Overview

Distribution

Range Description

This species is restricted to the coast of Western Australia, from Northwest Cape to Hamelin Harbour including offshore islands (Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Western rock lobsters can only be found in the Indo-West Pacific Ocean region. They are restricted primarily to the west coast of Australia between the Northwest Cape and Hamelin Harbour, but they can also be found at some of the offshore islands.

Biogeographic Regions: indian ocean; pacific ocean

  • Holthius, L. 1991. Marine Lobsters of the World: an annotated and illustrated catalogue of species of interest to fisheries known to date. Rome: Food and Agriculture Organizations of the United Nations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

FAO fishing area 57, Indo-West Pacific, Rottnest Island
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The basic physical features of the Western rock lobster are: compound eyes on mobile stalks, antennae, six pairs of small limbs around the mouth, and five pairs of walking legs.

Panulirus cygnus also have a strong and muscular abdomen with an exoskeleton that is segmented on their backs. They have swimmerets underneath the tail which ends in a tail fan. Their body color is pale to dark purple-brown with pale spots on the abdomen. The antennulae and legs are uniform in color with pale streaks.

Western rock lobsters have a maximum mass of 5 kilograms, and the largest ever reported was 5.5 kilograms, or about 12 pounds. The average length of their carapace is 8-10 centimeters, but their body is 9-11 centimeters long in ovigerous females and lobsters with spermatophores. The main distinction between different species of lobster can be made from their abdominal somites. In Panulirus cygnus there are pubescent grooves on the dorsal surface of the somites and there is a pubescent area along the posterior region.

As for sexual dimorphism, there are three main distinguishing characters between males and females. The first is the fifth pair of walking legs. In females the pair ends in a small claw, and in males, the pair ends in a point without a claw. The second difference is the location of the genital pore. At the base of the third pair of legs is the genital pore for the females, whereas in males, the genital pore is at the base of the fifth pair of legs. The third difference is between the pleopods/swimmers on the Rock lobsters' tails. In a female there are inner and outer pleopods used to carry her eggs; a male simply has four pairs of single pleopods.

Another related issue to sexual dimorphism in Panulirus cygnus is the hormones that are secreted by androgenic glands to induce the development of male sex characters. Also called the glands that make the male, the androgenic glands not only have an effect on males, they also have an effect on females. If they are artificially implanted into a female Western rock lobster, her ovaries will begin to turn into testes. As a result, not only will she start to produce sperm, but during the next molt her appendages will be reformed with male characteristics (such as are mentioned above).

Also, lobsters lower their metabolic rate when they are cooled, and as a result, their responses are altered.

Range mass: 5 .5 (high) kg.

Average mass: 5 kg.

Range length: 9-11 (high) cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found sheltering in vegetated rocky reefs and coral reefs at a depth range of 0 - 120 m, although is more commonly found to depths of 90 m (Holthuis 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Panulirus cygnus live as free-swimming larvae in the ocean for the first year of their life. Newly hatched, they can live up to 1,500 kilometers from the coastline. As they grow, they return to the coast to live for approximately five years on the reefs in water 40 meters deep, or less. After this period, they migrate to reefs that are deeper and further away from the shore. During this new stage of their life, the Western rock lobster is found in depths between 0-90 meters, and rarely as deep as 120 meters. As adults, they are nocturnal, so during the day they use coral and rock crevices for shelter.

Average depth: 0-90 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 14 - 14
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In the first stages of its life, Panulirus cygnus eat plankton that is found close to the surface of the ocean.

As the lobsters get older and move to the reefs, they also change their feeding habits. They begin to go out at night and search for food. In one night, a lobster is said to cover a mile or more a night looking for food. Panulirus cygnus are considered to be omnivorous, eating both animal and plant materials. They eat mollusks, worms, crabs, clams, sea urchins, slow flounder, seaweed, and seagrasses. A lobster will even eat another lobster if they have the chance. In cages lobsters can be cannibalistic, but this has never been seen in the wild.

Animal Foods: mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: macroalgae

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

While the lobsters are settled on the ocean floor they co-exist with the other bottom-dwellers. The other species that they live with are things such as: sea urchins, crabs, mussels, and algae. But, lobsters are considered to be bad neighbors because they will not hesitate to eat anything that lives around them, if they have the opportunity.

A while ago, sea urchins flourished and consumed large areas of kelp on the ocean floor, making it a very open area. But, as a result of a demand for sea urchins, their population has been reduced and the kelp is beginning to grow back. Scientists think that the growth of this new kelp provides places for young lobsters to hide and as a result is helping the population to grow.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are the biggest predators of the Western rock lobsters. Octopus, snapper, jewfish, and sharks are also their predators. But, to help minimize the number of potentially fatal attacks they are cryptic and they hide in rock crevices during the day. Panulirus cygnus can also avoid capture by their aquatic predators by producing a startling buzzing noise or self-amputating a limb. The limb occupies the predator and the lobsters are able to make their escape. However, problems arise with this approach because the ability to find food is reduced as limbs are lost. Luckily, the sacrificed limb is replaced during the next molt.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There have been many studies done about the visual senses of Panulirus cygnus. These lobsters have eyes on eyestalks on their heads. They use them to see, but tests have been done that prove that they do not necessarily need their eyes to know where to go. Scientists believe that, like birds, lobsters may be using the Earth's magnetic field to find their way around.

It is also known that Western rock lobsters have special sound producing structures to produce acoustic signals. Panulirus cygnus produce a very unpleasant noise in a fascinatingly individual way. Similar to a violinist, they slide a bow across a vibrating surface. The bow is called the plectrum which is at the base of each antenna, and the vibrating surface is the file, a lump on both sides of a lobster's head. The lobsters simply wave their antennae and the sound produced is a loud, scratchy buzz. The technique is known as the stick-and-slip motion and the key to sound production is friction. The friction comes from microscopic shingles on the files of the lobsters. Hence, the longer the file, the longer time the lobsters can produce their sound.

Scientists believe that lobsters make these noises to startle predators enough to scare them away. This tactic is especially useful during the time right after molting. It appears that this feature of being able to produce the sound even when soft-bodied is an evolutionary response to predation. Protecting themselves in their most vulnerable time is very important.

However, not much is known about their sensitivity to vibration. It is hypothesized that the way lobsters interpret the acoustic signals they receive is by tiny structures in their inner ear called stereocilia. When the sound reaches the ears of the lobsters it shakes the eardrum which displaces the endolymphatic fluid in the inner, and deflects the stereocilia. The stereocilia then convert the sound into nerve impulses. However, scientists believe that lobsters cannot hear unless at very close range, so they have come to the conclusion that their sound production is not intended to help them communicate with their own species, but instead to talk to other species. As a matter of fact, it is believed that the lobsters can't even hear the sounds they produce.

Additionally, Panulirus cygnus also communicate by the use of chemical signals or pheromones. They release these in their urine through little holes found at the base of their antennae. These pheromones are carried by currents to nearby lobsters who use their chemoreceptors (on their antennules) to detect the signals. Scientists suppose that males and females have different pheromones in their urine, which allow rock lobsters to distinguish between male and female in other rock lobsters. Other uses for the chemical signals are not yet known.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

It takes about 1 year for Panulirus cygnus to complete its entire larval cycle. During the larval cycle there are about 11 complex stages. At the end of a year, the juvenile rock lobsters are considered puerulus. In this puerulus stage, they are normally 25 millimeters long, and look like minature adult lobsters. In this stage they have an unusually low sensitivity to temperature changes, which works as an energy saving adaptation. In the puerulus stage they drift back to the coast and sink to the bottom where they stay for 2 or 3 years while they slowly mature. In this stage, the rock lobster could possibly grow 4 centimeters per year, which is very rapid. This rapid growth slows down as the lobster ages. The rock lobsters reach their full size at around 10 years of age.

Western rock lobsters must, like many crustaceans, shed their exoskeleton in order to grow. Molting occurs frequently in the younger ages, and approximately one or two times a year in maturing lobsters. The lobsters will hide for a few days after they molt because they have a new soft shell and are defenseless against predators. It is also a possibility that the lobsters may eat what they molt so they can retain the calcium in it to aid in forming their new shell.

  • Anger, D. K., R. Vonk. 2001. The Biology of the Decapod crustacean larvae. Helgoland, Germany: A.A. Balkema Publishers.
  • Imgrund, J. 1999/2000. "Western Rock Lobster: Panulirus cygnus" (On-line ). Accessed 03/12/03 at http://aqwa.com.au/lobster.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Scientists have yet to find a reliable way to determine the age of lobsters. Nonetheless, they can make guesses based on geographical location, and the temperature of the water, among other things. It is thought that lobsters can live in the wild for 100 years or more. But, it is expected that average lobsters only live to be 30 years old in the wild. However, in a marine research laboratory aquarium, the oldest rock lobster to survive was 28 years old, had a 165mm carapace, and weighed 7 pounds.

Although, the number for the average age of lobsters is skewed - lobsters that reach that age are very lucky. Of all the eggs that the females release, only 1/10 of 1% survives for more than a few weeks. For example, if a female laid 10,000 eggs, 10 would survive.

Range lifespan

Status: wild:
100 (high) years.

Range lifespan

Status: captivity:
28 (high) years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

It is a very difficult task to see lobsters mating in the wild because they have very private habits and remain hidden under rocks. When they do come out it is at night, because they are nocturnal, so it is difficult to watch their behavior in their natural environment without affecting their actions in any way. Despite the setbacks, scientists do know a few things about the mating systems of lobsters in general. The knowledge that they have was acquired from laboratory observations in artificial habitats.

When the time is approaching for the females to shed their shells, they initiate this pairing by repeatedly going to where the male lobster lives. The pair lives together for a couple days and when the females are about to molt they jab the male they are living with. The male Panulirus cygnus approach the soft females, and turn them over onto their backs. The males proceed to put their ventral surface to the females in a head-to-head fashion. Spermatophores emerge from the male's genital opening and the male rock lobsters transfer a packet of sperm to the females, and stick this jelly-like fluid matrix of sperm between her last pair of legs. It appears as a tar spot. The freshly placed sperm go into the oviduct of the females, and as the fluid matrix disappears, the sperm are released to fertilize the female's eggs. This whole mating process takes about 30-60 seconds.

In a day or two the female lobsters move to a different shelter to finish hardening their shells. No sooner do the females leave the males' shelter, does another female move in to go through the same process she just completed. This goes on until all the females in that male's area have their eggs fertilized. For females, mating is serial monogamy because only one exclusive pair is formed during each breeding season. However, for males, mating is serial polygyny because they form exclusive bonds with a series of females during each breeding season.

Mating System: monogamous ; polygynous

The breeding season for adults is during the late winter. They generally spawn for the first time between the ages of 6 and 7. The females have a final pre-spawning molt and then wait for optimum weather and food conditions. It is possible that the lunar cycle or rising water temperature produce the biological urge for courtship.

The eggs are laid between September and January and depending on the size of the female, 300,000-700,000 eggs are produced. Over a number of weeks the eggs develop inside the mother until the cephalothorax is filled with a bright orange, caviar mass.

Once hatched, the rock lobster larvae, phyllosoma, go to the surface with the other planktonic animals. They move by the current of the ocean, or by attaching to a jellyfish. Understandably, morality rates are very high during this 9-11 month time period.

Breeding season: Late Winter

Average number of offspring: 300,000-700,000 eggs laid.

Average gestation period: 95 days.

Average time to independence: few minutes.

Average age at sexual or reproductive maturity (female): 6-7 years.

Average age at sexual or reproductive maturity (male): 6-7 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

The eggs are eventually laid, after 3-4 hours of work, through holes at the base of the third pairs of legs. When the eggs are laid, they are attached to the setae (fine hairs) on the abdominal swimmerets of the females. The females carry the eggs while they develop for a maximum of 95 days, and then they hatch. Females carrying eggs are called, berried, because the appearance of the developing eggs is similar to that of berries. Once the eggs are hatched, the mothers leave the babies to fend for themselves.

Parental Investment: no parental involvement; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus cygnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCATGAGCAGGAATAGTAGGAACTTCTCTAAGACTTATTATTCGAGCTGAGCTAGGTCAACCAGGTAGTTTCATTGGAGAC---GATCAAATTTACAACGTAGTAGTAACTGCTCACGCTTTCATTATAATTTTCTTTATGGTTATGCCCATTATGATTGGAGGATTTGGAAACTGATTAGTTCCTATTATATTAGGAGCTCCTGATATAGCTTTCCCCCGGATAAATAACATAAGGTTTTGACTTCTCCCTCCGTCCCTAACTCTACTACTTGCAGGTGGTGCAGTCGAGAGGGGTGCTGGTACTGGTTGAACAGTTTACCCCCCTTTATCAGCTGGTGTCGCACACGCGGGGGCATCGGTTGATCTGAGGATCTTCTCCCTTCACCTGGCGGGTGTTTCATCTATTCTAGGTGCTGTTAATTTTATTACCACTGTGATTAACATGCGCTCTTCTGGCATAACTCTTGATCGAATACCACTTTTCGTATGATCAGTTTTCATTACAGCCATCTTACTTCTTCTATCTCTGCCCGTCTTAGCCGGAGCTATTACTATACTTCTCACTGATCGAAATTTAAATACTTCCTTTTTTGATCCGGTCGGAGGTGGAGACCCAATTCTCTATCAACATTTGTTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus cygnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Butler, M., Cockcroft, A., MacDiarmid, A. & Wahle, R.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, HT, Soulsby, A.-M. & Whitton, F.

Justification
Panulirus cygnus has been assessed as Least Concern. This species is harvested throughout its range along the coast of Western Australia, however catch per unit effort data indicates stability in the stock. The fishery is well managed and appropriate restrictions have been introduced when catch declines have been highlighted by ongoing monitoring. There is substantial research supporting this fishery that ensures it remains sustainable. Continued monitoring and regulation mean this species is currently not threatened by extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Humans may affect the lobsters greatly, but they also help them to flourish so that the population is not depleted. For example, the fisheries: limit the fishing season, have a minimum size requirement for the caught lobsters, offer protection for the breeding females, limit how many lobsters each fisherman can take, and restrict the size of the lobster pots.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no detailed population data for this species. It has been said to be an abundant species in areas of suitable habitat, with the Western Australia Rock Lobster fisheries catching over 10,000 mt annually (Holthuis 1991).



Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is harvested throughout its range. Overall harvesting does not pose a threat to this species, however it does appear to be more vulnerable in some areas where exploitation is greatest (Caputi et al. 2008). Despite coastal development along Western Australia the species does not appear to impacted by this threat (The Fisheries Department 2004).


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The following fishery management measures are in place to ensure sustainable practices (The Department of Fisheries 2004):

  • From 1993-1994 a period of 2.5 months has been set at the start of the open season when a minimum size limit of 77 mm is in place to allow immature lobsters a chance to migrate and mature.
  • It is illegal to take mature females when in breeding condition, when carrying eggs or tar spots (sperm packets)
  • Pot size and number are regulated, as well as escape gaps (54 mm) to allow immature individuals to escape. Hours when, and depths at which, pots are pulled to the surface are regulated.
  • Any new technology that may enhance fishing efforts and increase exploitation (such as underwater video cameras) must be assessed and approved.
Research regarding this fishery includes: computer models of the lobster fishery used as the basis for catch prediction and stock management; commercial catch monitoring (Abrolhos Fremantle, Lancelin, Jurien and Dongara sites); and the study of egg production, peurelus (between larvae and juvenile) settelment and age at maturity (The Department of Fisheries 2004).

The Department of Fisheries staff act as advisers to the Rock Lobster Industry Advisory Committee (RLIAC) and there is close consultation between this body, the Department of Fisheries, the fishing industry and the Minister on the status of the rock lobster fishery. Public submissions are welcomed and considered by the RLIAC (The Department of Fisheries 2004). Continued monitoring will ensure the population of this species is sustained, and prevent over-exploitation.

In 2000, the fishery was awarded the Marine Stewardship Council certificate for operating in an ecologically sustainable way.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Western rock lobsters do not really have a negative impact on humans economically, but it appears as though it is leading to that. This is because there is such a high demand around the world for lobster, and the lobster fisheries around the world are being pushed to their limits to meet the demand. It is predicted that because of this exploitation, some fisheries may fail in some countries within the next five years because of over fishing in those areas. More focus is now being placed on trying to grow lobsters in captivity in order to boost production while simultaneously keeping the population of wild lobsters safe.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Panulirus cygnus are seen as one of the best and most desired seafoods in the world and in Australia, Western rock lobsters are the richest commercial fishing industry. Each year, 10,000-11,000 tons of lobster are caught and more than $300 million is made per year off of this industry. It is considered to be the oldest and the best managed fishery in the world. This fishing is done off the coast of Western Australia between November and June every year. The fisheries target the whites, the lobsters that are freshly molted, as they are leaving the shallow reef areas.

The species is marketed fresh, but the greatest percentage of them is exported as frozen tails.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Panulirus cygnus

An adult Panulirus cygnus in an aquarium

Panulirus cygnus is a species of spiny lobster (family Palinuridae), found off the west coast of Australia. Panulirus cygnus is the basis of Australia's most valuable fishery, making up 20% of value of Australia's total fishing industry, and is identified as the western rock lobster.

Contents

Description

The species has five pairs of legs that are used to move across the ocean floor, the fifth set possessing claws in the female, and six smaller pairs are located at the mouth. The eyes are located at the ends of stalks. They vary in colour from a brownish purple to a pale colour. The exoskeleton is segmented, and must be shed as the animal grows. The largest recorded specimen is 5.5 kilograms (12 lb), but a maximum weight of 5.5 kg (12 lb) is considered typical. The average accepted form of measurement, that of the carapace, is from 80 to 100 millimetres (3.1 to 3.9 in) in length.[2]

Distribution

The range of the species is along the coast of Western Australia, from Hamelin Bay to the North West Cape, and at islands such as the Houtman Abrolhos.[2] The larvae of the species develop in the meadows of seagrasses of Western Australia, migrating out from these toward the deeper ocean and coral reefs such as the Abrolhos Islands.

Fisheries

The annual catch is 8,000–15,000 tons. The value of production in 2003/2004 was A$248 million. The fishery was one of the first in the world to be certified as ecologically sustainable by the Marine Stewardship Council. The western coastline contains eight species of rock lobster, but the harvest primarily targets Panulirus cygnus.[3]

The species is known to have been caught since the settlement of Swan River Colony, in 1829, and expanded as the larger populations were discovered in remote locations of the state. The industry came to be centred at the Houtman Abrolhos, at the edge of the continental shelf, where the mature crays occur in large populations. A cannery was established at the islands to export the seasonal catch in the 1930s. The early industry claimed to harvest up to fourteen species, however, research into the Abrolhos populations recognised only three.[4]

The population harvested near Dongara is reputed to be a greater delicacy amongst consumers, although investigation of that catch did not reveal any morphological distinctions from other populations.[4]

Taxonomic history

Panulirus cygnus was previously classified under several taxonomic arrangements, the first description was published in 1962. The author, Ray George, recognised the similarities to other species of Panulirus, such as Panulirus longipes, but regarded the number of distinctions qualified this as a separate species. The generic name is an anagram of Palinurus, as with other genera of its nominal family Palinuridae, the spiny lobsters. The name is derived from Palinurus, mentioned in the Aeneid, whose improper burial caused his soul to drift near the coast to the open seas; an appropriate metaphor for the habits of the spiny lobsters that develop near the coast and migrate away from it.[4]

The specific epithet is named for an emblem of Western Australia, Cygnus atratus, the Black Swan. The holotype was collected by George in a pool at Rottnest, at a depth of 1 metre, and preserved at the state's museum (WAM);[5] other specimens in their collection were reclassified as paratypes. George's taxon was demoted to a subspecies until the 1970s, when a revision recognised the population as a species. The recognition of the species was relevant to the conservation of its related fishing industry, it is unique to the region and could not be naturally repopulated from other regions.[4]

Common names of the species include "western rock lobster", "Australian spiny lobster",[6] "crayfish" or "crays". The common names of "lobster", "homard" and "yabbie" are also used to refer to this species, along with many other crustaceans.[2]

See also

References

  1. ^ M. Butler, A. Cockcroft, A. MacDiarmid & R. Wahle (2009). "Panulirus cygnus". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved 22 August 2011. 
  2. ^ a b c Saunders, D. (2004). "Panulirus cygnus". Animal Diversity Web. Retrieved 12 January 2009. 
  3. ^ "Western Rock Lobster". Commercial Fisheries of Western Australia. West Australian Fisheries Department. 
  4. ^ a b c d H. Gray (1992-1999). The western rock lobster, Panulirus cygnus (Volume 1). Geraldton, Western Australia: Westralian Books. ISBN 0-9594105-3-8. 
  5. ^ Type locality: "Radar Reef, Rottnest Island, Western Australia (32°00'S 115°30'E), in reef pool at depth of 1 metre".
  6. ^ "Panulirus cygnus George, 1962". Integrated Taxonomic Information System. Retrieved 22 August 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!