Overview

Brief Summary

Biology

The white-handed gibbon was considered to make life-long pair bonds, but recent studies show some serial monogamy with occasional partner changes, and even non-monogamous groupings (10). Generally, however, groups consist of a mated pair and their offspring. An elaborate duet sung between males and females is thought to maintain pair bonds as well as to mark and defend the pair's territory. These gibbons breed year round, usually producing one young every two to three years (2) (8). The gestation period lasts seven to eight months and young are weaned at 18 months (10). Juveniles reach adult size at six years but remain with their natal group until they reach sexual maturity at around nine years old (8) (10). Parental care is predominantly given by the mother but the father and elder siblings also help raise young (8). Lifespan in the wild lasts 25 to 30 years (10). These gibbons are active during the day, which is mostly spent foraging for food and feeding (10). Primarily frugivorous, the white-handed gibbon will also eat immature leaves, flowers, stems, shoots, buds, insects, eggs and the occasional bird (2) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

A beautiful and captivating primate, the white-handed gibbon is a master of agility (5). As true brachiators, gibbons are much admired for their remarkably fast, yet seemingly effortless, suspensory motion through the trees (6). The white-handed gibbon possesses the long arms and hands typical of gibbon species, which are perfectly suited to this pendulous swinging from branch to branch. Despite lacking a tail, the gibbon's sense of balance is nevertheless acute, and it can even be found walking on its hind legs along branches high above the ground, characteristically raising its arms above its head for balance (5). Individuals vary in colour from dark brown or black to red-buff and pale fawn, but always with a white fringe framing the black face and white upper sides of the hands and feet (7) (8). Males and females are very similar in size and can have all colour variants (7). Its unmistakable call, a loud whooping sound, is enhanced by a sound-amplifying throat sac and can be heard from a great distance (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species as a whole is found in northern Sumatra (Indonesia), throughout Peninsular Malaysia (except for a narrow strip between the Perak and Mudah Rivers, where H. agilis occurs), north through southern and eastern Myanmar (east of the Salween River), most of Thailand (though not in the north-east), and marginally into southern China. The break in distribution between Perak and Muda/Thepa Rivers on the Malaysian Peninsula is genuine (T. Geissmann pers. comm.). The species also occurs in a small area of northwestern Lao PDR (west of the Mekong River). The range formerly extended into southeastern Thailand, where it was parapatric with H. pileatus (Brockelman 1978; Marshall and Sugardjito 1986; Marshall et al. 1972; T. Geissmann pers. comm.). It is unclear whether the population on Phuket (Thailand) is native, but they certainly have been introduced or reintroduced.
In China, the species is currently known only from Nangunhe Nature Reserve in the Prefectury of Lincang, south-west Yunnan (Geissmann et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hylobates lar is found in the tropical rainforests of southern and S.E. Asia, including Thailand, Malaysia, Indonesia, and the area encompassing Southern China to Eastern Burma.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the tropical rainforests of southern and Southeast Asia (8), in the countries of China, Myanmar, Thailand, Malaysia and Indonesia (9). The Malaysian lar (Hylobates lar lar) is found in Malaysia and southern Thailand, the central lar (H. l. entelloides) in southern Myanmar and southern Thailand, Carpenter's lar (H. l. carpenteri) in eastern Myanmar, north-western Thailand and Laos, the Yunnan lar (H. l. yunnanensis) in the Yunnan province of southern China and the Sumatran lar (H. l. vestitus) in Indonesia (northern Sumatra) (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hylobates lar weighs 5.5 kg on average. Individuals are either dark brown to black in color, or red buff color with white face-rings, hands, and feet. Colors are not specific to sex. Males and females can show either color, but their white "accents" are always present.

Range mass: 4.5 to 6 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in evergreen, semi-evergreen, and mixed evergreen-deciduous forest (sometimes known as ?dry evergreen? forest, in the northern parts of its range), and is known to utilize regenerating secondary forest and selectively logged forest (Johns 1985). In northwestern Thailand, white-handed gibbons utilize patches of dry evergreen, mixed deciduous, and bamboo forest near Karen settlements if they are not hunted (Yimkao and Srikosamatara 2006). This is predominantly a lowland species (below 1,000-1,500 m).

Like most other species of gibbon they consume a largely frugivorous diet that includes mainly figs, as well as young shoots, leaves, some flowers, and insects. Gibbons, unlike most macaques and leaf monkeys that often share their habitats, swallow nearly all the seeds that they ingest, making them potentially important as seed dispersers. Certain species of fruits that require the consumer to remove a tough outer cover appear to rely almost entirely on gibbons for seed dispersal (Bartlett 1999; Ellefson 1974; Gittins and Raemaekers 1980; MacKinnon and MacKinnon 1980; Palombit 1992, 1997; Ungar 1995).

Generation length in white-handed gibbons is on the order of 15 years. They mature late, with females maturing at 8-10 years and males at 8-12 years, and have one offspring every 3 to 5 years (Brockelman et al. 1998; W. Brockelman pers. comm.). If a female loses a baby she may come into estrus sooner, but the average inter-birth interval in a population at carrying capacity is about 3.5 years (W. Brockelman pers. comm.). Average group size in H. lar generally increases with latitude, illustrating that group size is not a very useful species-specific character in gibbons. This reflects a general trend of increasing birth rate with latitude found in many vertebrate groups. Average group size has been reported at 2.7 (Chivers 1978) and 3.3 (Ellefson 1974) in Peninsular Malaysia, 3.7 in central Thailand (Brockelman and Srikosamatara 1993), and 4.4 (Carpenter 1940) and 4.9 (Yimkao and Srikosamatara 2006) in northern Thailand. The average home range sizes are 44-54 ha on the Malayan peninsula (Ellefson 1974; Gittons and Raemaekers 1980; MacKinnon and MacKinnon 1980) and about 16 ha in the Khao Yai National Park in Thailand (Chivers 1984).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species is found in the tropical rainforest, where it occupies only the upper canopy. These gibbons rarely, if ever, descend to the forest floor. This fact alone makes them very hard to study.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This arboreal species inhabits primary or secondary semi-deciduous monsoon forests and tropical evergreen forests (9). Occupying only the upper canopy, these gibbons rarely, if ever, descend to the forest floor (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Lar gibbons are one of the pickiest eaters in the primate world. They are mainly frugivores, but they will also eat other plant matter. They consume ripe fruit only, and only new leaves and buds. They have several adaptations for feeding. One of them is brachiating locomotion, which involves swinging from branch to branch by their arms. This style of motion allows them to reach the periphery of the tree canopy, where most of their food is found. Other adaptations include high cusps on their back teeth to help grind plant matter, and a gut adapted for a folivorous diet.

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As frugivores, these animals are probably important in seed dispersal.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Incidents of predation on these animals have not been recorded. It is likely that because they inhabit the upper canopy, they do not often fall victim to terrestrial predators like leopards. Any predators they do have must be able to reach them in the canopy, where the thin tree brances do not permit heavier animals to travel. Because of this, it seems that to the extent that predation occurs, these animal fall victim to raptors.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in all species of gibbon, these animals use vocalizations to defend their territorial boundaries. In addition to these vocal communications, primates are known to use a variety of visual signals, such as facial expressions and body postures, to communicate. Tactile communication, such as grooming and playing, is important within the family unit.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Data are not available for this species, but other members of the genus Hylobates are known to reach ages of 44 years in captivity. Wild individuals are thought to live around 25 years. It is likely that H. lar is like other members of the genus in terms of its lifespan.

Average lifespan

Sex: male

Status: captivity:
40.0 years.

Average lifespan

Sex: female

Status: captivity:
40.0 years.

Average lifespan

Status: wild:
25.0 years.

Average lifespan

Status: captivity:
31.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 56 years (captivity) Observations: A female wild-born specimen acquired by San Antonio Zoo in 1954 died in 2008 at an estimated 56 years of age. Her male companion, also acquired in 1954, passed away in 2005 at the estimated age of 51 years (John Gramieri, pers. comm.).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Lar gibbons are monogamous.

Mating System: monogamous

Gibbons have no fixed season for breeding. The gestation period lasts around seven months, and females produce approximately one young every two years. Young are weaned by the time they are about two years old. In most gibbons, reproductive maturity is reached around 8 years of age. Although they are probably completely capable of caring for themselves at an earlier age, young gibbons do not leave their family group until they reach sexual maturity.

Breeding interval: Females produce approximately one young every two years.

Breeding season: These gibbons breed year round.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 7 months.

Average weaning age: 24 months.

Average age at sexual or reproductive maturity (female): 8 years.

Average age at sexual or reproductive maturity (male): 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 307.2 g.

Average gestation period: 217 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2555 days.

Although infants are weaned within a two year period, young stay with the family group for a few additional years. Although the bulk of parental care, including nursing and grooming, is the responsibility of the mother, the father and older siblings also help out.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hylobates lar

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0544-06|NC_002082|Hylobates lar| GACCGCTGGTTATTCTCCACAAACCATAAAGATATTGGAACACTATACTTACTATTTGGCGCATGGGCCGGGGTTCTGGGCACGGCCTTA---AGCCTCCTCATTCGAGCCGAACTGGGTCAACCCGGCAATCTCCTAGGCAAT---GACCATATCTATAACGTCATTGTAACGGCCCACGCATTCGTCATAATCTTCTTCATAGTAATACCCATCATAATTGGGGGCTTTGGCAACTGGCTCGTCCCTCTGATA---ATCGGCGCTCCCGATATGGCATTCCCTCGTATAAATAACATAAGCTTCTGACTTCTTCCCCCCTCATTCCTACTGCTGCTTGCCTCCGCTATAGTAGAAGCCGGCGCCGGAACAGGATGAACGGTCTACCCTCCGCTGGCAGGAAACTACTCCCACCCAGGAGCCTCTGTCGACCTA---ACCATTTTTTCTCTACACCTGGCCGGAGTATCATCTATCCTAGGGGCTATTAACTTCATTACCACAATCATCAACATAAAACCCCCAGCCATATCCCAATACCAAACACCCCTCTTTGTCTGATCCGTCCTAATTACAGCCGTCCTACTCCTCCTCTCCCTACCAGTCCTAGCCGCC---GGCATTACTATACTACTAACGGACCGCAACCTCAACACTACTTTCTTTGACCCCGCTGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTATATTCTCATCCTACCAGGCTTCGGAATGATCTCACATATCGTAACACACTACTCAGGAAAAAAA---GAACCGTTCGGATATATAGGCATAGTCTGAGCCATAATATCAATTGGCTTCCTAGGTTTCATTGTCTGAGCCCACCATATATTCACAGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hylobates lar

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Brockelman, W. & Geissmann, T.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species is listed as Endangered as it is believed to have undergone a decline of more than 50% in the last three generations (45 years) due to rampant forest loss and loss of mature individuals due to hunting.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

This species is threatened for a several reasons. These gibbons are hunted for meat in some areas. Live capture for the pet trade also poses a serious problem. In many Asian countries, it is "fashionable" to own your own primate, and this has led to the death of many gibbons either at the time of capture or during transport. The final, and greatest, threat to these gibbons is deforestation. Rainforests are disappearing at an alarming rate due to logging and agricultural, leaving forest species with an ever smaller region in which to live. Some efforts are being made to save these primates, such as national parks and reserves, but they are not very effective. Laws protect them from live capture, but they are rarely enforced. Listed in CITES Appendix 1.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Near Threatened (LR/nt) on the IUCN Red List 2004 (1), and listed on Appendix I of CITES (4). Subspecies: Malaysian lar (Hylobates lar lar), central lar (H. l. entelloides), Carpenter's lar (H. l. carpenteri) and Sumatran lar (H. l. vestitus) are all classified as Lower Risk / Near Threatened (LR/nt), and the Yunnan lar (H. l. yunnanensis) is classified as Critically Endangered (CR – C2a, D) on the IUCN Red List 2004 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population densities for this species range from 2.4 groups/km2 in Ketambe, Sumatra (Palombit 1992) to 0.7-2.6 groups/km2 in Kuala Lompat and Tanjong Triang on the Malayan peninsula (Ellefson 1974; MacKinnon and MacKinnon 1980; Raemaekers 1977) to 6.5 groups/km2 in Khao Yai National Park, Thailand (Brockelman cited in Chivers 2001). A few smaller, fragmented populations survive in southern Peninsular Thailand and northwestern Malaysia, perhaps together numbering in the low thousands. There are no recent estimates of the populations in the Tenasserim section of Myanmar, northern Sumatra and in southern Peninsular Malaysia (W. Brockelman pers. comm.).

In China, during the 1960s, there were estimated to be 200 individuals on both sides of the Nangunhe River. In 1988, the date of last sighting, it was estimated that there were less than 10 groups. And in 1992, the last survey date, the authors did not find any direct evidence for the species? persistence, but estimated that three groups may remain with about 10 individuals in total. Although not specified in the original publications, this estimate appears to be based on interview data (Geissmann et al. 2006; Guo and Wang 1995; Lan and Wang 2000).

No population estimates are currently available for Indonesia, Malaysia, and Myanmar. While for Lao PDR, there are no reliable estimates, but for Nam Poyi National Protected Area (which is the only protected area from which they are recorded), the species is uncommon to rare, perhaps numbering in the mid- to high-hundreds (Boonratana 1997). In some parts of Thailand there are several populations where numbers are at least in the thousands, though in northern Thailand they are now very rare. The largest population is in Kaeng Krachan National Park, which probably has on the order of 3,000-4,000 individuals. The Western Forest Complex may well have on the order of 10,000 animals, and likely upwards of 1,000 survive in the western part of Khao Yai National Park, as well as in Phukhieo Wildlife Sanctuary and Nam Nao National Park. A few smaller populations survive in the south, for example Khao Sok (W. Brockelman pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threat to this species is hunting (having replaced even forest clearance as the top threat); they are hunted both for subsistence food use and for the pet trade. Hunting pressure varies across the range, but takes place even within protected areas. Much of the hunting is done by villagers exploiting Aquilaria spp. trees prized for their aromatic wood, and other forest products (W. Brockelman pers. comm.).

Construction of roads through protected areas (for example, the Security Highway through Nam Poyi in Lao PDR, the north-south highway in Peninsular Malaysia) may also pose a threat since it promotes forest clearance and strip development, possibly increases fragmentation, and increases access by hunters into protected areas. Ongoing localized forest loss due to shifting agriculture and commercial plantations of palm oil poses a threat. On northern Sumatra, most of the lowland forests have been logged out and the threat of Ladia Galaskar, a network to link the west and east coasts of Aceh province, means that much of the remaining forest is at risk.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Rapid loss of habitat poses the principle threat to gibbons, placing their future in great peril (3) (8). With breathtaking speed the forests of Southeast Asia are being cut down due to logging and agriculture, leaving forest inhabitants an ever smaller region in which to live. This species is sometimes hunted for its meat (8) and the capture of young gibbons for the pet trade is rampant in some countries, particularly Thailand (5). Frequently the mother is shot so that the young can be taken (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Hylobates lar, like all gibbons, is a nationally protected species in all the countries across its range, and is listed under CITES Appendix I. In most of its range it is confined to protected conservation areas (for example in Thailand, where no significant populations survive outside of protected areas). However, in most countries, these areas are not well patrolled, even if they are well managed for tourism. There is an urgent need for improved protection of these areas, ideally involving local communities that should benefit from as well as participate in management. Illegal use of forest products, as well as poaching, is common in most protected areas. Inadequate management and protection, rather than forest destruction, are the main long-term threats and conservation efforts must seek to identify the hunters and incorporate them into new management priorities.

Further survey work is needed to determine current population numbers within protected areas across the range. One such priority area is southwest Yunnan, where it is unclear whether the species still survives (W. Brockelman pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The white-handed gibbon is protected from international trade by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (4). Other efforts are being made to save these primates, such as national parks and reserves, but they are not terribly effective as they are often poorly supervised and laws against capture un-enforced (8). The highest priority in protecting this primate must be given to preserving adequate areas of suitable habitat (3). Action is required now if we are to prevent this agile and intelligent lesser ape from becoming more critically endangered.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hylobates lar is not known to have any negative impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Lar gibbons do not play a very important role economically. They provide some food for humans, but not on a large scale. Although many primates are used for biomedical reasearch, gibbons are not often used for this purpose. They are occasionally captured for the pet trade.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lar gibbon

The lar gibbon (Hylobates lar), also known as the white-handed gibbon, is a primate in the Hylobatidae or gibbon family. It is one of the better-known gibbons and is often seen in zoos.

Contents

Range

Lar gibbons have the greatest north-south range of any of the gibbon species.[3] They are found in Indonesia, Laos, Malaysia, Myanmar and Thailand.[4]Their range historically extended from southwest China to Thailand and Burma south to the whole Malay Peninsula in primary and secondary tropical rain forests. It is also present in the northwest portion of the island of Sumatra. In recent decades, especially, the continental range has been reduced and fragmented. Lar gibbons are likely extinct in China, but if they still exist, they would only be found in southwest Yunnan, their former range.[5]

Habitat

Lar gibbon are usually found in lowland dipterocarp forest, hill dipterocarp forest, and upper dipterocarp forest, including primary lowland and submontane rainforest, mixed deciduous bamboo forest, and seasonal evergreen forest. They are not usually found higher than 1200 meters above sea level.[6] The gibbon genus is highly allopatric, usually separated by large rivers. As a result, their range extends through southern and eastern Myanmar, but only east of the Salween River. They are found through the Malay Peninsula. Lar gibbons also exist west of the Mekong River in northwestern Laos and northern Sumatra.[7] The lar gibbon can be found living in sympatry with several other primates and apes, including orangutans (Pongo pygmaeus), siamangs (S. syndactylus), pileated gibbons (Hylobates pileatus), purple-faced langurs (Trachypithecus spp.), Thomas's langur (Presbytis thomasi), slow loris (Nycticebus coucang), and several macaques (Macaca spp.)[8] In Thailand alone, lar gibbons probably number between 15,000 and 20,000.[9]

Appearance

Climbing Lar Gibbon at Cincinnati Zoo

The fur coloring of the lar gibbon varies from black and dark-brown to light-brown, sandy colors. The hands and feet are white-colored, likewise a ring of white hair surrounds the black face. Both males and females can be all color variants, and the sexes also hardly differ in size. Gibbons are true brachiators, propelling themselves through the forest by swinging under the branches by their arms. Reflecting this mode of locomotion, the white-handed gibbon has curved fingers, elongated hands, extremely long arms and relatively short legs, giving it an intermembral index of 129.7, one of the highest of the primates.[10] As with all apes, the number of caudal vertebrae has been reduced drastically, resulting in the loss of a functional tail. Gibbons have tough, bony padding on their buttocks, known as the ischial callosities, or sitting pads.

Diet and dentition

The lar gibbon is considered frugivorous with fruit constituting 50% of its diet, but leaves (29%) are a substantial part, with insects (13%) and flowers (9%) forming the remainder [10]. In the wild, lar gibbons will eat a large variety of foods, including figs and other small, sweet fruits, liana fruit, tree fruit and berries, as well as young leaves, buds and flowers, new shoots, vines, vine shoots, and insects, including mantids and wasps, and even birds' eggs.[11] Its dental formula is 2.1.2.3/2.1.2.3, the generalized formula for Old World monkeys and apes. The dental arcade is U-shaped, and the mandible is thin and light. The incisors are broad and flat, while the molars have low, rounded cusps with thick enamel. The most noticeable characteristic of the dentition of Hylobates lar is the presence of large, dagger-like canines in both the upper and lower jaw. These canines are not sexually dimorphic.

Behavior

Lar gibbons are diurnal and arboreal, inhabiting rain forests. Lar gibbons are usually active for an average of 8.7 hours per day, leaving their sleeping sites right around sunrise and entering sleeping trees an average of 3.4 hours before sunset. On average, lar gibbons spend their days feeding (32.6%), resting (26.2%), traveling (24.2%), in social activities (11.3%), vocalizing (4.0%) and in intergroup encounters (1.9%), although actual proportions of activities can change significantly over the course of the year.[12] They rarely come to the ground, instead using their long arms to brachiate through the trees. With their hooked hands, they can move swiftly with great momentum, swinging from the branches. Although they rarely come to the ground naturally, while there, they walk bipedally with arms raised above their heads for balance. Their social organization is dominated by monogamous family pairs, with one breeding male and one female along with their offspring. When a juvenile reaches sexual maturity, it is expelled from the family unit. However, this traditional conception has come under scrutiny. Long-term studies conducted in Khao Yai National Park in Thailand suggest their mating system is somewhat flexible, incorporating extra-pair copulations, partner changes and polyandrous groupings.[13]

Lar Gibbon hoots.ogv
Pair of lar gibbons hooting in Copenhagen Zoo

Family groups inhabit a firm territory, which they protect by warding off other gibbons with their calls. Each morning, the family gathers on the edge of its territory and begins a "great call", a duet between the breeding pair. Each species has a typified call and each breeding pair has unique variations on that theme. The great call of Hylobates lar is characterized by its frequent use of short hoots with more complex hoots, along with a "quavering" opening and closing.[14] These calls are one of the traits used determining species differences among the gibbons.[15]

Reproduction

Sexually, they are similar to other gibbons. Mating occurs in every month of the year, but most conceptions occur during the dry season in March, with a peak in births during the late rainy season, in October.[16] On average, females reproduce for the first time at about 11 years of age in the wild, much later than in captivity. [17] Gestation is six months long on average, and pregnancies are usually of a single young. Young are nursed for approximately two years, and full maturity comes at about eight years. The life expectancy of the lar gibbons in the wild is about 25 years.[18]

Status

Video showing a lar gibbon monkey holding on to cage bars, a seemingly sad look in its eyes that dart back and forth
A lar gibbon looks out from its cage at Ueno Zoo.

Lar gibbons are threatened in various ways: they are sometimes hunted for their meat, sometimes a parent is killed to capture young animals for pets, but perhaps the most pervasive is the loss of habitat. Lar gibbon habitats is already threatened by forest clearance for the construction of roads, shifting agriculture, ecotourism, domesticated cattle and elephants, forest fires, subsistence logging, illegal logging, new village settlement, and palm oil plantations.[19]

Subspecies

There are five subspecies of lar gibbon:[1][15]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 179-180. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100761. 
  2. ^ Brockelman, W. & Geissmann, T. (2008). Hylobates lar. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Barlett, T.Q. (2003). Intragroup and intergroup social interactions in white-handed gibbons.. Int J Primatol. pp. 239–59.. 
  4. ^ Brandon-Jones, D (2004). Asian primate classification. Int J Primatol. pp. 97–164.. 
  5. ^ Brandon-Jones D, Eudey AA, Geissmann T Groves CP, Melnick DJ, Morales JC, Shekelle M, Stewart (2004). Asian primate classification. Int J Primatol. pp. 97–164.. 
  6. ^ Chivers DJ (1972). The siamang and the gibbon in the Malay Peninsula.. Gibb Siam 1. pp. 103–35.. 
  7. ^ Brockelman WY, Reichard U, Treesucon U, Raemaekers JJ. (1998). Dispersal, pair formation and social structure in gibbons (Hylobates lar).. Behav Ecol Sociobiol 42. pp. 329–39.. 
  8. ^ Ellefson JO (1974). A natural history of white-handed gibbons in the Malayan peninsula.. Gibb Siam 3. pp. 1–136.. 
  9. ^ Geissmann T. (2007). Status reassessment of the gibbons: results of the Asian primate red list workshop 2006. Gibb J 3. pp. 5–15.. 
  10. ^ a b Rowe, Noel. Pictorial Guide to the Living Primates. East Hampton, N.Y. : Pogonias Press, 1996.
  11. ^ Carpenter CR. (1940). A field study in Siam of the behavior and social relations of the gibbon (Hylobates lar).. Comp Psychol Mono 16. pp. 1–212.. 
  12. ^ Bartlett TQ. (2009). The gibbons of Khao Yai: seasonal variation in behavior and ecology. Upper Saddle River. Pearson Prentice Hall.. pp. 170. 
  13. ^ Sommer, V. & Reichard, U. (2000). "Rethinking Monogamy: The Gibbon Case". In P. Kappeler, ed.. Primate Males. Cambridge: Cambridge University Press. pp. 159–168. 
  14. ^ Geissmann, Thomas. "Sound Gallery: Hylobates lar". http://gibbons.de/main/sound/03lar.html. Retrieved 2009-04-29. 
  15. ^ a b Geissmann, Thomas. "Gibbon Systematics and Species Identification". http://gibbons.de/main/system/intro.html. Retrieved 2009-04-29. 
  16. ^ Barelli C, Heistermann M, Boesch C, Reichard UH. (2008). Mating patterns and sexual swellings in pair-living and multimale groups of wild white-handed gibbons, Hylobates lar.. Anim Behav 75(3). pp. 991–1001.. 
  17. ^ Barelli C, Boesch C, Heistermann M, Reichard UH. (2008). Female white-handed gibbons (Hylobates lar) lead group movements and have priority of access to food resources.. Behaviour 145. pp. 965–81.. 
  18. ^ Barelli C, Heistermann M, Boesch C, Reichard UH. (2007). Sexual swellings in wild white-handed gibbon females (Hylobates lar) indicate the probability of ovulation.. Horm Behav 51. pp. 221–30.. 
  19. ^ Yimkao P, Srikosamatara S. (2006). Ecology and site-based conservation of the white-handed gibbon (Hylobates lar L.) in human-use forests in Mae Hong Son province, northern Thailand.. Nat Hist Bull Siam Soc 54. pp. 109–38.. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!