Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Dorylus nigricans terrificus Santschi, 1923e PDF: 275 (s.w.) DEMOCRATIC REPUBLIC OF CONGO. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

[[ soldier ]]. Long: 13 mm. (15 avec les mandibules). D'un rouge brunatre, thorax plus violace, avec le dos plus obscur, la tete, moins ses appendices, noir brunatre, le dessus noir. Celle-ci est lisse et luisante sauf son plan anterieur qui, comme le thorax, est submat, densement et finement ponctue; le reste de l'insecte lisse et luisant. Dessus du corps glabre, seuls quelques poils en dessous et au bout du gastre ainsi qu'a l'epistome. La pubescence abonde sur les tarses et les funicules, plus clairsemee sur le reste des pattes, rare ou absente ailleurs.

 

Tete robuste, trapezoidale, presque aussi large devant que longue (4,2 - 4,3 mm.); les cotes beaucoup plus convexes que chez arcens Westw. et surtout que chez burmeisteri Shuck. Le bord posterieur relativement etroit (2 mm. d'un angle a l'autre) et plus echancre que chez arcens . Les articles du funicule nettement plus longs que chez burmeisteri . Mandibules comme chez arcens mais plus robustes et plus epaisses, avec la dent basale aussi petite ou meme plus petite. Thorax comme chez arcens . Petiole un peu plus long et plus large derriere, a peu pres comme chez burmeisteri .

 

" [[ worker ]], (ii mm. sans les mandibules). Celles-ci different des burmeisteri de meme taille par leur dent basale plus petite et par la presence de denticules le long du bord interne de l'intervalle de cette

 

(1) D'apres des exemplaires types recus du R. P. Wassmann et revises par lui-meme.

 

dent a l'apicale. Cette partie de la mandibule est du reste plus large et plus deprimee chez terrificus . La tete est plus large que chez burmeisteri . Le petiole plus etroit derriere que chez cette derniere, et moins luisant que chez le [[ soldier ]].

 

' [[ worker ]]. (8 a 9 mm.). Tete plus large et plus convexe lateralement que chez burmeisteri et arcens de meme taille. La dent preapicale developpee comme chez cette derniere, mais l'intervalle dente qui la separe de la basale plus rectiligne, la mandibule etant plus large et deprimee.

 

[[ worker ]] '. (5 mm.). Tete plus brusquement et fortement retrecie derriere que chez burmeisteri et arcens ; les cotes plus convexes. La sculpture un peu moins luisante que chez le [[ soldier ]].

 

Congo belge: Kasai, Kondue (E. Luja) (Mus Tervueren). Doit se placer a cote de burmeisteri dont elle differe surtout par sa robustesse.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus terrificus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGGATCCTAGGATCCTCAATAAGAATAATTATCCGTTTAGAATTAGGTACATGTGGAACTATAATTTTTAAT---GATCAAGTTTTTAACGTTATTGTAACTAGACATGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGTTTTGGTAATTTTATTGCACCTTTAATGATTGGAGCCCCTGACATAGCATACCCTCGAATAAATAATATAAGATTTTGACTTCTTCCTCCTTCAATTACTTTAATAATTATAAGAAATTTCATTAATATAGGGTCAGGAACTGGTTGAACTGTATACCCGCCCTTAGCCTCAAATATTTATCATAATGGAGCGTCAATTGATCTAACTATTTTTTCTTTACATATTGCAGGAATATCATCAATTTTAGGGGCCATTAATTTTATCTCAACAATCATTAATATACATCATAAAAATTTAACCATAGATAAAACTCCATTATTTGTTTGATCTATTCTAATTACGGCAATTCTTTTACTTCTTTCATTACCAGTTTTAGCAGGAGCAATTACCATACTATTAACTGACCGTAATATTAATACATCATTTTTTGATCCATCAGGAGGGGGTGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus terrificus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!