Overview

Distribution

Arctic - temperate waters
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Temperate-boreal waters of the North Pacific, off the coasts of both North America and Asia. Does not occur in European waters

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

As differences between species are very subtle, for general morphological description, see genus diagnosis.

Female:
Cephalothorax slender in lateral view, cephalosome rounded, scarcely protruding anteriad of rostrum. The posteroventral margins of the first 2 thoracic segments without, sometimes with small spiniform processes. Abdominal segments long, the mediodorsal surface abdominal segments 1-3 without sensilla or integumental pore. Seminal receptacle small. The ratio of the lengths of the 1st and 2nd basipodites of P4 is less than 1.5.

Male:
Prosome stocky, anterodorsal sensilla short. Mediodorsal surfaces of urosomal segments without sensilla.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Female: 0,94-1,53 mm
Male: 0,84-1,17 mm

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Morphological differentiation between species of Pseudocalanus is very ambiguous, identification bordering impossible in juvenile stages. Adult P. newmani can be distinguished from other species of the genus by the following features:
- Longest abdomen relative to cephalothorax length
- No integumental pores or sensilla on dorsal surface of abdominal segments

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Pseudocalanus newmani Frost, 1989
Catalog Number: USNM 234174
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Collector(s): B. Frost
Year Collected: 1973
Locality: Vicinity Of Vancouver, North Pacific Ocean
Depth (m): 225
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Pseudocalanus newmani Frost, 1989
Catalog Number: USNM 234175
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): B. Frost
Year Collected: 1965
Locality: Vicinity Of Vancouver, North Pacific Ocean
Depth (m): 225
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found in inshore and coastal areas.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 7 - 225
  Temperature range (°C): 0.234 - 1.708
  Nitrate (umol/L): 5.539 - 12.541
  Salinity (PPS): 32.046 - 32.706
  Oxygen (ml/l): 7.746 - 8.635
  Phosphate (umol/l): 1.119 - 1.653
  Silicate (umol/l): 19.227 - 31.877

Graphical representation

Depth range (m): 7 - 225

Temperature range (°C): 0.234 - 1.708

Nitrate (umol/L): 5.539 - 12.541

Salinity (PPS): 32.046 - 32.706

Oxygen (ml/l): 7.746 - 8.635

Phosphate (umol/l): 1.119 - 1.653

Silicate (umol/l): 19.227 - 31.877
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Oceanic, epi-bathypelagic

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocalanus newmani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATAGCTGGTGCATGAGCAGGTATAATTGGGACAGGGTTAAGAATAATTATTCGAATAGAGTTAGGTCAAGCAGGATCATTGATTGGAGAT---GATCAGATTTATAATGTAGTTGTTACTGCACATGCATTTATTATAATTTTTTTCATGGTCATACCAATCTTAATTGGGGGATTTGGCAACTGATTAGTACCTCTAATACTGGGTGCGGCAGATATGGCTTTTCCACGTATAAATAATATAAGGTTTTGATTTTTAATACCAGCCTTAATTATACTTCTTTCTAGATCTTTAGTAGAAAGAGGNGCAGGTACAGGATGAACCGTATATCCTCCTCTTTCAAGAAATATTGCCCATGCTGGTGGATCTGTGGACTTTGCCATTTTTTCTTTACACCTCGCAGGGGTAAGATCTATCTTAGGTGCTGTTAATTTTATTAGTACTCTAGGTAATCTGCGAGTATTTGGTATATTGCTAGACCAGATACCATTGTTTGCTTGATCCGTACTAGTTACAGCTATTCTTTTACTCCTTTCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTGACGGACCGAAACTTAAATACCTCTTTCTACGATGTTGGTGGGGGTGGGGATCCTATCTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocalanus newmani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!