Physical Description

Type Information

Paratype for Calanus tonsus Brady, 1883
Catalog Number: USNM 85613
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Year Collected: 1875
Locality: South Pacific Ocean
Vessel: Challenger R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 0 - 625
  Temperature range (°C): 0.435 - 20.846
  Nitrate (umol/L): 0.292 - 42.304
  Salinity (PPS): 31.901 - 36.634
  Oxygen (ml/l): 0.584 - 7.979
  Phosphate (umol/l): 0.032 - 3.256
  Silicate (umol/l): 0.744 - 122.307

Graphical representation

Depth range (m): 0 - 625

Temperature range (°C): 0.435 - 20.846

Nitrate (umol/L): 0.292 - 42.304

Salinity (PPS): 31.901 - 36.634

Oxygen (ml/l): 0.584 - 7.979

Phosphate (umol/l): 0.032 - 3.256

Silicate (umol/l): 0.744 - 122.307
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neocalanus tonsus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAAAGTGATTATGATCTTGCAATCATAAAGACATTGGTACACTTTACTTATTGGCTGGAGCATGATCAGGTATAATTGGTACAGGATTGAGTATAATTATTCGATTAGAATTAGGACAAGCGGGATCTCTTATTGGAGAT---GACCAAATTTATAATGTAGTTGTGACAGCACATGCATTTATTATAATTTTTTTTATGGTTATGCCCATCTTAATTGGCGGGTTTGGTAACTGATTAGTACCTCTAATACTAGGGGCTGCAGATATGGCATTTCCTCGTATAAATAATATGAGATTTTGATTTTTGATACCAGCTCTTATTATACTACTATCTAGCTCATTAGTCGAGAGAGGGGCAGGTACAGGTTGAACAGTATATCCACCATTGTCAAGTAATATTGCCCATGCTGGAGGTTCTGTTGATTTTGCTATTTTTTCATTACATTTAGCAGGTGTTAGGTCTATTTTAGGAGCTGTGAATTTTATTAGTACACTTGGTAATTTACGTGTTTTCGGTATATTATTAGATCGTATGCCATTATTTGCCTGGGCTGTGTTAATTACTGCGGTTTTATTATTATTATCATTACCTGTACTAGCAGGTGCTATTACAATGCTTTTAACTGACCGGAACTTAAATACTTCATTCTACGACGTAGGAGGTGGTGGAGATCCAATTTTATATCAGCATCTTTTTTGATTTTTTGGACATCCGGAGGTTTACATTTTAATTTTACCAGGATTTGGACTTATTTCTCACATTGTTGCTCAAGAGAGTGGTAAAAAAGAAACATTTGGGGTATTAGGTATAATTTATGCTATACTAGCCATTGGTATCTTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGGATAGATGCAGATACGCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neocalanus tonsus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!