Overview

Distribution

Range

E Colombia to Venezuela, Guianas, n Brazil and ne Peru; Trinidad.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Icterus chrysocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATCGGGACCCTATACTTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAGGTCTACAACGTAGTTGTTACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGCAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCTACAATTGAAGCAGGCGTAGGCACAGGTTGAACAGTATACCCCCCACTAGCAGGCAACTTAGCCCATGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACACCTAGCCGGTATCTCTTCAATCCTAGGGGCAATCAACTTCATTACAACCGCAATCAACATAAAACCCCCTGCTCTATCACAATACCAAACTCCCCTATTCGTATGATCAGTCTTAATTACCGCAGTACTCCTGCTCCTATCTCTCCCAGTTCTCGCCGCAGGGATTACAATACTTCTCACAGACCGCAACCTCAACACTACATTCTTTGATCCTGCCGGGGGAGGAGACCCTGTACTATACCAACATCTCTTCTGATTCTTCGGCCATCCAGAAGTCTACAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Icterus chrysocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Moriche Oriole

The moriche oriole (Icterus cayanensis chrysocephalus) is a passerine bird in the New World family Icteridae. It is unrelated to Old World orioles (family Oriolidae). It is a breeding resident in the tropics of eastern South America. This bird is noted for its close association with the palm Mauritia flexuosa (moriche, buriti, ita, ité, etc.).

This ecologically distinct bird was formerly treated as a species Icterus chrysocephalus. It was eventually found to be embedded in the epaulet oriole (I. cayanensis) clade. Thus, for example the AOU since 2005[verification needed] has lumped the moriche oriole into I. cayanensis. The subspecific structure of I. cayanensis is still rather puzzling.[1]

This is a slim bird, 8.7 in (22 cm) long and weighing 1.5 oz (42 g), with a long tail and thin decurved bill. It has mainly black plumage, apart from a bright yellow crown, rump, thighs and wing epaulets. The sexes are similar, but the juvenile bird is dark brown rather than black, with duller yellow patches.

The song of the moriche oriole is a squeaky whistling heaaa-wheeooo-heaaa. This is an often-conspicuous species near its favoured tree, and usually occurs singly or in pairs.

The mochique oriole breeds from eastern Colombia, Venezuela, Trinidad and the Guianas, and south to eastern Ecuador, Paraguay and northern Brazil. The Trinidadian population may have originated from recent colonisation or escapes. It is most common from sea level up to 1,600 ft (500 m) ASL, but here and there it reaches up to around 3,300 ft (1,000 m) in the eastern foothills of the Andes, which mark the western border or its range.[2]

The moriche oriole is a bird closely associated with moriche palms (Mauritia flexuosa), and it is found in the forests, swamps or savannah where that tree occurs. This bird eats mainly insects, but will also take nectar and some fruit. Its nest is a long hanging basket of grass and other plant fibres, suspended from the end of a moriche palm branch. The normal clutch is two dark-spotted pale blue or white eggs.

It is affected to some extent by trapping for the cagebird trade, but can cope with heavy disturbance to its habitat as long as some moriche palms remain.

Footnotes[edit]

  1. ^ SACC (2008)
  2. ^ Salaman et al. (2002)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!