Overview

Distribution

Range Description

This species is found in Brunei, Indonesia (Bangka, Belitung, Karimata, southeastern Sumatra, Serasen in the South Natuna Islands, and Kalimantan Borneo), and Malaysia (Sabah and Sarawak) (Groves 2005). The distribution in Sumatra is unknown but is thought to be delimited by the Musi River.

Tarsius bancanus saltator
Confined to the island of Belitung (Billiton), Indonesia.

Tarsius bancanus natunensis
Confined to Serasan (Sirhassen) in the South Natuna Islands, and possibly nearby Subi Island, Indonesia.

Tarsius bancanus borneanus
Occurs in Brunei, Indonesia (Kalimantan Borneo and Karimata Islands) and Malaysia (Sabah and Sarawak Borneo) and on the island of Karimata (Indonesia).

Tarsius bancanus bancanus
Occurs in southeastern Sumatra and the island of Bangka, Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tarsius bancanus is found in the Melay archipelago, on the islands of Sumatra and Borneo, as well as on several smaller islands. It can also be found on southern Sumatra, but its range is thought to be restricted in the north by teh Musi River.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

  • 2003. Tarsiidae (Tarsiers). Pp. 91-100 in Grzimek's animal life encyclopedia, Vol. 14, Second Edition. Detroit: Gale.
  • Niemitz, C. 1984. Biology of tarsiers. Stuttgart: Gustav Fischer Verlag.
  • Shekelle, M., I. Yustian. 2010. "Tarsius bancanus" (On-line). The IUCN Red List of Threatened Species. Accessed May 25, 2011 at http://www.iucnredlist.org/apps/redlist/details/21488/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most striking feature of tarsiers is their large eyes, which are larger than those of any other mammal, with respect to body size. Tarsius bancanus is small. Males are 12 cm in length on average and range in mass from 122 to 134 g. This species is sexually dimorphic, as females are on average 10 grams lighter than males. Its fur is grey and/or brown and does not help distinguish it from the other tarsiers species. It has a very long tail, nearly twice as long as its head and body. The tale is scaly in appearance, with the exception of a tuft of hair near the distal end. In general, tarsiers have extraordinarily long hind legs (the longest legs of any mammal in proportion to body length), which contributes to their primary mode of locomotion as vertical clingers and leapers. The forelimbs are rather shorter. All four limbs end in long, thin digits, and the front digits have disc-like pads.

Range mass: 122 to 134 g.

Average length: 129 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Crompton, R., P. Andau. 1986. Locomotion and habitat utilization in free-ranging Tarsius bancanus : A preliminary report.. Primates, 27: 337-355.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can live in both primary and secondary forest, as well as along the coasts or on the edge of plantations (Niemitz 1979). This is often described as a lowland species, most common below 100 m elevation; however, there is at least one record from 1,200 m from the Bukit Baka-Bukit Raya National Park in western Kalimantan (Gorog and Sinaga in press).

The species is 100% carnivorous, eating mainly insects (including beetles, grasshoppers, cockroaches, butterflies, moths, praying mantis, ants, phasmids, and cicadas), but also small vertebrates (including bats, snakes, and birds) (Niemitz 1979). These animals are nocturnal and exhibit adaptations for vertical clinging and leaping modes of locomotion and prey capture (Roberts 1994). They spend a majority of their time below 2 meters off the ground and only 5% above 3 meters (Niemitz 1979, 1984; Crompton and Andau 1986, 1987).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred habitat of Tarsius bancanus is primary and secondary forest, although it can also be found in mangroves and forest edges. It is a vertical clinger and leaper, and generally does not venture into more open areas unless both prey and small-diameter trees to cling to are present. It can also be found along the forest edge and in fruit plantations. Although it is generally described as a lowland species, residing below 100 m in elevation, sightings above 1200 m have been documented.

Range elevation: 0 to 1200 m.

Habitat Regions: tropical

Terrestrial Biomes: rainforest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Western Tarsiers are exclusively carnivorous, most commonly feeding on insects. They consume almost any kind of insect, as well as some small vertebrates, including birds, mammals and reptiles. The prey upon anything that moves, including animals as large as themselves. They have even been sighted preying upon spotted-winged fruit bats tangled in mist nets.

Animal Foods: birds; mammals; reptiles; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

  • Hodgkison, R., T. Kunz. 2006. Balionycteris maculata. Mammalian Species, 793: 1-3.
  • Jablonski, N. 1994. Feeding Behavior, Mastication, and Tooth Wear in the Western Tarsier (Tarsius bancanus).. International Journal of Primatology, 15: 29-60.
  • Rosenberger, A. 2010. The Skull of Tarsius: Functional Morphology, Eyeballs, and the Nonpursuit Predatory Lifestyle. International Journal of Primatology, 31: 1032-1054.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Western tarsier are primarily insectivorous, and may help control insect pest populations. In addition, they are host to various species of intestinal worm (Moniliformes tarsii and Moniliformes echinosorexi), tapeworms and roundworms. Little else is known of parasites specific to this species.

Commensal/Parasitic Species:

  • intestinal worm, (Moniliformes tarsii)
  • intestinal worm, (Moniliformes echinosorexi)
  • tapeworms, (Cestoda)
  • roundworms, (Nematoda)

  • Deveaux, T., G. Schmidt, M. Krishnasamy. 1988. Two new species of Moniliformis (Acanthocephala: Moniliformidae) from Malaysia. The Journal of Parasitology, 74/2: 322-325.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is little information available on the major predators of western tarsiers. Their brown/grey pelage allows them a certain degree of camouflage and helps decrease risk of predation. More importantly, their arboreal nature keeps them out of reach of most predators, however, snakes and arboreal mammals (e.g., slow lorises) are likely their primary predators. They are likely most vulnerable when they are chewing, as they are unable to hear approaching predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tarsius bancanus relies mostly on sight for foraging and depends upon sound and smell for intraspecific communication. Of all tarsier species, T. bancanus is the least communicative. Where touching and grooming are common in most other species, it has only been documented between mothers with young and mating pairs. Territory is marked with urine, scent from glands in the ano-genital region, and secretions from the epigastric gland. Tarsius bancanus communicates with potential mates via squeaks and whistles, and physical contact prior to copulation is usually initiated by grasping the tail.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about tarsiers' lifespan, but is estimated for T. bancanus at 12 years. The relative lack of predators and limited fecundity of tarsiers points to a relatively long lifespan.

Average lifespan

Status: wild:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.3 years (captivity) Observations: This animal has a gestation time unusually big for his size (Ronald Nowak 1999). One captive specimen lived 16.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

It was previously assumed that tarsiers, including Tarsius bancanus, had a high incidence of monogamy. However, recent evidence suggests that the mating system is highly dependent on prey availability, and that T. bancanus is most likely polygynous. Females signal their readiness to mate both chemically and visually. When in estrus, females exhibit labial swelling and scent-rubbing near territorial borders shared with males. Once males identify estrous females, the often perform "courtship calls."

Mating System: polygynous

Tarsius bancanus mates non-seasonally, and gestation lasts 178 days on average. It has 1 offspring per mating period, which can be up to 25% of the mother body weight. This species generally has slightly more than one birth per year, with an average inter-birth timespan of 258 days. Tarsius bancanus are moderately precocial at birth, as they are able to climb but not leap. Most young are weaned by 80 days after parturition.

Breeding interval: On average every 258 days.

Breeding season: Mating is nonseasonal.

Average number of offspring: 1.

Average gestation period: 178 days.

Average birth mass: 24 g.

Average weaning age: 80 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 24.6 g.

Average gestation period: 178 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
920 days.

After parturition, male western tarsiers are aggressively chased away by the mother until the baby reaches maturity. Captive males have been known to kill their young. Young do not develop locomotor independence for about four weeks; until then, they are "parked" while mothers forage for prey. Unlike many other primates, mother's rarely carry young, which may be due to the large-size of newborns. Other than providing milk and protection from the father, mothers offer limited care to their offspring.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Niemitz, C. 1984. Biology of tarsiers. Stuttgart: Gustav Fischer Verlag.
  • Roberts, M. 1994. Growth, development, and parental care in the western tarsier (Tarsius bancanus) in captivity: Evidence for a "slow" life-history and nonmonogamous mating system. International Journal of Primatology, 15: 1-28.
  • Simons, E. 1986. Reproductive Cycles in Tarsius bancanus. American Journal of Primatology, 11: 207-215.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tarsius bancanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGTTGATTATTCTCAACCAATCACAAAGACATCGGAACTTTATACCTATTATTTGGTGCCTGAGCTGGAATAGTAGGAACAGCCCTCAGTCTTCTAATCCGAGCGGAACTCGGACAACCAGGAGCCCTCTTAGGAGATGACCAAATCTATAATGTAATCGTCACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATACCCATTATAATCGGGGGTTTCGGCAACTGACTAGTACCCCTCATAATTGGAGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGCTTCTGATTATTACCACCATCTTTCCTCCTACTTATAGCCTCCTCAATAGTTGAAGCTGGAGCAGGGACCGGTTGAACCGTCTATCCCCCTCTAGCAGGAAACCTAGCCCACGCAGGAGCCTCTGTAGATCTTACTATCTTCTCCCTCCACTTAGCAGGAGTATCCTCTATCCTAGGGGCTATCAACTTCATCACAACTATTATTAATATAAAACCTCCCGCCATATCACAATATCAAACTCCTTTATTCGTGTGATCCGTCCTTATTACCGCTGTACTATTATTACTATCCCTTCCAGTCCTAGCAGCAGGAATTACTATACTTTTAACTGATCGAAACCTTAATACAACCTTTTTTGATCCCGCCGGAGGAGGAGACCCTATCCTCTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTATATATCCTTATTCTCCCCGGATTTGGTATAATTTCCCACATTGTAACCTATTATTCTGGAAAAAAAGAACCATTCGGCTACATAGGCATAGTCTGAGCTATAATGTCTATTGGCTTCTTAGGTTTCATTGTCTGAGCCCACCATATATTTACAGTAGGAATAGACGTAGATACCCGAGCATACTTTACATCCGCCACTATAATTATTGCTATTCCAACTGGCGTAAAAGTATTCAGCTGACTAGCAACTCTACACGGAGGGAACATTAAATGATCTCCTGCTATACTATGAGCCCTAGGATTCATCTTTCTATTTACCGTAGGAGGCCTGACCGGTATTGTCCTTGCTAATTCTTCCCTTGATATTGTTCTCCACGATACCTATTATGTAGTAGCACACTTTCACTACGTCCTATCAATAGGAGCAGTATTCGCAATTATAGGAGGCTTCGTTCACTGATTCCCACTATTCTCAGGATTTATCCTCCACCCAACCTGAGCCAAAACCCACTTCGCAATTATATTTGTAGGAGTTAATTTAACATTTTTCCCTCAACATTTCCTCGGACTATCAGGCATGCCCCGACGGTACTCCGACTACCCTGACGCATATACTATATGAAATACTATTTCCTCCATAGGTTCATTCATCTCTCTCACTGCAGTAATACTAATAGTCTTCATAATCTGAGAAGCTTTTGCTTCAAAACGAGAGGTACTAGCAATTGAACTTCCAACTACAAACCTTGAGTGACTTCACGGCTGCCCCCCACCCTACCATACATTTGAAGAACCTACCTATGTAAAGGCATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tarsius bancanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Shekelle, M. & Yustian, I.

Reviewer/s
Mittermeier, R.A., Rylands, A.B. (Primate Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
Over the last 20 years (approximately three generations), at least 30% of the habitat has been lost, qualifying this species as Vulnerable where population reduction is inferred based on habitat loss. In addition, levels of exploitation can be regionally high for the pet trade, yet impacts at the population level are unknown. Further research is needed (taxonomic, threat and ecological) in order to further assess this species.

History
  • 2000
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tarsius bancanus is classified as "vulnerable" on the IUCN's Red List of Threatened Species, primarily due to a 30% habitat loss over the last 20 years. Despite this, more information is needed to determine overall population trends. Major threats include habitat loss due to forest conversion to palm plantations and collection of individuals for the illegal pet trade. Despite the fact that this species is 100% carnivorous, it is sometimes considered an agricultural pest and appears to be especially vulnerable to contamination from agricultural pesticides. This species is listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) and is protected by law in Indonesia and Malaysia.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Density has been variously calculated at 80 animals/km2 in Sarawak (Niemitz 1979, 1984), 15-20 individuals/km2 in Sabah (Crompton and Andau 1986, 1987), and 19-20 individuals/km2 in Belitung (I. Yustian pers. comm.). Based on satellite studies of the extent of available habitat on Belitung Island, Yustian (2006) estimated a total population for T. b. saltator of 29,440 (Yustian unpubl. data).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The principle threat is habitat loss due to forest conversion, especially due to expanding oil palm plantations, fires and logging. The species is collected for the illegal pet trade, particularly, it is thought, in the vicinity of Lampung and Way Kambas National Park. It is wrongly considered a pest to agricultural crops, and can suffer, directly and indirectly, from contamination from agricultural pesticides.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is protected by law in Indonesia and in Malaysia, and is listed in CITES Appendix II.

T. b. bancanus occurs in a few protected areas, such as Bukit Barisan Selatan National Park, Kerinci Seblat National Park, Way Kambas National Park (Indonesia) (M. Richardson pers. comm.); T. b. borneanus occurs in several protected areas, including Tasek Merimbun Sanctuary (Brunei); Bukit Baka Bukit Raya National Park, Kayan Mentarang National Park (Indonesia); Bako National Park, Gunung Malu National Park, Kinabalu National Park, Sapagaya Forest Reserve, Semengo Forest Reserve, Sepilok Forest Reserve (Malaysia) (M. Richardson pers. comm.); while
T. b. saltator and T. b. natunensis do not occur in any protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Tarsius bancanus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Although Tarsius bancanus may help control insect pest populations throughout its range, there are no known positive effects of this species on humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!