAACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGTGGCTTTGGTAACTGACTAGTACCACTAATA---ATCGGCGCCCCTGATATAGCATTTCCACGAATAAACAATATAAGCTTCTGACTACTTCCACCATCTTTTCTATTACTACTAGCATCTTCCACAGTAGAAGCTGGTGCAGGAACTGGATGGACAGTATACCCCCCACTAGCCAGCAATCTAGCCCATGCCGGGGCATCAGTAGACTTA---GCAATTTTCTCCCTACATCTTGCAGGTATTTCCTCTATCCTAGGTGCTATCAACTTTATCACTACAATCATTAACATAAAACCACCAGCCTTATCTCAATATCAAATCCCATTATTTGTTTGATCAGTAATAATCACAGCAGTACTACTTCTCCTATCTCTTCCAATCTTAGCAGCA---GGAATTACTATACTATTGACTGACCGCAACTTAAATACAACTTTTTTTGACCCAACTGGCGGAGGCGATCCTATTTTATACCAACACCTATTCTGATTTTTTGGTCACCCAGAAGTTTACATCTTAATCTTACCTGGGTTTGGCATAATCTCACACATTGTAACCTTCTATTCAGGAAAAAAA---GAACCATTCGGCTATATAGGTATAGTCTGAGCAATAATATCCATTGGATTCCTAGGATTTATCGTATGAGCCCATCACATATTTACAGTAGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phascolarctos cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gordon, G., Menkhorst, P., Robinson, T., Lunney, D., Martin, R. & Ellis, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. This is a high profile species that varies greatly in population size and density across its range, and requires intensive management in areas where it is considered a pest species, as well as in those regions where it is known to be in decline.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The koala holds no special status although the Environment Australia Biodiversity Group calls the koala lower risk--near threatened (1996). Koalas were nearly exterminated at the turn of the century because they were hunted for their fur, and because their environments were destroyed by fires caused by humans. After1927 as a result of public outcry the koala became legally protected. Currently their main threat is habitat destruction. Management of the koala can be difficult. Populations that are protected can reach such high numbers in an area that they destroy the trees on which they feed. Often portions of populations have to be relocated in order to reduce the number of individuals in a given area. However, this is complicated by the shortage of suitable forest areas where surplus animals can be released (MacDonald, 1984).

They are also threatened by the microorganism Chlamydia psittaci, which can make them sterile.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 05/09/2000
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Phascolarctos cinereus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk - near threatened (LR/nt) on the IUCN Red List 2003 (1). Listed as Vulnerable in the southeast Queensland bioregion under the Nature Conservation Act 1992 and as Common in the rest of the state. Classified as Vulnerable under the New South Wales Threatened Species Conservation Act 1995. Victoria has no official listing and in South Australia, koalas are listed as Rare (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Koalas are uncommon and patchily distributed in most of their Queensland range, but are common in south-eastern Queensland. Queensland populations have persisted where habitat occurs, although fluctuating markedly in size (Gordon and Hrdina 2005; Gordon et al. 2006). They are widespread and common in Victoria. In New South Wales, they are known to be common in the Pilliga (the species' stronghold is along the north coast), but they are uncommon elsewhere. All South Australian populations became extinct by 1920, and current populations have been introduced outside their original range with the exception of the extreme south-east of the state. The introduced populations have expanded and caused severe environmental damage on Kangaroo Island (current population estimates on Kangaroo Island are of 28,000 ? these animals are highly inbred, resulting from a very small original source population of 10 animals). The Koala was listed in the 2001 State of the Environment report of the Commonwealth as one of the eight pest species of Australia.

While remaining populations are widely distributed, habitat fragmentation and modification has resulted in an increased prevalence of predation, in addition to geographic and genetic isolation (Maxwell et al. 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Current threats to this species include continued habitat destruction, fragmentation, and modification (which makes them vulnerable to predation by dogs, vehicle strikes, and other factors), bushfires, and disease, as well as drought associated mortality in habitat fragments. Public concern for the species is high. There are management problems with many populations; remnant populations living at high densities in isolated patches of habitat are at greatest risk (Martin et al. 2008). Effective management of some of the threats on the mainland could lead to excessive abundance and result in pest problems similar to those occurring on Kangaroo Island and in parts of Victoria.

The overall distribution of Koalas has been reduced since European settlement. This decline was primarily due to disease, bushfires, and widespread habitat destruction in the early decades of the 20th century. Commercial harvesting also took place across the range towards the end of the 19th century and early 20th century (huge numbers, running into the millions, were killed for their pelts for a large export industry in Victoria, New South Wales, and Queensland). This was banned in Victoria in the 1890s, and it continued sporadically (and under regulation) in Queensland until 1927 (Hrdina and Gordon 2004). There is no evidence, however, that the early spate of commercial harvesting had any long-term impact on the overall population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Climate change is predicted to cause an increase in drought frequency and fires in many parts of Australia as a result of reduced rainfall levels, increased evaporation rates, and an overall temperature increase of about 1ºC by 2030, according to a CSIRO report (IUCN 2009). Increasing frequency and intensity of droughts or periods of extreme heat would force Koalas to descend from trees more frequently in search of water or new habitats. This would make them more vulnerable to wild and domestic predators, as well as to road traffic. Dispersing Koalas often have to cross main roads and come into contact with domestic animals. It is estimated that around 4,000 Koalas are killed each year by dogs and cars alone (IUCN 2009).

Koalas’ warm fur and thick skin enables them to endure cold conditions in southern Australia, but they do not cope well with extreme heat. Unlike most arboreal marsupials, Koalas do not use nest hollows, which contributes to their greater susceptibility to extreme temperatures and drought. Bushfires, which have already wiped out numerous populations of Koalas, are likely to increase in both frequency and severity with climate change. Koalas are particularly vulnerable to bushfires as their slow movement and tree-dwelling lifestyle makes it difficult for them to escape and their food supply can be destroyed (IUCN 2009).

Climate change is likely to have some less obvious negative impacts on Koalas as well. Atmospheric carbon dioxide concentrations globally have increased from 280 ppm to 387 ppm since the Industrial Revolution. Projections for 2050 suggest that carbon dioxide concentrations are likely to increase markedly to between 500 and 600 ppm, depending on future emissions scenarios (IUCN 2009). Increased carbon dioxide levels tend to result in faster plant growth, but also to reduce protein levels and increase tannin levels in plants’ leaves, making them less nutritious and more difficult to digest (Lawler et al. 1997). As carbon dioxide levels continue to rise, Koalas and other browsers will need to cope with increasingly nutrient-poor and tannin-rich leaves.

Given the altered chemical composition of their food plants, Koalas could meet their nutritional needs by spending more time feeding and thus eating more. However, there is a limit to how much Koalas can increase the size of their guts. Furthermore, eating more leaves causes food to pass more quickly through the Koala’s digestive system, resulting in less thorough digestion and decreased nutrient uptake. Another possibility would be to exercise greater selectivity in tree and leaf choice (see Moore and Foley 2000, 2005; DeGabriel et al. 2009). Although Koalas could be more selective in their food selection, however, this would require more travel time to find the best trees and Koalas travelling in search of food are at an increased risk of predation and road accidents. Furthermore, the nutritional demands of breeding female koalas are higher than those of non-breeding individuals, raising the possibility that even if nonbreeding individuals were able to sustain themselves when faced with less nutritious food options than they have today, failure of breeding females to meet their nutrition needs could nevertheless lead to widespread reproductive failure and population declines (IUCN 2009).

Reports of large population declines in the first years of this century have prompted reassessments of the Koala’s threat status by the Australian government (IUCN 2009). In addition to factors related to climate change, other major factors contributing to Koala declines include disease and habitat destruction. The primary disease threat is from chlamydia, a widespread sexually-transmitted disease that causes blindness, pneumonia, and urinary and reproductive tract infections and death in Koalas. Habitat loss is also a major problem. Destruction and degradation of Koala habitat is particularly prevalent in the coastal regions of Australia, where urban development is rapidly encroaching on eucalyptus forests. In addition, habitat fragmentation limits Koalas’ ability to disperse to suitable areas and can intensify inbreeding problems (IUCN 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Chlamydia bacterium), death by road traffic and predation by dog. Recently there has been a lot of attention in the media suggesting that koalas in some isolated patches of habitat have been the cause of defoliation of eucalyptus trees, resulting in calls for a cull of the koalas in these areas. That the koalas are to blame is a contentious issue amongst scientists and authorities and there is evidence to suggest that several other factors may be the cause (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in numerous protected areas. Recommended actions for the species (Maxwell et al. 1996; Martin and Handasyde 1999; Gordon pers. comm.) include: complete and implement National Strategy for Conservation of the Koala (currently in draft form); develop appropriate PVA models applicable to the diversity of habitat types utilised by the species; conduct regional and local surveys of distribution, assessment of tree preferences and identification of key critical habitat areas for conservation; formulate and implement detailed regional management plans for the conservation of these populations; manage populations to prevent over-browsing at some sites in Victoria and South Australia; develop positive community involvement in Koala conservation and management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Although koalas are a protected species, their numbers have markedly decreased due to habitat loss, and many populations are now living in isolated patches of habitat, putting them at greater risk of localised extinctions. Remaining koala habitat is mostly on privately-owned land so landowners have a responsibility to conserve them. As an important step in its aim to achieve national species-specific legislation that would effectively protect koala habitat over all of the koala's range, in July 2004 the Australian Koala Foundation submitted a nomination to the Australian Government, supported by a large amount of scientific data, to list the koala as Vulnerable nationally as a matter of urgency. To date this has not been achieved. Without legislation that encourages landowners, through incentives, to protect habitat on their land, there are fears koala numbers will decline to such an extent that populations will be incapable of ever recovering (5). Legislation, along with continued research and monitoring, will be necessary to prevent this Australian icon from further declining as a result of competing land use pressures (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

none noted

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the early 20th century the koala was hunted extensively for its warm, thick coat. However, they are now protected and can no longer be hunted.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Koala

The koala (Phascolarctos cinereus) is an arboreal herbivorous marsupial native to Australia, and the only extant representative of the family Phascolarctidae.

The koala is found in coastal regions of eastern and southern Australia, from Adelaide to the southern part of Cape York Peninsula. Populations also extend for considerable distances inland in regions with enough moisture to support suitable woodlands. The koalas of South Australia were largely exterminated during the early part of the 20th century, but the state has since been repopulated with Victorian stock. The koala is not found in Tasmania or Western Australia.

Contents

Names

The word koala comes from the Dharuk gula. Although the vowel /u/ was originally written in the English orthography as "oo" (in spellings such as coola or koolah), it was changed to "oa" possibly due to an error.[3] The word is erroneously said to mean "doesn't drink".[3]

The scientific name of the koala's genus, Phascolarctos, is derived from Greek phaskolos "pouch" and arktos "bear". Its species name, cinereus, is Latin and means "ash-coloured".[4]

Although the koala is not a bear, English-speaking settlers from the late 18th century first called it koala bear due to its similarity in appearance to bears. Although taxonomically incorrect, the name koala bear is still in use today outside Australia[5] – its use is discouraged because of the inaccuracy in the name.[6][7][8][9][6] Other descriptive English names based on "bear" have included monkey bear, native bear, and tree-bear.[3]

Variation

A Southern koala on Kangaroo Island, not native to the island

Although three subspecies have been described, these are arbitrary selections from a cline and are not generally accepted as valid. Following Bergmann's Rule, individuals from the southern cooler climates are larger.

A typical Victorian koala (formerly P. cinereus victor) has longer, thicker fur, is a darker, softer grey, often with chocolate-brown highlights on the back and forearms, and has a more prominently light-coloured ventral side and fluffy white ear tufts. Typical and New South Wales koala weights are 12 kg (26 lb) for males and 8.5 kg (19 lb) for females. In tropical and sub-tropical Queensland, however, the koala is smaller (at around 6.5 kg (14 lb) for an average male and just over 5 kg (11 lb) for an average female), a lighter often rather scruffy grey in colour, and has shorter, thinner fur. In Queensland, the koala was previously classified as the subspecies P. cinereus adustus, and the intermediate forms in New South Wales as P. cinereus cinereus. A fourth variation, though not technically a subspecies, is the "golden koala", which has a slight golden tinge to the fur as a result of an absence of the melanin pigment that produces albinism in most other mammalian species. The variation from one form to another is continuous and there are substantial differences between individual koalas in any given region such as hair colour. Koalas may also have white fur in rare cases due to a recessive gene.

The origins of the koala are unclear, although almost certainly they descended from terrestrial wombat-like animals. Koala fossils are quite rare, but some have been found in northern Australia dating to 20 million years ago. During this time, the northern half of Australia was rainforest. The koala did not specialise in a diet of eucalypts until the climate cooled and eucalypt forests grew in the place of rainforests. The fossil record indicates that before 50,000 years ago, giant koalas inhabited the southern regions of Australia. The koala fills the same ecological role as the sloths of South America.

Physical description

Female
Koalas have a slow metabolism and sleep for most of the day

The koala is broadly similar in appearance to the wombat (its closest living relative),[1] but has a thicker coat, much larger ears, and longer limbs. The koala has large, sharp claws to assist with climbing tree trunks. Weight varies from about 14 kg (31 lb) for a large southern male, to about 5 kg (11 lb) for a small northern female. The koala's five fingers include two opposable thumbs, providing better gripping ability. The first two fingers are positioned in apposition on the front paws, and the first three fingers for the hind paws.[10] The koala is one of the few mammals (other than primates) that has fingerprints. Koala fingerprints are similar to human fingerprints; even with an electron microscope, it can be quite difficult to distinguish between the two.[11]

A Koala Skeleton

The teeth of the koala are adapted to their herbivorous diet, and are similar to those of other diprotodont marsupials, such as kangaroos and wombats. They have sharp incisors to clip leaves at the front of the mouth, separated from the grinding cheek teeth by a wide diastema. The dental formula for koalas is Upper: 3.1.1.4, lower: 1.0.1.4

The male koala, like many marsupials, has a bifurcated penis. The female has two lateral vaginas and two separate uteri, which is common to all marsupials.[12]

Koalas walk on all four legs when walking on the ground, joey clinging to the back

The brain in the ancestors of the modern koala once filled the whole cranial cavity, but has become drastically reduced in the present species, a degeneration scientists suspect is an adaptation to a diet low in energy.[13] One of the smallest in marsupials with no more than 0.2% of its body weight,[14] about 40% of the cranial cavity is filled with cerebrospinal fluid, while the brain's two cerebral hemispheres are like "a pair of shrivelled walnut halves on top of the brain stem, in contact neither with each other nor the bones of the skull. It is the only animal on Earth with such a strangely reduced brain."[15]

It is generally a silent animal, but males have a very loud advertising call that can be heard from almost a kilometre away during the breeding season.[16] Females glean clues regarding a male's suitability as a mate from these calls, showing a preference for larger males.[17] When under stress, koalas may issue a loud cry, which has been reported as similar to that of a human baby.[18] There is little reliable information about the lifespan of the koala, but in captivity they have been observed to reach the age of 18 years.[10]

Life cycle

A young joey, preserved at Port Macquarie Koala Hospital
Baby koala on a mother's back
Baby koala at Currumbin Wildlife Sanctuary

Females reach maturity at 2 to 3 years of age, males at 3 to 4 years. A healthy female koala can produce one young each year for about 12 years. Gestation is 35 days. Twins are very rare; the world's first confirmed identical twin koalas, named "Euca" and "Lyptus", were born at the University of Queensland in April 1999.[19][20] Mating normally occurs between December and March, the Southern Hemisphere's summer.

A baby koala is referred to as a joey and is hairless, blind, and earless. At birth the joey, only 20 mm (0.79 in) long, crawls into the downward-facing pouch on the mother's belly (which is closed by a drawstring-like muscle that the mother can tighten at will) and attaches itself to one of the two teats.

Young remain hidden in the pouch for about six months, only feeding on milk. During this time they grow ears, eyes, and fur. The joey then begins to explore outside of the pouch. At about this stage it begins to consume small quantities of the mother’s "pap" (formerly thought to be excrement, but now thought to come from the mother's cecum) in order to inoculate its gut with the microbes necessary to digest eucalypt leaves.[21] The joey will remain with its mother for another six months or so, riding on her back, and feeding on both milk and eucalypt leaves until weaning is complete at about 12 months of age. Young females disperse to nearby areas at that time; young males often stay in the mother's home range until they are two or three years old.

Diet and behaviour

Koala with young.ogv
Koala with joey in pouch
Koala dozing during the day

The koala lives almost entirely on eucalypt leaves. This is likely to be an evolutionary adaptation that takes advantage of an otherwise unfilled ecological niche, since eucalypt leaves are low in protein, high in indigestible substances, and contain phenolic and terpene compounds that are toxic to most species. Like wombats and sloths, the koala has a very low metabolic rate for a mammal and rests motionless for about 16 to 18 hours a day, sleeping most of that time. Koalas can be aggressive towards each other, throwing a foreleg around their opponent and biting, though most aggressive behaviour is brief squabbles.[22] Handling koalas may cause them stress,[23] and the issue of aggression and stress from handling is a political issue in Australia.[24][25]

Koalas spend about three of their five active hours eating. Feeding occurs at any time of day, but usually at night. Koalas eat an average of 500 g (18 oz) of eucalypt leaves each day, chewing them with powerful jaws to a very fine paste before swallowing. The liver deactivates the toxic components ready for excretion, and the hind gut (especially the cecum) is greatly enlarged to extract the maximum amount of nutrient from the poor quality diet. Much of this is done through bacterial fermentation: while young are being weaned, the mother passes these essential digestive aids on to her offspring.

A koala eating eucalyptus
Koala grooming.ogv
Koala in tree, scratching & grooming

The koala will eat the leaves of a wide range of eucalypts, and occasionally even some non-eucalypt species such as Acacia, Leptospermum, and Melaleuca. It has firm preferences for particular varieties of eucalypt and these preferences vary from one region to another: in the south Manna Gum, Blue Gum, and Swamp Gum are favoured; Grey Gum and Tallowwood are important in the north, and the ubiquitous River Red Gum of the isolated seasonal swamps and watercourses that meander across the dry inland plains allows the koala to live in surprisingly arid areas. Many factors determine which of the 680 species of eucalypt trees the koala eats. Among trees of their favourite species, however, the major factor that determines which individual trees the koala chooses is the concentration of a group of phenolic toxins called formylated phloroglucinol compounds.[citation needed] Researches on koalas by keepers at 13 wildlife parks and zoos in New South Wales show that the most preferred group of Eucalyptus foliage had the lowest content of condensed tannins.[26]

Conservation status

The Australian government currently lists the koala as a priority species for conservation status assessment.[27] Government estimates of the national koala population numbers in the hundreds of thousands, although other studies have estimated as few as 80,000 koalas left in the wild.[28] The Australian Koala Foundation in 2008 estimated there are around 100,000 koalas left in the wild.[29]

As with most native Australian animals, the koala cannot legally be kept as a pet in Australia or anywhere else. The only people who are permitted to keep koalas are wildlife carers and, occasionally, research scientists. These individuals are issued with special permits to care for koalas, but have to return them to the wild when they are either well enough or, in the case of joeys, old enough.[9]

The IUCN lists the species as "Least Concern".[2] The Australian government does not consider the species to be threatened, although the US government has declared the koala a threatened species.[30]

The koala inhabits four Australian states. Under state legislation, the species is listed as:

  • Queensland – Common, or "Least Concern Wildlife" throughout the state, except in the South East Queensland bioregion, where it is listed as vulnerable.[31]
  • New South Wales – listed at a state scale as vulnerable, but varying regionally from secure to locally extinct.[32]
  • South Australia – classified as rare (although the population on Kangaroo Island is thriving).[33]
  • Victoria – The koala population in Victoria was considered large and thriving, according to an article which was last reviewed on 29 October 2007.[34]

The koala was hunted almost to extinction in the early 20th century,[35] largely for its fur. Millions of furs were traded to Europe and the United States, and the population has not fully recovered from such decimations. Extensive cullings occurred in Queensland in 1915, 1917, and again in 1919 when over one million koalas were killed with guns, poisons, and nooses.[36] The public outcry over the cullings was most likely the first wide-scale environmental issue that rallied Australians.[36] Despite the growing movement to protect native species, the poverty brought about by the drought of 1926–28 led to another 600,000 koalas being killed during a one-month open season in August 1927.[36]

Today, habitat loss and the impacts of urbanisation (such as dog attacks and traffic accidents) are the leading threats to the survival of the koala. In recent years, some colonies have been hard hit by disease, especially chlamydia.[37] 2011 surveys in Queensland show that chlamydia has caused symptons in at least 50 percent of Koala population. Chlamydia of Koalas neither same as the human form, but can make blindness, respiratory infections to all koalas and infertile of female koalas. Moreover nearly all of Koalas in Queensland are infected with Koala retrovirus which supresses the koala's immune system and interferes with its ability to fight of chlamydia.[38] The koala requires large areas of healthy, connected forest and will travel long distances along tree corridors in search of new territory and mates. The increasing human population of the coastal parts of the continent continues to cut these corridors by agricultural and residential development, forestry, and road-building, marooning koala colonies in decreasing areas of bush. The long term viability of the koala is therefore threatened by genetic weakness[citation needed]. The Australian Koala Foundation is the principal organisation dedicated to the conservation of the koala and its habitat, mapping 40,000 km2 (15,000 sq mi) of land for koala habitat and claiming strong evidence that wild koala populations are in serious decline throughout the species' natural range.[33] Local councils in growing urban areas with koala populations that have established or are in the process of establishing planning overlays and controls to preserve habitat for koalas include the Victorian councils of City of Ballarat,[39][40] Macedon Ranges Shire[41] and Glenelg Hopkins Catchment Management Authority[40] as well as the Queensland councils of Moreton Bay Regional Council and Redland Shire Council.

Although the species covers a large area, only 'pieces' of koala habitat remain. Presently, many habitats are lost to weeds, clearance for agriculture, or carved up by developers. Other threats come from logging, poor management, attacks from feral and domestic animals, diseases, and roads.

See also

References

  1. ^ a b Groves, Colin P. (16 November 2005). "Order Diprotodontia (pp. 43-70)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 43. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11000005. 
  2. ^ a b Gordon G, Menkhorst P, Robinson T, Lunney D, Martin R. & Ellis M (2008). Koala. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 October 2008.
  3. ^ a b c Dixon, R.M.W.; Moore, Bruce; Ramson, W. S.; Thomas, Mandy (2006). Australian Aboriginal Words in English: Their Origin and Meaning (2nd ed.). South Melbourne: Oxford University Press. ISBN 0-19-554073-5. 
  4. ^ Kidd, D.A. (1973). Collins Latin Gem Dictionary. London: Collins. p. 53. ISBN 0-00-458641-7. 
  5. ^ Leitner, Gerhard; Sieloff, Inke (1998). "Aboriginal words and concepts in Australian English". World Englishes 17 (2): 153–169. doi:10.1111/1467-971X.00089. 
  6. ^ a b Australian Koala Foundation. "Interesting facts about koalas". https://www.savethekoala.com/about-koalas/interesting-facts. 
  7. ^ "Australian Fauna". Australian Fauna. http://www.australianfauna.com/koala.php. Retrieved 9 March 2009. 
  8. ^ "Australasian Regional Association of Zoological Parks and Aquaria". Arazpa.org.au. http://www.arazpa.org.au/Koala/default.aspx. Retrieved 9 March 2009. 
  9. ^ a b Australian Koala Foundation. "Frequently asked questions (FAQs)". https://www.savethekoala.com/about-koalas/frequently-asked-questions. 
  10. ^ a b Martin, Roger (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. pp. 872–5. ISBN 0-87196-871-1. 
  11. ^ Henneberg, Maciej; Lambert, Kosette M., Leigh, Chris M. (1997). "Fingerprint homoplasy: koalas and humans". NaturalSCIENCE.com 1. http://naturalscience.com/ns/articles/01-04/ns_hll.html. 
  12. ^ Dawson, T.J.; Finch, E., Freedman, L., Hume, I.D., Renfree, M., Temple-Smith, P.D. (PDF). Fauna of Australia; 17. Morphology and Physiology of Metatheria. pp. 51, 53. http://www.environment.gov.au/biodiversity/abrs/publications/fauna-of-australia/pubs/volume1b/17-ind.pdf. 
  13. ^ Byers, John A. (1 July 1999). "PLAY'S the THING". Natural History. http://findarticles.com/p/articles/mi_m1134/is_6_108/ai_55127881. 
  14. ^ "Koala (Phascolarctos cinereus) Fact Sheet 2003". Spot.colorado.edu. Archived from the original on 21 January 2008. http://web.archive.org/web/20080121190748/http://spot.colorado.edu/~humphrey/fact+sheets/koala/koala.htm. Retrieved 9 March 2009. 
  15. ^ Flannery, T.F. (1994). The Future Eaters: An ecological History of the Australasian Lands and People. Sydney: Reed New Holland. p. 86. 
  16. ^ "koala mating call on National Film and Sound Archive's australianscreen online". http://aso.gov.au/titles/environmental/bird-and-animal-calls/clip1/. Retrieved 25 February 2011. 
  17. ^ Koala's brutish bellows are all for love, Australian Geographic, 25 February 2011.
  18. ^ "Facts about Koalas". Koalaplayworld.com. http://koalaplayworld.com/Facts_about_Koalas.html. Retrieved 9 March 2009. 
  19. ^ "General Koala Information". Koalaresearch.net.au. http://www.koalaresearch.net.au/General.html. Retrieved 2 June 2011. 
  20. ^ "University of Queensland Koala Study program". Koalas.cqu.edu.au. http://koalas.cqu.edu.au/news/baby.htm. Retrieved 9 March 2009. 
  21. ^ Martin, Roger; Handasyde, Kathrine Ann (1999). The Koala: Natural History, Conservation and Management. Australian Natural History Series (2nd ed.). UNSW Press. pp. 64–65. ISBN 0868405442. 
  22. ^ Smith, M (1980). "Behaviour of the Koala, Phascolarctos cinereus (Goldfuss), in Captivity VI*. Aggression". Australian Wildlife Research 7 (2): 177–190. doi:10.1071/WR9800177. http://www.publish.csiro.au/paper/WR9800177.htm. 
  23. ^ Jackson, Stephen M. (2003). "Koalas". Australian mammals: biology and captive management. CSIRO Publishing. p. 524. ISBN 0643066357. http://books.google.com/?id=Ys_NC1P9AX4C&pg=PA161. 
  24. ^ "Koalas Welfare – 16 November 1995 – ADJ – NSW Parliament". Parliament.nsw.gov.au. Archived from the original on 10 June 2008. http://web.archive.org/web/20080610051307/http://www.parliament.nsw.gov.au/prod/parlment/HansArt.nsf/66662d17d79b79d7ca256cfd000e0c22/ca256d11000bd3aa4a25644a00824515!OpenDocument. Retrieved 9 March 2009. 
  25. ^ Anderson, Ian (2 December 1995). "Please don't cuddle the koalas". New Scientist. http://www.newscientist.com/article/mg14820060.800-please-dont-cuddle-the-koalas.html. Retrieved 21 October 2009. 
  26. ^ Hume ID, Esson C (1993). "Nutrients, Antinutrients and Leaf Selection by Captive Koalas (Phascolarctos-Cinereus)". Australian Journal of Zoology 41 (4): 379–392. doi:10.1071/ZO9930379. 
  27. ^ Australian Government. "Environmental Finalised Priority Assessment List for the Assessment Period Commencing 1 October 2008" (PDF). http://www.environment.gov.au/biodiversity/threatened/publications/pubs/priority-assessment-list.pdf. 
  28. ^ Australian Government. "Environmental assessment of koala's conservation status". http://www.environment.gov.au/minister/env/2006/mr14july206.html. 
  29. ^ Australian Koala Foundation. "Potential Koala Habitat in 2008". http://www.savethekoala.com/kc/maplaunch2008.html. 
  30. ^ US Fish and Wildlife Service. "Threatened and Endangered Species System". http://ecos.fws.gov/tess_public/SpeciesReport.do. 
  31. ^ Queensland Parks and Wildlife Service. "EPA/QPWS Koala designation". http://www.epa.qld.gov.au/nature_conservation/wildlife/koala_plan/. 
  32. ^ New South Wales Parks and Wildlife Service. "NSWPWS Koala profile". http://www.threatenedspecies.environment.nsw.gov.au/tsprofile/profile.aspx?id=10616. 
  33. ^ a b Australian Koala Foundation. "Koala conservation status (FAQs)". http://www.savethekoala.com/koalasendangered.html. 
  34. ^ Department of Sustainability and the Environment. "Victorian Koala designation". http://www.dse.vic.gov.au/dse/nrenpa.nsf/LinkView/E260BBD07DD52CF4CA256DE3007F11443B3BE6168C8BE71ECA256E5A0010BD5C. 
  35. ^ Australian Koala Foundation. "History of Koalas". http://www.savethekoala.com/koalashistory.html. 
  36. ^ a b c Evans, Raymond (2007). A History of Queensland. Port Melbourne, Victoria: Cambridge University Press. p. 168. ISBN 9780521876926. 
  37. ^ Malkin, Bonnie (10 November 2009). "Koalas 'extinct within 30 years' after chlamydia outbreak". The Telegraph. http://www.telegraph.co.uk/news/worldnews/australiaandthepacific/australia/6537179/Koalas-extinct-within-30-years-after-chlamydia-outbreak.html. 
  38. ^ "Chlamydia Vaccine Could Slow Koala Disease Crisis". JakartaGlobe. 22 February 2012. http://www.thejakartaglobe.com/international/chlamydia-vaccine-could-slow-koala-disease-crisis/499867. 
  39. ^ Williams, Erin (3 August 2010). "VCAT knocks back Mt Helen subdivision". The Courier. http://www.thecourier.com.au/news/local/news/general/vcat-knocks-back-mt-helen-subdivision-due-to-koalas/1902027.aspx. Retrieved 2 June 2011. 
  40. ^ a b "Implementing the Ballarat Koala Plan of Management through the Ballarat Planning Scheme" (PDF). City of Ballarat. http://www.ballarat.vic.gov.au/media/57443/ballarat%20koala%20plan%20of%20management%20-%20information%20brochure.pdf. 
  41. ^ Kennedy, Barry (6 July 2010). "HAVE YOUR SAY: Macedon Ranges koala habitat plea". Sunbury Leader incorporating the Macedon Ranges Leader. http://macedon-ranges-leader.whereilive.com.au/news/story/have-your-say-macedon-ranges-koala-habitat-plea/. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!