Overview

Distribution

Arctic Ocean, Azores Exclusive Economic Zone, Bay of Biscay, Bering Sea, British Isles, California, East Atlantic, Eastern Central Atlantic, Eastern Central Pacific, European waters (ERMS scope), Faeroe Exclusive Economic Zone, FAO fishing area 18, FAO fishing area 67, French Exclusive Economic Zone [Atlantic part], Greenlandic Exclusive Economic Zone, Gulf of St. Lawrence, Indo-Pacific, Irish Exclusive economic Zone, Irish Sea, Japanese Exclusive Economic Zone, Kristianiafjord, Lofoten, Manicouagan, Mediterranean Sea, New England (USA), North Atlantic, North East Pacific, North Pacific, North Sea, North West Atlantic, Northwestern North Pacific, off Japan , Norwegian Exclusive Economic Zone, Okhotsk Sea, Portuguese Exclusive Economic Zone, Saguenay Fjord, Saint Lawrence River, Scotland, Skagerrak, Skagerrak strait, South Atlantic, St. Lawrence Estuary, Suruga Bay, United States part of the North Atlantic Ocean, West Central Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), Saguenay Fjord, northern Gaspe waters, lower St. Lawrence estuary, Upper Laurentian Channel (bathyal zone off Sept- Iles), Laurentian Channel (bathyal zone)(=Honguedo Strait), lower Laurentian Channel (bathyal zone as far as Cabot Strait: Cape North, N.S., St. Paul Island to Cape Ray, NL.); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 5 - 1889
  Temperature range (°C): 1.845 - 10.585
  Nitrate (umol/L): 12.245 - 44.232
  Salinity (PPS): 34.092 - 35.590
  Oxygen (ml/l): 0.552 - 6.109
  Phosphate (umol/l): 0.766 - 3.323
  Silicate (umol/l): 5.191 - 188.299

Graphical representation

Depth range (m): 5 - 1889

Temperature range (°C): 1.845 - 10.585

Nitrate (umol/L): 12.245 - 44.232

Salinity (PPS): 34.092 - 35.590

Oxygen (ml/l): 0.552 - 6.109

Phosphate (umol/l): 0.766 - 3.323

Silicate (umol/l): 5.191 - 188.299
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boreomysis arctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCTTATATTTTATGTTTGGTGCATGAGCAGGAATAGTTGGTTCTTCTCTTAGAGTTTTGATTCGTTTAGAGTTAGGTCAACCTGGTAGTTTAATTGGGGATGATCAAATTTACAATGTGATTGTAACAGCACATGCTTTTGTAATGATTTTTTTTATGGTTATACCTATTATAATTGGTGGGTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATATAAGGTTTTGGTTACTTCCTCCTTCTTTGACTCTTCTTTTAATAAGGGGTATAGTAGAAAGGGGGGTTGGTACAGGTTGGACTGTGTATCCTCCTTTAGCATCTAATATTTCTCATGTTGGGGCTTCTGTTGATTTAGGTATTTTTTCATTACATTTAGCAGGTGCTTCTTCTATTCTTGGGGCGGTTAATTTTATTTCTACAGTTATCAATATACGAGCAGTTGGTATAACTATAGATCGAGTACCTTTATTTGTTTGGTCTGTTTTTATTACAGCTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTGTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCAACAGGAGGTGGAGATCCTATTTTATATCAGCATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Boreomysis arctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!