Overview
Distribution
Arctic Ocean, Azores Exclusive Economic Zone, Bay of Biscay, Bering Sea, British Isles, California, East Atlantic, Eastern Central Atlantic, Eastern Central Pacific, European waters (ERMS scope), Faeroe Exclusive Economic Zone, FAO fishing area 18, FAO fishing area 67, French Exclusive Economic Zone [Atlantic part], Greenlandic Exclusive Economic Zone, Gulf of St. Lawrence, Indo-Pacific, Irish Exclusive economic Zone, Irish Sea, Japanese Exclusive Economic Zone, Kristianiafjord, Lofoten, Manicouagan, Mediterranean Sea, New England (USA), North Atlantic, North East Pacific, North Pacific, North Sea, North West Atlantic, Northwestern North Pacific, off Japan , Norwegian Exclusive Economic Zone, Okhotsk Sea, Portuguese Exclusive Economic Zone, Saguenay Fjord, Saint Lawrence River, Scotland, Skagerrak, Skagerrak strait, South Atlantic, St. Lawrence Estuary, Suruga Bay, United States part of the North Atlantic Ocean, West Central Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Zimmer, C. (1933). Mysidacea. The fauna of the North Sea and Baltic, 23(10.g3). Akademiische Verlagsgesellschaft: Leipzig, Germany. 29-69 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1096
-
TATTERSALL, W.M. & O. TATTERSALL (1951): The British Mysidacea. Ray Soc., London, 460pp
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6643
-
TATTERSALL, W.M. (1908): The Schizopoda and Isopoda collected by the J. Mar. Biol. Ass. U.K., new ser., 8: 189-196
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6644
-
II, N. (1964): Fauna Japonica, Mysidae. - Biogeogr. Soc. Japan, 610pp
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6611
-
Muller, H.G. (1993) . World catalogue and bibliography of the recent Mysidacea. 238p
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=4199
-
van der Land, J.; Brattegard, T. (2001). Mysidacea, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 293-295
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1408
-
Mark, S., Provencher, L., Albert, E. et Nozères, C. 2010. Cadre de suivi écologique de la zone de protection marine Manicouagan (Québec) : bilan des connaissances et identification des composantes écologiques à suivre. Rapp. tech. can. sci. halieut. aquat. 2914 : xi + 121 p
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=150858
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
-
Bossé, L., B. Sainte-Marie et J. Fournier (1996). Les invertébrés des fonds meubles et la biogéographie du fjord du Saguenay. Rapp. tech. can. sci. halieut. aquat. 2 132: vii + 45 p.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=153966
-
Préfontaine, G. & P. Brunel. 1962. Liste d'invertébrés marins recueillis dans l'estuaire du Saint-Laurent de 1929 à 1934. Naturaliste Canadien, Quebec 89(8-9):237-263, fig. 1.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=109070
-
Lagardère, J.P., & H. Nouvel. 1980. Les Mysidacés du talus continental du golfe de Gascogne. II. Familles des Lophogastridae, Eucopiidae et Mysidae (Tribu des Erythropini exceptée).-- Bulletin du Muséum National d´Histoire Naturelle, sér. 4, Section A, No. 2: 375-412; Section A, No. 3: 845-887.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6614
-
Mauchline, J. & M. Murano (1977) World list of the Mysidacea, Crustacea. - J. Tokyo Univ. Fish., 64 (1): 39-88
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9412
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
-
Fukuoka, K. (2009). Deep-sea mysidaceans (Crustacea: Lophogastrida and Mysida) from the Northwestern North Pacific off Japan, with descriptions of six new species National Museum of Nature and Science Monographs 39: 405-446.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=163951
Trusted
Gulf of St. Lawrence (unspecified region), Saguenay Fjord, northern Gaspe waters, lower St. Lawrence estuary, Upper Laurentian Channel (bathyal zone off Sept- Iles), Laurentian Channel (bathyal zone)(=Honguedo Strait), lower Laurentian Channel (bathyal zone as far as Cabot Strait: Cape North, N.S., St. Paul Island to Cape Ray, NL.); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
bathyal, infralittoral and circalittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
mesopelagic
-
Muller, H.G. (1993) . World catalogue and bibliography of the recent Mysidacea. 238p
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=4199
Trusted
Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.
Environmental ranges
Depth range (m): 5 - 1889
Temperature range (°C): 1.845 - 10.585
Nitrate (umol/L): 12.245 - 44.232
Salinity (PPS): 34.092 - 35.590
Oxygen (ml/l): 0.552 - 6.109
Phosphate (umol/l): 0.766 - 3.323
Silicate (umol/l): 5.191 - 188.299
Graphical representation
Depth range (m): 5 - 1889
Temperature range (°C): 1.845 - 10.585
Nitrate (umol/L): 12.245 - 44.232
Salinity (PPS): 34.092 - 35.590
Oxygen (ml/l): 0.552 - 6.109
Phosphate (umol/l): 0.766 - 3.323
Silicate (umol/l): 5.191 - 188.299
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 13 samples.
Environmental ranges
Depth range (m): 5 - 1889
Temperature range (°C): 1.845 - 10.585
Nitrate (umol/L): 12.245 - 44.232
Salinity (PPS): 34.092 - 35.590
Oxygen (ml/l): 0.552 - 6.109
Phosphate (umol/l): 0.766 - 3.323
Silicate (umol/l): 5.191 - 188.299
Graphical representation
Depth range (m): 5 - 1889
Temperature range (°C): 1.845 - 10.585
Nitrate (umol/L): 12.245 - 44.232
Salinity (PPS): 34.092 - 35.590
Oxygen (ml/l): 0.552 - 6.109
Phosphate (umol/l): 0.766 - 3.323
Silicate (umol/l): 5.191 - 188.299
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Boreomysis arctica
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TACCTTATATTTTATGTTTGGTGCATGAGCAGGAATAGTTGGTTCTTCTCTTAGAGTTTTGATTCGTTTAGAGTTAGGTCAACCTGGTAGTTTAATTGGGGATGATCAAATTTACAATGTGATTGTAACAGCACATGCTTTTGTAATGATTTTTTTTATGGTTATACCTATTATAATTGGTGGGTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATATAAGGTTTTGGTTACTTCCTCCTTCTTTGACTCTTCTTTTAATAAGGGGTATAGTAGAAAGGGGGGTTGGTACAGGTTGGACTGTGTATCCTCCTTTAGCATCTAATATTTCTCATGTTGGGGCTTCTGTTGATTTAGGTATTTTTTCATTACATTTAGCAGGTGCTTCTTCTATTCTTGGGGCGGTTAATTTTATTTCTACAGTTATCAATATACGAGCAGTTGGTATAACTATAGATCGAGTACCTTTATTTGTTTGGTCTGTTTTTATTACAGCTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTGTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCAACAGGAGGTGGAGATCCTATTTTATATCAGCATCTTTTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Boreomysis arctica
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
