Overview

Distribution

Gulf of St. Lawrence (unspecified region), Saguenay Fjord, northern Gaspe waters, lower St. Lawrence estuary, Upper Laurentian Channel (bathyal zone off Sept- Iles), Laurentian Channel (bathyal zone)(=Honguedo Strait), lower Laurentian Channel (bathyal zone as far as Cabot Strait: Cape North, N.S., St. Paul Island to Cape Ray, NL.); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

mesopelagic
  • Muller, H.G. (1993) . World catalogue and bibliography of the recent Mysidacea. 238p
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 5 - 1889
  Temperature range (°C): 1.845 - 10.585
  Nitrate (umol/L): 12.245 - 44.232
  Salinity (PPS): 34.092 - 35.590
  Oxygen (ml/l): 0.552 - 6.109
  Phosphate (umol/l): 0.766 - 3.323
  Silicate (umol/l): 5.191 - 188.299

Graphical representation

Depth range (m): 5 - 1889

Temperature range (°C): 1.845 - 10.585

Nitrate (umol/L): 12.245 - 44.232

Salinity (PPS): 34.092 - 35.590

Oxygen (ml/l): 0.552 - 6.109

Phosphate (umol/l): 0.766 - 3.323

Silicate (umol/l): 5.191 - 188.299
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Depth range

300-1900m
  • Muller, H.G. (1993) . World catalogue and bibliography of the recent Mysidacea. 238p
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boreomysis arctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCTTATATTTTATGTTTGGTGCATGAGCAGGAATAGTTGGTTCTTCTCTTAGAGTTTTGATTCGTTTAGAGTTAGGTCAACCTGGTAGTTTAATTGGGGATGATCAAATTTACAATGTGATTGTAACAGCACATGCTTTTGTAATGATTTTTTTTATGGTTATACCTATTATAATTGGTGGGTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATATAAGGTTTTGGTTACTTCCTCCTTCTTTGACTCTTCTTTTAATAAGGGGTATAGTAGAAAGGGGGGTTGGTACAGGTTGGACTGTGTATCCTCCTTTAGCATCTAATATTTCTCATGTTGGGGCTTCTGTTGATTTAGGTATTTTTTCATTACATTTAGCAGGTGCTTCTTCTATTCTTGGGGCGGTTAATTTTATTTCTACAGTTATCAATATACGAGCAGTTGGTATAACTATAGATCGAGTACCTTTATTTGTTTGGTCTGTTTTTATTACAGCTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTGTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCAACAGGAGGTGGAGATCCTATTTTATATCAGCATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Boreomysis arctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!